The Computer Language
22.05 Benchmarks Game

reverse-complement Lisp SBCL #2 program

source code

;;; The Computer Language Benchmarks Game
;;; https://salsa.debian.org/benchmarksgame-team/benchmarksgame/
;;; contributed by Antonio Saade

(declaim (optimize (speed 3) (safety 0) (debug 0))
         (inline compl))

(defconstant +lut+
  (let ((lut (make-array 256 :element-type 'base-char)))
    (loop
      for a across "ACGTMRWSYKVHDBNUacgtmrwsykvhdbnu"
      for b across "TGCAKYWSRMBDHVNATGCAKYWSRMBDHVNA"
      do (setf (aref lut (char-code a)) b))
    lut))

(defun compl (a)
  (declare (type base-char a))
  (aref +lut+ (char-code a)))

(defun write-seq-by-n (s n out)
  (declare (type simple-string s)
           (type fixnum n))
  (loop
    with length = (length s)
    for start from 0 by n below length
    do (write-line s out :start start :end (min length (+ start n)))))

(defun process-fasta (s out)
  (declare (type simple-string s))
  (do ((start 0 (1+ start))
       (end (- (length s) 1) (1- end))
       (b #\0))
      ((< end start))
    (setf b (schar s start))
    (setf (schar s start) (compl (schar s end)))
    (setf (schar s end) (compl b)))
  (write-seq-by-n s 60 out))

(defun main ()
  (with-open-file (in #p"/dev/stdin" :direction :input)
    (with-open-file (out #p"/dev/stdout"
                         :direction :output
                         :if-exists :supersede)
      (loop
        with fasta = (make-string-output-stream :element-type 'base-char)
        for line simple-string = (read-line in nil)
        while line
        do (if (char= (char line 0) #\>)
               (progn
                 (process-fasta (get-output-stream-string fasta) out)
                 (write-line line out))
               (write-string line fasta))
        finally (process-fasta (get-output-stream-string fasta) out)))))
    

notes, command-line, and program output

NOTES:
64-bit Ubuntu quad core
SBCL 2.2.4


Thu, 05 May 2022 01:25:03 GMT

MAKE:
cp: 'revcomp.sbcl-2.sbcl' and './revcomp.sbcl-2.sbcl' are the same file
SBCL built with: /opt/src/sbcl-2.2.4/bin/sbcl --userinit /dev/null --batch --eval '(load "revcomp.sbcl-2.sbcl_compile")'
### START revcomp.sbcl-2.sbcl_compile
(handler-bind ((sb-ext:defconstant-uneql      (lambda (c) (abort c))))      (require :sb-concurrency)      (load (compile-file "revcomp.sbcl-2.sbcl" ))) (save-lisp-and-die "sbcl.core" :purify t)
### END revcomp.sbcl-2.sbcl_compile

; compiling file "/home/dunham/all-benchmarksgame/benchmarksgame_i53330/revcomp/tmp/revcomp.sbcl-2.sbcl" (written 20 MAY 2019 10:50:35 AM):

; file: /home/dunham/all-benchmarksgame/benchmarksgame_i53330/revcomp/tmp/revcomp.sbcl-2.sbcl
; in: DEFUN MAIN
;     (PROCESS-FASTA (GET-OUTPUT-STREAM-STRING FASTA) OUT)
; 
; note: deleting unreachable code
; 
; compilation unit finished
;   printed 1 note


; wrote /home/dunham/all-benchmarksgame/benchmarksgame_i53330/revcomp/tmp/revcomp.sbcl-2.fasl
; compilation finished in 0:00:00.056
### START revcomp.sbcl-2.sbcl_run
(main) (quit)
### END revcomp.sbcl-2.sbcl_run


2.58s to complete and log all make actions

COMMAND LINE:
/opt/src/sbcl-2.2.4/bin/sbcl --dynamic-space-size 8192 --noinform --core sbcl.core --userinit /dev/null --load revcomp.sbcl-2.sbcl_run 0 < revcomp-input250000.txt

UNEXPECTED OUTPUT 

1c1
< * * * omo sapiens alu
---
> >ONE Homo sapiens alu
20811c20811,41671
< TNACDRTATBNATATASTAGAAMSCGGGAN
\ No newline at end of file
---
> TNACDRTATBNATATASTAGAAMSCGGGANRCKKMCAAACATTNAGTCTRMAATBMTACC
> CGTACTTCTBGDSYAATWGAAAATGACADDCHAKAAAYATATTKTTTTCACANACWAGAA
> AKATCCTTATTAYKHKCTAAACARTATTTTDATBTVWCYGCAATACTAGGKAAASTTDGA
> MGGCHTTHAATVCAHDRYAGGRCTATACGTCMAGAGAGCTBTHGNACARTCCBDCTAAGA
> GCGGCTTTARTAAAGAATCCNAGTAWBTGACTTGAATTACWTVACAGAAABCAATNAAAC
> CGTNTRANTTGAYCMAWBADTANABRGGTKTHTWTAGTTVCTMBKTAGMTVKCCAGCANT
> TVAGSWTTAGCCGCRHTTTCCTTHNTATTAAGAAGAATAGGMTRAARTCTABGTACDTTT
> TATAAVDHAHTATAGATCCTAGTAAGYTWATDWCATGAGGGATAGTAAMDMNGBASTWAM
> TSTATRBAYDABATGTATATYCGCACTGTTTTAACMCWBTATAWAGTATBTSTATVTTAR
> CCTMTTAAKADATCAACTAATYTSVTAKGDATTATGCKTCAYCAKAATACTTKAANGAGT
> ATTSDAGATCGGAAATACTTAAYAAVGTATMCGCTTGTGTDCTAATYTATTTTATTTWAA
> CAGWRCTATGTAGMTGTTTGTTYKTNGTTKTCAGAACNTRACCTACKTGSRATGTGGGGG
> CTGTCATTAAGTAAATNGSTTABCCCCTCGCAGCTCWHTCGCGAAGCAVATGCKACGHCA
> ACAKTTAATAACASAAADATTWNYTGTAATTGTTCGTMHACHTWATGTGCWTTTTGAAHY
> ACTTTGTAYAMSAAACTTAADAAATATAGTABMATATYAATGSGGTAGTTTGTGTBYGGT
> TWSGSVGWMATTDMTCCWWCABTCSVACAGBAATGTTKATBGTCAATAATCTTCTTAAAC
> ARVAATHAGYBWCTRWCABGTWWAATCTAAGTCASTAAAKTAAGVKBAATTBGABACGTA
> AGGTTAAATAAAAACTRMDTWBCTTTTTAATAAAAGATMGCCTACKAKNTBAGYRASTGT
> ASSTCGTHCGAAKTTATTATATTYTTTGTAGAACATGTCAAAACTWTWTHGKTCCYAATA
> AAGTGGAYTMCYTAARCSTAAATWAKTGAATTTRAGTCTSSATACGACWAKAASATDAAA
> TGYYACTSAACAAHAKTSHYARGASTATTATTHAGGYGGASTTTBGAKGATSANAACACD
> TRGSTTRAAAAAAAACAAGARTCVTAGTAAGATAWATGVHAAKATWGAAAAGTYAHVTAC
> TCTGRTGTCAWGATRVAAKTCGCAAVCGASWGGTTRTCSAMCCTAACASGWKKAWDAATG
> ACRCBACTATGTGTCTTCAAAHGSCTATATTTCGTVWAGAAGTAYCKGARAKSGKAGTAN
> TTTCYACATWATGTCTAAAADMDTWCAATSTKDACAMAADADBSAAATAGGCTHAHAGTA
> CGACVGAATTATAAAGAHCCVAYHGHTTTACATSTTTATGNCCMTAGCATATGATAVAAG
> >THREE Homo sapiens frequency
> GGATCCTAATCTTTAAGCTCATTGGTGACGTATCGTAAAAACTGTTATTTATCTGGAGAG
> TTCTTGAGTATGATAATCCACTATGTTTAGTTTTGGTATTCCAAGTCATTATTACTTACG
> TCTGCTTCGTAAAGACAAGACTACATTTATATATTACTCTTCCACAATAAGGCTGCTCAG
> TACGGCAACCGTTGATAGGATAACGATAGAATGCATATTTCTAGGCGAGGCAAGACAGCT
> GATGATACTAGTAGAGCACCGTGGATTAAGCTGGTAACTCTTAAACATGTCTCGAAGTTT
> ACATAGACTATCCTGTTAACCAAGGTGTTTTCCGGTGAATTCCCTCTCATCGAAAGCGAC
> ACGACTTTATCAGTACCTACTATCCGAACACACCCACAGAAGACGGCTCAAGAGGTTCCC
> ATGAAACTATTGAACTACCAATGTGCTCCTGCGAAAGCATTTTTTTGTACATGAAACTAC
> AAGGTCAAAGTTGTCTACTTGGGAAGTGATACGATTGTAGAGAATGTAATGGCTCCAGTC
> CAATTAATTATCCTGTAGTCAACTATGTTCGACCACCAGGGGCGTTTTTATTAGTTGATA
> TAGTGGCTTGTCTATTTTAGTTAATCACAGTCTTGATTCAGTGTTCGATCATAAGTGGTA
> CAAGTCAATTGCGCAATTCAATGTCTAATAGAATGACAAACTTCTTTATCTGATTTTGTG
> CGAAGTAGTCGAAAACCGATTAAATGCGTTGCTACAAGTTGTCCCTTTCGTACTAACTTT
> AATAGCACGAACCTGTTGACGGAGAAGCTCTAAATGATACTAAGATAGAAAGCAATTATA
> CTAACGTAGATAGGAAAGTAGTCTGTGTAGAAAATGATGGAGCAAGAGGGCAGATGAGGT
> CGAGATCTAGATGATGAGGGCTTTATCAACGCCTCTTGCTAAATATCAGGAACGCCGCCA
> CGACAGTGGGAGTTCTGCGTTCTCAACATCGATGCAAATCCGGTGTACCCGCACGCGGTC
> AACTCTCCTAGACAGTTGACGTCAGACCTCATACTATCAACGTGGGATACATCCTACCTG
> CAATAACTGGAAAGATCTTACCTTGTGGCACAACTTGATAATTTTGCTTAGATCCTATGC
> GCTTCTCATTGACGGGTCAAATAAAAATCGCTGTTTACACTAAGAATCGAATCTTGCTAT
> AATCAGAAAAACACAGAGAAGTACGACTCACACGAACAACAGAGCCGGGTAGTTTATATC
> AATAGGAAAGGCCTATCGTAGTCTTATTTAAAATGAACTTTGGAAAACACCTTCAAGACT
> GAGTAATCAATTGTTCGTGGTCTCAACGCTAAGTGTTACAGACTAAAGTGTCCGAACATC
> TCCTCGGGGATTGATCAAAGTGGACCGTCCAATGAATTAGCTCACTGGAGATATTGGGAC
> GGCAGATAACGTGCTTTCATTCCATAGAACTTCAAGCAATATAACTCCAACGCGATGAGT
> CATTCTCATCCTTGGTTATTGTATTATAAGTATTTAGATATCGTAATTTCTTTGACGCCA
> ACAAAGTGATCGAGTTGGAGGACTACAATTACGGTGATCGCGGACCATCAGAGTCTGAAG
> ATCTAAGGCACGTGCGTCTAGGATATCATTAATCACTACCTAGTACAGTCCCCTTAGCCT
> CTAGATGGTCGATTACGTACGAAGGGCGCGAGCGTGATGTTTGAGTAGGTAATTAAACCC
> TTAACTAAAGCCGCACTCAAATTTTATATGTCCCTACCTGTCGTTTCACACCTAACTCTA
> GCCTCAAGGTGGTACCCGTTCTCGTTGAAGGTCGTCTATAAGTATTCAGATTAGCATCTA
> ATGCGATCTAACTTATATATTAGCACATAGGGACACGCGACCGAACTCCTGAAAAGTCTG
> ATCCCGAACAAGTTCGCGTCAATACATAGCGTGAGTGGGCTCGAGAAGGGAGGGGGCGTT
> TTTGACGAAACTTGGAGTCACTAGTGTATGTAAGAGACTGACATTACTCGCACGTCCAGC
> GTCAGCTTAAGATCGAAAAGCCGGGTATGTTAAACATATTCACTTAACTGAACTTGGAAA
> AGTATCATTCATTTATGTCACGAGTTTTTCATTGTTGCCACGCTCCACCGAGTATCTTCT
> AGCAGTTCAGGACCTGAGTATTGTCTCTCGAACCTTTCTTCAAAAATGTGAGAGACATAA
> AACGATTTGTCTCCTAGGATAAATTAGACGTACGTCAGAAAAATTGAGCGAATGGATTTT
> CTGATCATCTTCTCTTAATATTCCAAAGGTGCGAGTGGGTGTAACCACACGCGAATTTGA
> ATAGCGAAATGTATGTCGCCATGCAGAGAAAGTAAGTTTACCATGATGCACGGTCTAGAA
> CTGAATGCCATTATGATATTTAACAGATTCTTTAATCGTAACGGATTATCATATAAAGTT
> CCGTCGTTATAATCTTCTAAGTTCATTATATGCGTCACAAAGGTGCCGTGAAACCGTGCC
> ATATTGAACATTTGCAAGTCAGAAGTAATGAGATTCGTCATTAAAACAGAGTCGGAAATA
> TCTCTTCGCTTAGAGACAGCATTAATTTTATTCCTACAGCTTATCATTAGGGTAGTTATA
> CTTCGTGACATATACTCTGCCTAGCCGGTTACCTTATTGGCGACACCAGCTTTTCAACGA
> TACATTAATATTAACCGTATTAATTTACTCTAACCCACAAACTAATCGTTATTAGGGGTG
> TCGGTATAGAAGATGTGAACCCAAAGGGCGGGAGAACATCAGGGAACTCCAAAGTTGCAG
> AGATAGATGACGCCTGTATAGTTTAAGTATAGGTATGTCTAGCCTATTAGTCCCCATACT
> TATCCAACCAGACAGCCGATAGGAAAGTCCGAATAGTGTATCCGCTAAATTGTACTATGA
> TTCTGGCCACCCCAAGCCCATTTCATTAGTCTAGTAATAAAGTTAAGACTTGACAGGGTA
> TTTCCGTCATATAAGAGCTTTGAGAGTAAAACAAAATCCAGTGTTTTTCGTTGAAGGTTT
> CTCCCTTCCTGTTTACTAAGGATCCAAAGTATAATAAAAATCAGGCCAAGTACGAGAATT
> TACTTATATCTCGTGAGTTATAATTGATAGTTGGACTAGACGATAACCCGTAGAATTTCA
> CTGGAGAATGTGGCGTATTTCCTCTTACTGATTTTCACTAGGTTAACTGTCAAATTGATA
> TTCAAGCTGGACTATATAATACCTCGAAAATAGGTTCCCTGTCAATACTTTTGTTTAAGT
> GGTGTAAGGCAGGACTCGATTGACGATAGGCAACATCTCGCAACCTGAAAAAGCAGATCA
> TCGTGTCTTATGTATAATGAATCCCATCTATTGTTTGTAATATGCGGATTACACGCTGCG
> AGCAATTTTAGCTTTAGGTGAGTTCTAAGTATCGGTGATATATCAACTGTACAGGTCAAA
> CTCCACCCTCTTGACATGAAATGAAAGCCGTATAGCTAAATGACTGGTAAGCATTATTTC
> ACTTGGCTTTCTATAGTTACACCGACTCCACATCCGGATTTATTATCTTCTGTTATATCC
> GTTTAACGCGAGTATGGTGTATGTACGACTCAAGGATGTTTTTAACCGCATTGGTATTTG
> TGAAATCTAAAGCGGCTTATGTGCGGGGGTTTTTGCCACGTCTTTATTGTCCACTTTGAA
> CACTTACGCACAATTTTATACTTACATAGATAAATGGTTTGGGGTAGGTGTGAGCCTTAC
> TTCCCGTTAAGACTCACGATCGTATGATTAGAAGCCGGTAATACCGTCTAGACGCAGTCC
> CTAGGCCTGTACAGACCATCATAGTGTGGGATTCAGGCTTCCGATGTAATACTCCCACGT
> CAATAACTTGAGCAGTGGCCTTTTTCATCCCTTGCTGAACGTATTACGGAACAGTTTTAG
> TAATACTCCCGTAATGGGGATGTCCCTCTCGGGCTTGAACAAAATGTGCGTAGTGGGCCA
> TTAAGAAGCCCCTATGGTTAAGAAAACGAAACATCTTCGAGTAGTTCGGGCATCTGCTTT
> CTTCGGACTTCCACTTTATACAGTTATCGTTTGTTAAACTCGTGAATTCCTACGTTTTTT
> TTAAGAAGGGTGTATTCGTAGAAATTTTATGGAAGTAACGTGTGCGATTGACGGTTTTAC
> AAGCAATGCTCGACGCAGCTAATTACACAAAGTAACTACACATTCACCTTGTTTCATCGT
> CAAAGTTTTTACATATTAACCATTTGGTGGTGGATTTCAAGGAATAGCTAGTCATAAGAC
> GCCCGCACAGTGATTATTAGGTCAAGTCATCATGTTTGAGTAGGCCCCTCCCAATCACAT
> AAAGCCGAGATATTTACTTTGTATAAAAGGTCTAAATACAGTATACACAGACAAGATTAC
> AAGGCGCGATGGTAGGACACCTCCTCGATGATTCATGCTGCGGAGTATCGGCTGTATAAC
> CCTGATTTTCCTGTAAGGCTTCTAGACTTTAATATACTACGACAGAAAACAAAAGGTGTA
> ATAGATAGTCTTTAATAACCACTAACATTTCGTCAAGTTACTCATCACATATTTTTTATA
> TGATGGTAGGGACTCAATATTTTTTTTCTTTTACATTTTTTTTGCCATTCTTTCTTGTCC
> AAGGACGTGCGGTCGAAACCATAGGAATAATTACCGTCAATATATTAAAAATGGCCGTAA
> ATAGCGCCGGGTAAGGCGGGATAGTAGCCGAGACCGATCTTAGTAAATATAACTTAAACT
> CCTACGATCCATTAATGAATCCGTGTAGCATATCGACTATGGTGGATAATAAGCGTCACG
> GACGTCCATAAATGATAAAGTATATGTATGCAGGGCAGCTCCAGCAAATCAGTTAGTTTA
> AGGGAGGGGGTTACCTAATAAAAAGGATGGGTGACTTTAGTCGCCAACTCAGCATAGCCA
> TTTCTTCGCAATAACAGAACAAATACTGGTGATATGGGGTAAAAACTCATTCTTAGTGTA
> TTGCACTCAGCATCAGGGAAGCATGGTAAATTATACCCAGTTGTAGCTTCGACGTCATCC
> TTACGGTGGCGCACCCTATGCAGAAGATCGTTCTTGCAAAATGCTGACGCTGTGTCAATC
> AAAGGGGGGGGTCGTGAATCACTATGTGAGAGATCCGTCGAATCGTGTACGCCAGTATAT
> AATATTATTAACTGCATTTGGCTTCCATTATAATCCCTTAGGTGCTACCTACGGATGTAT
> CGTTCATTTATTATGGGCTCTAGAGAAATTACAGTGGTAGCTCTGAGCCTCTTAGCAATT
> CGTCAAGATTTAGGGTCCCAATCGACTCCTTGCGGCGCCCGGTACTTTACTCTTAGTTGT
> CTCGAAGAGGGTGCTTCGCCTCAAAGTTACAAAGATCTTCAGTTGATATGATCGGTAGTC
> TTTGTGTTCTGTTTATATTTCAACTACAGGAGCACGTCGTTTAAGTGGTAAGGTATATGG
> CTCCAAGCGACTGACTATTCTAGCCGCAAAAATACGGTCTTTCGGAGTTAACGTATGTTT
> GAAATTTTGTCGATCAGGTTCCAGTAGCATAGGCCCAAAGATTGAATCCAATTTTCAATC
> ATTTACGGACATCCTTACGGCTAAATTAAAAATGGAACAAAATTTAAAATCCTATTGCTG
> CGCATGCACCTGGACTCGCACAACGCTGCGGCTCTACGTCCGTCTTATGCGATTCTTTGC
> CAACCTTATTTCTTACCGATAAGCAGGTGAAGAAACTAGTGATTTAAGTACTTGTCCGCG
> CACAGCCGATAATGGGTCAAGGTTATGAAAACCTCGATAATGATCAATGATAGCACATGT
> CTGGTTACCGGGCTTTAGGCAACCGTGACATATGGTTTCTTGCTCTTCAACTTCGAAGTT
> CGCTCATTATTCAAAGTTCCAGGAGCTCTATATGGCGTATGTGTGTCATTTTAATATACT
> GAAGTTACCAGGCATCACTATAATAGCTTCTACAGCATAAAAGTTCTTTTATTTGGAATA
> AGTAGGGCTGTTAACCGGTCCAATGGGGTATCATAGGTAAGGTTAGCATCAACTCAGCTT
> AGTTTGTATTCTGCCGTCGCAAACTTAGCATATAGGATATCGACTGATAAGTAATCCCAC
> GGTGGAGGTGGCGCAATGATCTTTATGCTTGCCACCTGGATATATCTTTAAATGTCAGTT
> TAGGTCATACTATTAAGATTGTCCCATTTCTAGTAGTCCCTTAAAACAAACTCTATCTAT
> TAGTAAGATTGCTTTGAAGAGGCTATTTGCCTACAAGGAGGTTCAAATATGCTCGAAGCA
> GTTGTTTCGGACTATTAACTAAACTTATGGAAGATGGTATCCATTCGCTAAGAGTGCTAT
> CTCTGGCTTACTAAAGAGTTAGACAACTATTGATGTCCGCTCACATAACGTAATATCCAA
> ACGTGTAGACAATAGCAACACTAAACGTATTACTATTTGAAAAATGAATATATTCCAGAA
> CCACGTAGCGCCTGGAATTGCCAAGAGCTCTGATGAAGTGAGACAATTGGCTATTCTTAT
> TGCATTGATTCTGAAAACGCTAGCTTATCCCCAGTGGAACAAATGAAGGGGAAAGGGTGG
> GAGGTAGTCACATTGATCATAACAAGTTCGATATTTAGATGGCAGACGTTAGGGTAGGGC
> AGTAATCGGGATTGGGCTTTGGCTAACGGGAGTTATGTTATAACTTTTCGTTGAGTCGTA
> AGGATCTCACTATCGCTCCGTGGGCTTTACATACCAGATAAAAAAGTAGACCTGATATGC
> TCTAGCACTGAATATTTTTAAAAATAATCGGATTTTAATCCAGTGCAACAGATCCGAGGT
> GCGTTCCATCCCTTTTCATTAGCTGGCTTTCATCATATTGTATTGCATTACTTTCTCGTG
> CAAAAATTGTACTCAGTTTAATAATGAGACGTGTGAGTTTTCTTATATCCCCAAGGTAAC
> AAGTTTCCTTGTGTACGGGACACCGCGGTGGAATGCATTGTATATCGATAGCGGTGTAAG
> ATGCCTCACAACGAAAAGGATGACTGTTTCCAATTTCACTCAGAGTAAGACTCGAAGAGC
> CCTTAATAAATTATATGACCGAATATCCTGAGACCCGATGTTGAATTTATTAAATTGACC
> ACCCTGGATACCACTTTCTGAACTAAAAGATGCGTTTCATTCTTAGGACTGCTTTATTAG
> GGTTGTAGAGGCAGTAAACAGCATAAATAACTCCTACAAAGCATTAGGTTCTGTGATTTC
> CATGTCGTTAATTAATTTTAAATTAGTTAACTATTTCAAAGGAACTCAAAAACCTTGTAT
> ACCTAGTCACTATCGAGGCGTTTCGCATAGGGTATTGCGACTGCTCACTTTGTCAATCGG
> TAAAATTTAAGGGTTTTTACTATGACTGAACAAGGTCTTAATTAACTCAATCCAATCCGG
> CCTATTAAACTTTTGGTTAGAATTCTTCATGCAAGGTCTCTCGGTGAGGTAGCGAAATCC
> ATGTATTAGCTCATGATTGAGCTCTCCAACGATTATAAAACCCATACATCCGAAATCTTA
> TATCAAGCCCAAACTTTAGGATAGAATCTCATTTTGCTTAGGATTGCCCACTGGCAATTA
> AACTGGTACCATCTACATACAATCCTTTGTTTAAACGCGTGGTCGCTAAAAATATAGCCC
> TTAATAGGACCGGTTATCTATTGGATTGTCACTAAATAAAACATAATTAGACCAAATACG
> TGGGTGAGTGATCGACGCAATATTACATTTTATTTGAGAACCCATGGCCCACGAGTATTG
> TGTATCACTAACATTAACCTGTATACTAGAGGTCACATTTTTATGATACAAGTATTCATC
> CCGATTCGAAGATGCACATTACGTCTGTTTTTTGGGATATACGTCGATAATATCTTTCTC
> TGTGAACCCTTTGCTAATCAGGAATCCGGGCTATATTTTTTGGATCATCAATTAGTGAAG
> CGTCGGGCGTGAGATGGTATAGTTTCCAACGTCAGTCTTTTCCATGCCTGGTCAGTCCTG
> TGGACGAAATATTGAACAGTTTCCCCCTGACACTTCCAGGAGTCTATTTGATATCATCGC
> TAACAATTCTATGTGGTGGTGTATGTATTCTCTTTAGCGCTAGCAAGCCTCATCGTAAAG
> TATGATTTGGGATTTAGTACTAATGTAAAACTCATCGGCTCACTATGGTGAAGCAGGTAA
> CATTGTGAGCCTTCATTCCTTTGACCCTTTTAATCAGTAACACGTCCCTCCAGGATACTG
> CGGACCTGCGTCGTGTAGGATACTAGTAGGACCCCTATGAAGGCTTCAATTACTGATATT
> AAATTCTAGAAAACCCATTGTGAAAAAATTTCGTCAGTATCAATTAAATAACCTGTTAAT
> GGAGCATGATAATGACATAATTCAAATTTTACTTGCTATGATGATTAACTAGTCGCGATA
> AAATCGTATCATCATAATGAAACTGATCATCTCACTCGTCACCACCTCGCGAGCAAGTTC
> CTGGCAAGAGCGCCAGCACAAATGCTATAAGCTCGAGGAGTCAGGCCATAACGGAGGATT
> TCGATGATACGGGGGTTGTTATTCTAAGATAAATCTTATTGTGGATGTTTTTTGTACACT
> CGACTATAAATTAAAATAGCTATATAACTCGTGGATGAATTCAACTTGACCAACTGTGGA
> CTAGCATTTTAACTTTAGTCGATCTTCGTCTTCTCAGTAAATTTTGAAGTGACCCTCAAT
> TTCGGACGAGCAATACTCAAGTTTCAAAACAGCGGCGGAAGAGCGTGTCATAATATCGCT
> TCCTTATGAGCTTTTCTTACTTAGATGCCAGGAAACTATTATTTGAAAGAGTCCCGAATA
> CGAATCTGGACTATTGCACAACCATTAAATAAAAGTCGGGTGCTTGGCCAATTGCTGATC
> TGCTAAGTATTATTTGTGGACGAGTCATGTAGTCCACGGCACCTATAATCAATCATGATT
> ATTAGACTAAAACTTAGGTTAGTCAACACAGTGCTTTGGATAAAACCTTCTGAGTATTGC
> CTCTATCTGAATAGAGAAGGACGCAATGTGCTAGGCAAAATCTACCGTTTTGTAGATTAT
> TAGATCGGTTTAACATATTTAAAGCAAAGTAAGTTCTACCAAAGATATTTTACAAGTGAA
> ATGCTCACACTGTGTATTCTCATCATATTCCGCGATTTTAATGTTGTTAACACAACGATT
> ATTCTGTTTACATTTCGCTCAACTTATACGGAGGAAGTACTGAAAAACCATAAGCCCGTT
> CAACGTCACTCCGCCTTCTTCTTGGGGGATTCGCTGCCAATTTAACTGAACTCAATGTTT
> CCCCCTGGGTTCATATCATGTGTGAACGATATGGTTGCATTTTAGGATAGATCTCAGCTG
> TACTTCCACTCGCGGACGTTCAGCTGAACTGTATACACAGATCTATACTATGCCCTAACT
> AGTCGCATCGCTTATTCATCTATATGATCACATGCATACAAACAGAAGATCGACTCCAAG
> AGCCTGTCCTCAAGTCTGAGTAAATTTATGGGTGCTAGGTATAATGTCAGAATTGCTGAC
> CAAATGTAAGTATTGGTATTATCAGGGCTACATGGGCGCGACGTCCGCACCTTCATAGCA
> GTGCAATCGCATTAGGCATGCCGGTAATAGTAATCTACTTTCTTAGTTTAGCATGTCATG
> AATCGCATATGCCAGTGACCTATGGACGACAACCACTCACACAGACATTTCCTAGAAGAC
> TGAAATAGACTAATGTAAGCTCTCAAACTTAAGCGAGATGCAGCTTTTACAAATGGCTTG
> AGTACCCCTTCTTTCCACGCAGTCTAATCAAATAATCAACATATATAATTTTTGAGTAAT
> TCAATGCGCTCTATGAAACGACCGAAATTGCAAATACGATGTAGGTATTTTCACCGTGTT
> AGCCACATATGCGAACGACGTTTGTAACGGTGTACTGCGCCACGCAGCATTATAATTATC
> CTATAGTACCATTAGAATCTCTTCGTGTAAGCTAATCCATAGCGAAATCCCAACTAAAAA
> CAATTTCAGGTCACTCACCCGGCGGTATATGGATTATGCCTTTACGCTCGGGCAACTCTC
> CATACAACGAGGGATGTCTAAACAATAATTCTATGTGAGAACACAATAAATAATGGGAGA
> GGGCGAAAATCCGATGTGTGGTAGAAAGGATATTTCCCAACGCTACGTTCCGTGAATTGT
> TCTCCGCAAAGATCCGGTCTACTTTTGAACTGACCAATTTCTGACACATTCCTTTTTAGA
> CCGAGAAGAGCATTGGGTCCCCCTCAGTGTTCGCCAGCGTATTGACGATTAATTTTCATC
> GTCTCTCTAACAACGTACCTAGTATTTAGGTTATATATACCTCTTCGTCTCGATCGTCGT
> ACATCCAGTTTCGAAGGCATAAACACATGATCGTGGATCTCAATGCTGACGAAACACTTA
> CAGTACTAATGAGTGGTGTAACATGAACTGACCGGGCAAATGGGGATCTTTTCTATCACT
> GTCATTCAGATTTCCATGTTTCCTCATTAATTTCATATTGTACACCAATTGTACCGATAT
> CTGAACTTTATGAATCCATAATTAAGTTGATCAAAAAGCAAGTAAGTCGGTTTCTGTAGA
> CCTCATGGATCACGTGGCAGTCATTCTTTACAGTGAAGGGACTTAATTATGGACACTTTC
> CATGTACATATTATCCATTCTTGGGATAAAGAGTCTGCCGATAACAAGTCATGACACCCC
> GTACATGCAGCACTAAGCAAGGTAAAGGACGAACCTAGCACAATGTGATCGGATATTGTG
> AAATTGACCTTAATGAAGCGACTCGATCAACCTATAGGCTTGCTTTCGTACATTACCGGA
> ACAGCCACGACAGTTCACAGAGATTGCCTAACGCCAAGCGGGTGCTTCAGTGGACCAGAT
> GCACTAATGTCTTACTAGTTAATCAGTAATAGACATTATTCACAGTTCTTCTAGACTTTC
> TGTCACGTTTTTTCATTTCTCAATGTAGACCAAATAAAGAATGCTGCGATGGTTTTAAAC
> TTTGCAACGACTTGACGAAACTAAAGTGTCTATTTGGACCTGAGTCACACTAACAATTCT
> GCACATCCATATTTTGGAAATCATTCATTGTCCCGAGCAGTAGAGGGTTTCCGGCTAAAA
> CGGGTGTTTCACATACCGCTTTATATGTGTAGTAGCCATAACTCTATGCCATCTGAAGTG
> AATGATTTTTAGTTTAGAACAATTAATTGTCCAAACTGTAGTTACTTGTGTTATTCATAT
> CACAATTTATATTATACTATATTCGTTAACATTAGGAAACGGGGTCTCGAGGCTCGCAAA
> TAGTATACGAACGGCTCCAGTCGTTCATTCAGTTGTGTAAGATACCATGCTAGAAGCACA
> TTTCAAATACCGTCTAACTATCAGAATTTGTATAGAACCGTGACACAATGACTGCCATGT
> AAAACTTTATACTATCTTCAATCCATGCTGGTGAAATGTTAAGGGAGACATTAAATATTG
> AATTACCCTGTCTATAACTGGTCACCAGCAGATGATTTTTGAGCTTTGGTGAAGGTTAGT
> ATAATCGCGTATTTAGATCCTGAGTTAGTCACTATCAGAATAAAAGAGCTTTACTTTTCC
> TATTCCTAGGCTTGTGTACTTTCCGAGGATTAGGAAACACAACAAGACATGTATTTATTA
> CTCTGACAAATTAACCAGCCTAAGTAACGCAACAGTTGTTACCATTACGTGAGAATCCAT
> ATTGCTTGCACAGGCATGAAAGCTGATCAGACTAGTAGACAACAGTGGTTTATGATGGTA
> ACTATTTAACATGGCTCCAACTTTTCTGACTCTAGCCTGGTAAAAAAGGTGTTGGCAGCT
> GTATGAAATCGCAGCGTATGCCACACGACGGTTTATGTACCTACTATCCGTACACAACCT
> AAGAAGAAGGCTAATGACGGTCAAATGAATATATTCTACTACAATTGGCCTACTCACATA
> GATGTTTTTTGTAAATCATACTACATCGGAAAAGTGGTATTCTTCCGATGGGTGACGATT
> GTACACAAGGTATTCGATCCTGGACAATGATTTAGCCTCTTGTAAAAGATGTTAGTCAAC
> AAGGGGAGTGTGTTTTTGTGCATTGACGGGATGGTAGATTTTACGTATTCACACGCGTGA
> TGCACTCTTCGATCTTATGGCCGACAACGATATTGAGCATGTAATGGTATAATTGTAGCA
> CTAACTTCTGTATCTCATGGTGTCCGTAGTAGTCGTAAAAACAGGTAAGGACTGGCTACT
> AGTTGTACATTTACTACTAACTTTATGAGCACCAACCGCTTCTCGGACAAGCGAGTAAGC
> TGTAGAAGAGAGAAAGCAAGTATACTAAACTTGATACGATTGGTGTATCGGTAGTATATG
> ATGGAGCAAGACGGAACTTGTCGTCCTGTTATAGTTGATGAGGGCGGTATAAAAGCATAT
> TGATAAATTGAAGGAAACAAGACTACACACTCCGAGTTCTCAGTTCTAAAAAGAGAGCCA
> AATCCGGTGTACCACAACGACGGAAAATCTCAGAGAAACTTCTACTCTGACATAATAAGA
> TAATACTGGCATACATCCTTAATCATATTAAGCGTTAGTTCTTACCGGGTCCAACTACGT
> CATTATTGTCCGTAGATAATTTGCCCTGCGCAGTGAACGGGCATATAAATATACCTGGGT
> TATCGATGAATAGAATCTTCATAGTTGAAGTATATATCAGAGAAGTACGTCGCAAAACAA
> CATAAGAGAACGGGTCTTTTTTTATTGTCCAAAGCACGATACTACTATTATTTAAAATGA
> TATTTGGATAACTCCTTAAAGAATCTGTAATCAAGTGTTCCGGGGCTCAACGCTAAGTCT
> TTAACAATAATCGCTCAGAAAATCGCATACCGCATTGATAATAGTGCTCCGTACATTCAA
> TGACCTCAATGGTGATTTGGGGACGGCTGATTACGTGAGTTATTTACATACAACGTAAAG
> CTTGAGAACTACTAAGACTTCACGCAGTCTAATAATTGCTTATGCTATTATAAGGATTTA
> CATTTACTATGTGCTGGGACGCCAAAATAGTCATCCACTTGGAGCAATACAATTACCCGC
> ATAGACGACCAGATGAGTCGGTAGAGATATGCAAAGTCCGTATAGGATTTCATTATGCAC
> GAACTTGTTAAGTCCACTGACAATATTGATGCGACTTTACGTACGAACCCCCACACCGTG
> ATGGTGCACTTCCTATGTAATCCAGTAACTAAACCCCCTAGCTAATGTTTTATCTACATT
> CCTCTAGTTTATCTACTATCTCGAGCCTCAACGGCGTACCCCGTCTCGTTCAAGGTCCTA
> TTTTACTTTGCTGATTAGATTAGTTTGCGTTCTAACTTATATAGTAGCACATAGCCACAA
> GACAAACAACTAATCAAAAGGCTGTTCACCAACTTCTTCGACGAAAGAAAGTGACTCTCT
> GGCCTACTCATGCGAGCCGGAGTTTGGCACCAAAATGCCTCTCACTAGGCTTTCTAACTC
> TCGCTAAGTTAGAGCACCTCAAGCGGAACCTTATCTGACTAAACAAGCCTATCTGTATAA
> TAGGCAATTTACTCAAATTGGATAACTATAATTCATTTTTCGCTCGAGGTTTTCATTGGT
> GACACCATACACCGACTATCTGCTACAACTTATGGACATCAGTTTTGTCGATAGATACTT
> TAGTCAATAATGTGACAGACATAAATAGTTTTGGCTCATAGCATTAATTTCTCCTAAGTA
> AGATTATTTCAGCGAATGCATTGTCGGATAATCGTCTATTAATATTACTAACGGCCCACT
> CGGGCTTACCACAACCGAAGTGGTATACCGATATCTAGCTCCCCAGCATCACATACGAAC
> TTTACCATCATGAAAGCTCTTGATCTCAATGCCATTATGAGATTTAAAAGTTTATGGTTG
> CGTAACGGTTGATAATAGAAACTTCCCTCCTGATAATCTTCTATCTTAATGATATGACTC
> ACTAAGGTGCCGTCTATACGTGACAGATTGAAATTGGGAAAGTCTCTTCTTTGGACATTA
> GTCATTTAAAATGAGGCCCTAAGAGCTCGTAGCGGAGACAATCATTTAATGTTATTAAGA
> CAGATTATCATTAGGGTTCGGTGAAGGCCTGTATTAGAATATCCCTACAACGGTTAATGT
> TTGGCCTAAACACATTTGCAACGTTAAATTAATATTAACCCTTTTATTTGACTCTTTCAC
> ACTATCTAATCCTGAGTACGGCTCTACGTATAGTAGTTGTCATCCCAAACGCCCGGACTA
> AAGAAGCGAACTACAAACTTCCTCACATAGATGTACCATGGTGACTTTAACTATACCTAT
> CTCTAGCATTTTTGTCCACATACTGATAAATCCTCACAGCCCATAGGTAAGTCCGATTAG
> GCTAGACGAGAATTTCTACTATGATTCGGCCCTAACATTGAACTTTTAATTAGTATAGTA
> ATTATCTTTAGTCGTGAATGCGTAGTGACCGAATATTACAGATGTGACAGGAAAACTTAT
> TACAGTGTTGTGCCTTCAAGGGTTATCACTTCCTGGGTACTAAGCAGCAAATCGATAATA
> AATTTCTGGAAATGGACCAGATTTTTCGTATAGCTACTCAGTTATAAGTGAGAGTTCCAA
> TACTCGTTAAACCGTTCAATTTAAATCGAGTATGGGCCCTATGGCATATGAAGCTGGTGA
> AAGACCTTTACTGTCAAATTGATATTAATGCTCGACTTTATAATACCTAGAAAATAGCTT
> CCCGGGCAATACTTTTGTTTAAGTGGTGGAAGGCACCAAGCGTTTCACCTTACCAATCAT
> CTAGATAACTGTAAAACCAGATAAGCCTGTATTAGCTAGAATCAATCCCATCTAGGGGTT
> CTAATATCCGGATTTCACGCTCAGAGCTAGTTTACCTGTTCCTCTGGGATAACTATAGCT
> GATATAGCTACTGTACAGCTCATAATACAAACGATTCAATTGAATGCAATGCAGGAGACC
> TAAATGTATGCTTAGCTTTTTTTCACTTCCCTTTAGAGAGTTACACAGTCTACTCATCCG
> GATTTAGGTTATTCTCTTAGAGCCGTTGTTCCCGAGGTTGGTCTTGCGACCTCTCAAGGT
> GGGGTTTATCACAATTCCTATTTGTGTTTGCTTAACCCGATTTTCGCACCGCGTTGGTGC
> ATCGTCTTGATTGGACACGTTGTTAAATTACCAACTAGTTTTTTAGTACATAGTTAAAGG
> GTTGCCCCTACGTCTCAGCCTTTAGGCAACGGATGTCTAAAGAGAGTTTGTGTTGAACCC
> GCGAATTCAGGCTAGAAGAAGGCACTTGCAATCTTAAGTCCATAAGAGTGTGCCTTTAAC
> GCTTCCGTGGTAATAATACCTAGTCATGTAAGTCAGAAGTGCCATTTTGAATCACTGCCT
> CATAGTATTACGGAACACGTGTACTTATAATCAACGAATCCCGATCTCCCTCGAGCGAGT
> CTTCAATATGGCAGGAGTCGGACATTATCAACAACCGAGCCTGAACAAAACGTAACAGAT
> GCCAGGAGTTCGCCAATCTCCTTGCTTCCCACTGCCAAGTTATACACTTATCGTGTCTTA
> ATCTAGTGAAGTACTACGTGTGTTTTAAGATGCCTGGAGTAGTAGAAATGTTATGCATCT
> ATCCGCTGCGATGGTACCGGTTTATAGAAATGATCGAAGCAGAGAATTAAACTATGTTTC
> TTCAAAGTCACCTTGTGGAATCGTAAATGTTGTTACTTTGTATCAAGTTCGTCGTGCAGT
> TCTAGCATGAGATACTCTTAACACGCCCGCTCTCTGAGTTGTAGCTATAGTCATCATGTT
> TGACTAGCCCCATACATAGCAAAGAAACACCACATAGTGAAGTGGTATAATAGCTCGAAA
> GACAGTAGTAAATGACTAGATTTCAACGAGCGAGGGGACCAAAACTCATCGATGTTTCAG
> CATCAGGTCTATACCATGTAGAAACCTCATTTGCCTCTATGCAGGCTACTCGTTAATTTA
> CGTCCTATCATATCAATAGGTGTAATAGTTTCTCTTTATTATAAAATAAAATGTCGTAAA
> CGTACTATTAACATTTTTTTTATTGCATGCTTGGCAATAAAGAGGTGTTTTCTGTGACAT
> TTTGGTTCCCATGAGTTCGGCTCATTCGACGTGAGCGCCTTAAAATTCGTTTTTTTACCG
> TCAAGTTTTGAATAATGCCAGTATATAGAGCAGCGTATGCCCGCTGACTAGACGTCAACC
> ATATTTCTTATTATTAATTATAATACTACGATCCTTTAAGGAAGACGTCTAGCATATAGA
> ATATGCTGGTGTTTAACCCTCACGCACCTAAATTAATGATTAACGAGAGCTTGCAACGCA
> AGCTCAAGCATATCACGTAGGTTATCCCACGGCCTTACCTAATATTTACGAGGCCTGACT
> TGTGTAGAATACTAACAATTCAATGTTCGTCCATTGAACAGATAATTTACTGCTGTTATG
> CCGGAATATCTAATTAGGACGGTATTCATCTAAGCATAAGGCTACATTGGTTTAGTAGAA
> ACTCGTGTAGCGGAGTCGGCTTAAGGTACGTCGCCAAACAGATCAACTACTTCGTTATTG
> ATTAATCCTGAAGAGGTCTCAATAATACGCGGCCGTCGTCAATCTCTAGGTCAGACTTCC
> GGAGAATCGGGTAAGCCAGGATTTAATTTGATGAACGGAAGTGCGCTTCAATTATAAGAC
> CTTTGGTCATAAAGACGCATCGATACTTCTTTTATTTGGGGCTATACACTTAGTACAGTC
> GTACAGCTGACAATAGTAGAAATTAGGCAAGATTGAGCCGCCCAATCGAATCCGTGCCGC
> GCAAGCGACTTGACGCGTTCTTGTCTCGAAGTCCCTCCGGCGACTCAAACTGAAAAAGTT
> AGTCTGTGCTGATGAGCGCTACGCTTTCTGTTCTGTTTAGATTGCATCTAAAGCACCACG
> TAGTTTATGGCGTTAGGTATATGGCTCAAACCCACGGACTATTAGTCACCAAATAATTCG
> CGCTTTCCCTGGTATACTATGTTTCAAATTTTCGCCATAAGCTTCAAGGACAAGAGCCAC
> AATGTGTGTAGAAAATTTGCAAGCAGTTTCGCACTTCATGACCGCTATAGTAAAAATCGT
> AAAAATGGTTTAAGCCTTTTGCTGCCCTGCAACCGCGACTCGAAAAAAGATGCCCATCGT
> ACTCCGTATTTTGACATTCGGTCACAACCTTTTTTCGGACCGATATGAAGCTGAAGTAAA
> TACTCAGTGTAGGACTGCTCAGACCACAGCCGATTATCGGTAAACGTGATCTAAAACTAG
> ATAATCATAAATCTGACAACATGTATCGTTTCCCCGCTTGACGCAAACGGGAAAGTTGGG
> TTCTGCCTATTCATAGTACAAGTTAGCGCATTATTCAAAGTTCAAGGAGCGAGATATGGA
> GTATGTCTGTAATTTTAATAGACTCATCTGTACACGAATCACGATATGAGCGGCTAATGC
> TTAAAAGGTCGTGTAGTTCGTATAAGTACGGAGCTTATACGGGAAAATGGGCGATATTAC
> CTAACGTGTGCAGCAAATCAGAGTAGTTTCGATTCTCACGGCCCAAAATTAGAAGATACG
> ATAGAGACGCTTTTGGAATACCACGGTGCACCTCGAGCAATGAGCTTTATGCTTGCAACC
> TGCATATATCTTTAAAGGGATCTTTTCCGCTGACTAGTTACTTTGTCCCATGGCTACTAG
> TCAATTTATACTAACGCGAGCTATGAGTTACATGCAGTTGAACTGGAGTTGTCCATTCTA
> CGACCGGCAAATTGCCGCGTAGCACGTGTTTACGAATAGGAACTAAAATGTTCGAAGAGG
> GTTTAATTTAGAGTACACTGAGAGATATCGCGTAATAATGTGGTACAAAAATATGCATGT
> ACCCGCAAAGTAAGTTTTTTCATAACCTGTAGTCAATAGCAACAATTATCGTATTACGAT
> TTCAATATGGTATTGATTAAAGAAACACGTAGCGCCTGCATTGGACTTGAGAGCGGATGA
> AGTCAGACAATTGCATAGTCGGATTCCTTTGATTATCTAAACGATAGATGTTACCCAGGC
> CTTAAAATGAACCGCAATGCGGGGGAGGTTGGCTCATTGAGCATAAATTCGTCCATATGT
> TGATCCCACTACGTTGCGTAGGGCTGTATTAGCCATTCCGCTTTCGCTAACGCGTGTGAT
> GTGTGATCTTGTACGTGAGTCGTAACGATCTAAATTTCGCGCACTGGGATTTTAATAACA
> GAGAAAAAACTACACATCATTTGATATAGAAATCAAGATTTTTAAAAATATTACCATTTT
> TTTACAGTCAAACAGTTCAGACCTGCCTTACTTACCGTGTCAGGTGCTGGCGTTAATAAG
> TTTCTATTCAATTACTGTCGACTGAAATAATTCGTATCAGTGTAATAATCTGACGTGTGA
> GTGTTCTTTGATCACAAACCGTAAAACTTTCCGTCGCTAACGCACACACCCGGGGAAGGA
> TTTGTAGATCGTTACAGGGGTATGAGCCCTATCTAACTATTCGTGCTATGGTTCCATTTT
> AAATCAGACTAACAATAGAACAGCCATTAAGAATGTTTAGGACCGAATAGCATGACACCC
> CATCTTGAATTTATGATATTCTCCACAATGGATACAAAGGTCTCTTCTAAAAGTGGCCTT
> TCATTCGTACGACGCCTTTAGTTCCGGTCGAGACGAAGTTAACTGCATAAATAACTCATA
> CATTCCAGGAGGTTCGCGGATTTCCTTGTCCTTATGTAAGTTTAAATTACTTAACGTTGT
> AAATGGAACGAATAATCATTGTATACAGACGCTATAGAGTGGACGTTCGCATAGGGTATT
> GCGTATGATCACGTTCTCTATCGGGTAAATTGATGGGGGTGTTCGATGACTGAAATTGGG
> CGTAATGTAAGAAATCATTTCAGGAATATTAATATGGGCGGTACAATTATGCATGCTAGC
> TCTCTCGCTGAGGTTGAGTATGCCTTCTAGGACCTAATGATTGTGCTATACAACCAGTAT
> ATAACCAATAATTCACAAATATTTTTGCATCCAAAATCTGTTGCAGTCAATATCATTTTC
> CTTACCATTCAACTATGCATAGTTAAATGGTTAAATCTTCATACAAGAATGGCTGGAATC
> CCGGGGTCGAGATATATATACCAAGTTAGAGGAACGCTTATCGATTCCATTGTCAAGAAA
> TAATAATGTTTGTCTAAATTTACGTCGCTCTGTGATAGACGATAGATGACTTTTTATTGC
> ACATCCCAGCCCCAACCACGATTGTGTATCACTAACTGTTTAATGTTTAATTCAGCGATC
> TTGTTTATGTGACAAGTATTATGACCGATTACAACAGCCAAAGGACGTCTCTTGTTTGGG
> ATATACCTAGAGTATATCTGTAGCTGGCAACCCGTTCCTTTTAACGAATACCGGCTATTT
> TGTTTGCTTCATCAATTAGTCAACACGCGGGCCTGACTGGCTATAGTTTACATCCTCAGT
> ATTTTCATGCAAGCGTCACTACGGTGGTCGTTATATTGATAAGTTGACCAATGAAAATGA
> CAGCTGTCTATTTCAGTTCTTCCCGATCAAGGAGTTGTCCTGCTCTTTGGTTTCTCGGTA
> CCCCGTGCAACCAGCTTCGTTAAGTTTGTTTTCCGTTTTTCGACTAATCTAAAAATATGA
> CGCTAAAGATCGTCAAGAAGCTAAAAGTGGCAGCCTTCTTTCCGGTGAACCTTTGTTTCA
> GTAAAAACGCAAGCCAGGTTACTGCCCACATGCGTAGGCTACGATTCGAGTAGGAACCCT
> TTCTAGCCGTCATTTACTCAGATTAATGTCTTGAAAAAAAATTCTGAATTTATTTACGAA
> GTATAAATTAAATAAAATGTTTATGCTCCTTGATAAGGACTTATTTCAATGTTTTATTCC
> GATCATCATGATCTAGTCCAGATATAATCGTTGCTTCATAAGGTATCTGATATTCTCACT
> CGGCACCTCCTAGACACCAAGTTCAGCGAATGACACAATGATCAATGGCGATTTCATAGT
> GCACTCTGGCCTTAAAGCTGGATTTAGAGCATTACCCCCTGGGTTTTCTAACATAATTAT
> GATTGTGCTTGTTGTTGGTACTATCGACTATAAATTAAAATACCTTTATAACTCGTGGTT
> GAAGTCAACTGGACCAAATGGGCACTACAATTGTTAATTGTCTCCATAGTCGGATTCTAA
> CTAATTGTGCATGTCACCATCAATTGCGGACCTGCAATAATCAACTGTCTTAAAAGAGGC
> CGAAGTGACTGTCATATTATAGAGTCCTTTGGTGATTTTATTAATTAGATGCCAGGTTAA
> TAGTTGGTGAAAGACTAACGAATACGAATCGGCTATATTGAAAAACCATTTATTAAAAGG
> AGGGGGATTCGAATTTTGCTGTTATGCTTAGTATTTGTTGGGCAAGAGTATTGTAGTACA
> AGGAACCGATAAGAAATCATCATTATTACACGTAAAATTACGTTTCGCATAACACTGATT
> TGGAGAATACATTCTGAGTAGGCCATATTTCTGAATAGACAAGCTCGCTATGTGCTACCA
> TTATTCTACCCGTTTGTTCATTATGAGATCCGGTTAAATTATGGAAACAAAAGGTAGTTA
> TAAAAAAGAGATTTGACAACTGAAATCAGATCACTGGGTTGGCTAATCAGATTCACCCAG
> GGGTTTGTGGTTAACACAACCATTAGGAGGTGTTCATTTACATCAAATTTTTACCACGTA
> CTTAGGAAAATCCAGAAGCACCTTCAAACTCTCTACCCATTCTTCGTGGGGCATGAGATG
> CAAATTTAACTGAACTCAAGCTTGACACCTCGGGTATTAGCTTCTGGGATCGATTTCGTG
> GCTTTTTAGGATAGAGATCACCGCTAATTCCACTCGCGCTCGTTCAGCTCTAAGCTTGTA
> TCACATCGATTATTTGACATAAATAGGCGCATAGCTGTTTCATCTATTGGAGCTATTGAA
> TTATATCAGTACATAGTCTCAATCACCCGCTCATCAAGTATCAGGTTTTTTATGGGTGAT
> AGCGATATGCTAACAAGTCATCAAAAATTGTAAGTATTCCTATTTGCAGCCCTACAGGCG
> ACCGTCCTAAGCTCATTCTTACAAGTGAAATCCAAGTACGCATGCCGCTAATACTAATCT
> AAGGTATTACTGTACAATGGCATCTAGACCATATGCATGTGACATATGGACCTCTAACAC
> TAACAAACTAATTTCAGTCAAGACTGAAATTGAATAATGTTTGCTATAAAACTGAAGCGA
> CATCCACCGGTTACTAAGGGCTTGTCTACACCTTAGTTCCTCGCAGTAGAATCAATTTTT
> AAAAATATTTAAGTTTTCAGGAATGAAATGCGAGCTATGAAACGTCCCAAATTCCTTAGA
> AGATGTACGTTTGTTCACACTCGTAGCATCAGATCACAAAGAAGTTTGGATAGGTGGAAT
> GAGCCACGATCCATTATAATTATAAGATAGTTCCATGAGTATAGAGGCCTCGAACCTTAT
> CCTTTGAGTAATCACATCGTATAAAATGTTCAGCGCACTCTCCCCCCGGGATATGGTTTT
> GCCAGGTTACCTACGCAAACTCTAAATACAAAGAGGGAGCTATATAAAATAATGAGATCT
> GTCATCAAAAGAATTAATCGCACACCGCCAAAATCACTTCTCTCGGTGAATCGAGATTTA
> CCTACCCTAAGGTAACTCTTTTGTTCTAAGCAAACATCACGTATACTTTGCTTCTGACAA
> TTTGAGGAATAATGCCTTTTTACTCCGACAACAGAAGGGGCTCCCACTCACTCTTAGAAA
> GAGGATTGAACATGAATTTTCAGCCTCTATATATATACCTTCATAGTATTGACGGGAGAT
> ATACCGCGGCGTCTAGATACTCGTAAAGCCAGTGTACTTCGCAGAATCAATTCATACTCC
> ATCTCTATGATGACGAATATAGGTCAGTTCTAATGTGTGGTCTAACTTGTACTCACCGGC
> AATATCCCCATCGTGTATTTCACTCTCATTCACATTTCCATCGTTACGAAGGTAGGGCTT
> TTGGTAAACAAAGTGGACCGATATCGGATCTTTATGTATCAAGAATGAACGTCAGCAAAT
> ACATACGATGTAGGTTTAGGTACACCGCATGGATCTCCTCGCAGTCATGATTGAAACTCA
> TCGGACTTTATTAGCCAATATTGCCAGCGTCTTATTATCCATTCTTCGGATAATCACTCT
> GCCGTGTTAAAGTCAGCACACCAAGGAAAGCCACCACTTACAAAGGTAAAGCACCATACT
> AGCTCAATGGGAGCCCATTGGCTGAAATTCACCTTAAGCATGACTCTAGATAAACCGATT
> GCCTTCATTTAGGTCAGTTAAGGAAAAGACAAGAAACTGCACTCTCATTCACGAACCCCA
> AGACGGGCCTTCAGTCCAACAGTTGAACTATGGTCTGAATAGGTATGCACTAATACACAT
> TAGTAACACGGCTTATAGACGTGATGGAACGTTGGGGCATTTATCAATCGACACCAAATA
> TTCAATGCGCACATGCTGTTAATAGTTGCATAGTCTTGACCAAACTAAACTGTATAGTTG
> CACATGACTCACAAGAACAATTAGGCACATCCATATTTTCGATTTCTTTCAGTCTCACGA
> GCAGGAGAGGCTTGAACCAGTTAACGCGTCTTGCACATACCGATTTAGAGCGGTAGTACC
> AATAACGCTTTGCAATCGCTAGTGATGGTTGTGGACTGTAGATATATGATTTGTAAATTA
> TCTTGTGACTTGTGTTATTCTTAGCTCATTGTATATTAGTCTAGTGTCGTTAACATTACG
> AATAGGGCTCTCGACGCGACCTAATAGTATAAGAAAGGCTCCACGCCTTAAGGCTGTTGT
> GGAAGAGAACATCAGTCTAGATCAGGTCATATAAACTCTTACTATCACTATTTCGATAGA
> TAAGTCTAAAATGCACTCCAATCTAATTCTTGATTATAGCTTATATAAAGGCTCGGGTTA
> GCTTAAGCCTGACATGTAATATGGAATTACACTGTCTATAACTGGTCACCAGCAGTTGAG
> GTTTGAGATTTCGTGAACGTGACTTTAATAGCGTAGTGTGATCCTCTCTTAGGCTCGATC
> AGAATAATAGAGCTTTACTGTTCCGTGGAATACGATTGTGTTATGTACGAGCATTACGTA
> ACAAATCAAGTATTGTAGTTATTACTATGAATATTTTACCAGCATATGTAACGAAAAACG
> GGTGACCTGTTACTGACATGCAAGAGGGATTGCACACGAATCTAACATCTGCAGAATTCT
> AGACAAAACGCCTTGATCAGCCTAAAGATTTAAAAGCGCTCCAACTTGTATGACTAGAGA
> ATGGTAAAAATGCTCGGGGAACCTCTTGGAAATAGCTGACTATCACTAACGAAGGGTGAT
> GTTAATAATATAAGTTCAATAAATAACAACAACCATATTCACCGGAAAATCATTAGATTC
> TTAGACAATTCGCAGAATCACATTCATGTGGGTTCTAATTCATAAGTAATCGGATTAGTG
> CTATTATTCCCATGGCTGACGAGTCGTCACTTGCTATGCCATAATGGAAAAGGATTGAGA
> AGCTTCGAATAGTTCTGACTCAAAATCCGCACGGGGTTTTTCTGCAGTGACGCCATGCGA
> GATTGTACGGATGCTAACGAGGCATGATCGCTTACAGATGATGGCCGTAAACGATAGTCA
> CCATGTAATGGTATTAGTGTAGCTCTATATGAGGGATAGCATGGTGTCCCTACTACGCCT
> TATAACAGGTATGCACGGCCGTATTCTGCGAAAGGTACTTATAACGTTTTGTCCTACAAA
> AGCTTCTCGGACTTCAGAGTTAGCTGTAGTACTGTGATACATAGTTTTATAAACGTGAGT
> CCATTCGTCTAGCGGTTCTATTTCATCCTCAATGACCGAACTTCTCGTACTCTTATTCTT
> GTTCTCCGAGGGATATAACCAGAGTCATAAAGTGAAGCATACAACACTACACACTCCCTG
> TTCTCACTGATAAAAAGACAGCATTATAACGGCTAACACATACACCGAAAATATCAGACT
> AACTGCTACTCTCTAATAATTAGATAATACTCCCTTAATTCATTAATCATATTTAGCGTT
> TCTGATGAAAGGCGCCATATTAGTCATTAGTGTCCGTAGTGAATTGCACCGGAGCAGTCA
> ACCGGAATATAAATATACATCGGTTATAGATCATGAGATTATTCATTGTTGATCTATATA
> TATGAGAACGAACTAGAAAAACATCATATCACAACGGGTCTTTTTTGATTGTCCATACCA
> CGATACTACTATGATTTAATTGGATATTTGCATATCTAATGAAAGTATCTGGTATAAAGT
> CGTACGCCGCTCTAACATTAGGCTGTAACAATTTTCGCTAACAAAATAGAAGACCCCTTG
> GAGAATAGTCCTACGTACATGCAATGTCCTCTATCCTCATTGGCGCAAGCATCATTAAGT
> GAGGGATTTACATACTTAGGAAAGCTTGTGAAATAATTAGACTTCACGCTGGATAAGAAG
> GCCTGATGCTATTTGTTCGTTGTACAGTTACGATGTGATGGCACCAAAAATTTCTCAGAC
> TCGTGCAGCAAGACTTTTTACCGCAGACACCACCAGATGACGCGGTAGAGATATCCATAC
> GCCGGATTCCAGTGAAGTATGAAAGAAATTCTTATCTACACTGACAAGAGTGATCCGACT
> TTAAGTTCCTTCCCACACTCACGCTTCGTGCACGTCCTTTGGAATAAAGTAACTTTACAA
> CATAGATAAGGTGTGTTCTAAATTCAGCGACTTTATATACGTTATAGACAAGCTTCGGCC
> GAAAACGGAGACTTCATCGGACTATTTTACTTGGATGATGACATTAGTTTCACTGAGAAA
> GTAGTTAGGACATCAGACCCAAAACACAAACATCTAATCTAATGGATGTTAAACAAATTC
> GGACACGAAAGAAAGTCACGCTCGCCCAGACTCATCCCACCCCCACGTTGGCAACAAAAG
> GCCTCTATCTACGCGTTCTAACTCTAGCTATGGTAGACCAACGCAAGCCGATCATTTTCT
> GACTTTACAACCCTATCTGTTTAATAGGATAGGTAATCAAAGTCGATAACTAGAAGGAAT
> TGTTCGATCCAGGTGGGATGTCGGCACTACAGAAAAAGACGATATGAGTCATCTTATCCA
> CATCACTTGTCGCGAGAGTTAAGTTAGTCAATTAGCTCACACTATTTATTACTTGTGGAG
> AATACCTTTATGTTCTACTTACTAACATTATTGCAGCCTTTGCTGTGTAGCTTAATAGTA
> TATTAATATTAATTACCGCACTCTCCCGCTTTACTAAACACAAGTGCTAGTCACTTTTCT
> TGCTACAAAGCATCTCATACGATCGGTTAAAGCAGGATAGCTATTCATATCTTGCCAAGT
> TTCAGTTTTTAATCTTTATGGTTGACGAAAGCTGGATAATAGTTTCTTAACGACTGATTA
> TATTCTATCTTAATGTTAGCACGAAATAACCTGAAGTCTATAAGTGAATGTTGCAAATTG
> GGAAACGATCTTCGTTGCTCATTACGAATTTAAAATGTCGACCTATGAGATAGGACAGGA
> CTCTATCATGTTAGGGTAGTAAGAATCATTATCTGTACCCTTCGGTGTAGGCCTGTATTA
> GTAGATCAATTCAACCGTTAAGGTTGCCACTAAAATCAGTTGCTAACTTAAAGGATGTTG
> TAAACTTTTTTTTGACGATTTCAAAATATCGTTTACTGTGTACGCCTCTACCTTTACTAG
> TGGTCTTAAATTACCCCCCGACTTAAGAACCCTAAGAATAACGTCATCTCTTACATCTAC
> AAGCGTGACTGTAACTATTCCTATCGATACAATTGGTCGAAAATGTAGGAGAAATCCTCA
> CAGCCCTTTGCTATCGACGATTAGGCTAGACCAGTATTGCTAATATCTTTAGCCCCTAAA
> ATTCAACTTTTATGGACTATACGTATTATCGTTACTAGTCTATCCGTAGTGACCGATTAT
> TTCACAGGTGTCTGGAATTATTATTACTCTGGTGTGACTTCTAGCGTTAGCAAGGAATCG
> GTAATAACCTGAATATCGATAAGATATTTATGCAAATCGACCACTTTTGTCGTATAGATA
> CGCACTGTGAAGTGAGACTGCCAATTCTAGTTTTAAACTTCATGGGATATCGACTAGCGC
> CACGTTGGAATATGAAGCTGGTGAAAGACCGTTACTCTAATTTGCAGATTAATGATCCAA
> GTTATATGTAATAGTTAAGTCCTTACAGGGAAAGTCTTTTCTTTTTGTCGGCGATCCATC
> CAAGCCTGGCTACTGTCCAATATGCGACATTAATGTATAACATGATAAGACGCTAGGAGC
> TAGAAGCAATAACATAGTGGCGGTCTATTAGCACCAGTTAAACCGCAGAGCTAGTTTACA
> GGGTCCTCTCGGAGATCTATACCGCATATAGATAATGGAAACCGATTAATAATAACGATT
> CTATTCTTTGCATTCAACGAGACCTAAAGCTATCCGTTCATGTTTGTCTCGTCCATTGAG
> TGTCGGAAAAAGTAGAATAAGCCCCTTTTAGGTTAGGATCTTTGAGAACTGGTTACCGAC
> GTTCCTCTTGCGTACTAGAAACGTGCGGGTTTTAACAATGCCTATTTCTCTTTGATTTAC
> ACCATGTTCGCACCCCCTTGGGCAATCCTATTGTTTCGAATCGTTCTTATATTAACAACT
> AGGGTTTTAGTAATTTCTTATTGCCTTGCCCCTACCGCTCACCCTTTAGGAAACGGATCT
> CTATACTGAGTTGCTGGTCTACAAGCGTATTAACGATTGTACATGGAAATTCCAATCGTA
> TCTCAATAAGTCTCTCCCTGTAACCCTTCCCTGCTTTGAAGAAATAGGAATGTAAGTCAC
> AACTGCAAGTTTGAAGAAAGGCCGCTTAGTAGTAACCAAATCGGGTACGTAGAATAAACG
> TATCCCCTGCGCAAGAGAGCCAGTCTTAATTAGCGCACGAGTCGCACAGGATCTACAAAA
> GAGCCGGATCAATAACTATAAGATGCCACGAGTTACCCAATATCATTGATTACCTAGGAA
> AAGTTAGTCTCGTTGAGTGTCTGAATAGACGGAAGGAAGTCGTGTGTTGTAACATGCCTC
> GAGGACTTCAATTGGTATCCTTCGATACGCTCCCAGGGTACCGGGTTATACAATTCAGAC
> AACATGAGAATTAATATATCTTTAGTAAAAGTAAAAGGGTGGATTAGTAATTGTGGTGAA
> TTTGGATAATGTTCCTCCTGCAGTTATACCATGTGATACGATTTACACGAAACATCTCTG
> AGGTGTACCTATACTAAGCTTCTTTCTCTTGCAAAATACATAGAAAAGAAACAACACATT
> GTGAAGTGCGTTATTACCGAGAAAGTCACTTGTATATCAATAGAGGTATTCCACACAGCG
> GACCAAAAATCATACATCTTGATGCAGCACCTCGTTACCATCTAGATAACTCTGTTGCCT
> CGTTCCAGGATACTAGTGAATTTTAGTCCTATCTTTTCATTACCGCTAAGTGTTTCTATT
> TATTTTAAAATTTAAGGTCGGATACGGTCGATTAACTTTTTTTTGTTTGCTTCCTTGCCT
> ATAATGAGGGGTGTGCTGTGAATGTGTGGTGCACATGAGGTAGGCGCATTCCACCGCACC
> GACTTAAATTTCGTTTTTGTTAACGATAGTTTTGATTATTCCAACGTTATAGACAACCCG
> ATCCACCCTGACTACAACTCTACCATATGTCTTATTTTTAATTATAATAATAACATAATG
> GAAGCAAGAACGCTACCAGTTAGTATAGCCTCCTGTTGTTCCCGCAACCAACTAAAGTAA
> GCATTAACGAGTGCTTGCATCCCATGCTAAACCATATCACGTTCGTTTTCCCACGCCCGT
> AAATAAGATTTACCAGCCCTCAATGGTCGACAATACTAACATTTCAATGTTAGTCCATTG
> ATCACTTATTTTACTCCGCTTAGGCCCGTATATATATGGAGGTCGCTTTTCATAGATCCA
> GAACCCTACATTCCTTTAGTAGTAACTCGTCGACAGGAGTACGCTTAAGGTACCGCCACA
> AAAAGATCATCTTCTTACTTATTCATTTATCATGTAGAGGGCGAAATATTACCCCCCCCG
> CCTCATGATCTTGCGCACACTTAACGACTATCCGCTAACAAACGTGTTATTTGGATGTAA
> GCAAGTGCCAGTCAATGATATGACAGGTCCGCATAAAGAACCATCGAGACGTCTTTTAGT
> TGGCGATAGACACTTAGTTAACTCGTACAGATGACAATAGTTCATTTGACGCTACATTGA
> CCCGAAATAGCCTATAAGGCACGACAAAGCGACTTGTAGAGTTCGTCGATCCTACTCCCT
> CAGGACAATAAAACGGAATTACTTAGGATCTGCTGATGTGACCTACGCGGGCTCGTCTGG
> GGTGAGGGCTTCTTAAGCACATCGTACTTGTTCGCCGTACCTAGAGCCAGAATACACACG
> GTAGTTTAGTCAACATATAATTACCGATGTACCTGGTTTACGATGTGTCAATTTGGCGAC
> AGATGCGGAATCGACAAGACCAACAATCTGTCTTGAAATTGTGAATGATGTTTAGCACTT
> AAGGACCCATATTGGATAAAGCCTTAATTTGGTTTTAGAAGTGTCAGCACATGCATACGC
> CACGACATAAAACATGCCCAGAGTACGACCTAGTTTCACTTTAGGTCACAAAATTTGTTA
> GGAACCTGTTCAACCTGATCTTAATACGCAGTGTACGAATGCTCAGACATAACCAGATTT
> TCGGTAATCGGGATCTTAAACGACTTTAGCATAATTCTGTCAACATCGAGCGGTTACCCC
> ATGGACCCAAACGGGTAAGTGCCGTTAGGCAGAGTAATAGTACATGTTACCGATTTATTC
> AAACGTAATGCACCGAGTTTGGCACGAGCGCTCGAATGTTTATTGTCTCTTCGGTAAACC
> AAGCTAGTTATGACAGGCTTATCATTAATACGTAGGGGAGGTCCTATATCTACCCAGCTG
> TTACCCGAATTTCCGCGAGATGTCCTATCCGGTCATGAAAATAACAGGTGTGTCGATTAG
> CACGGCCAAAAATTTGATGAGTCCTTTGACAAGCTTTTCGAAGAAAAACGTCCACCTCCA
> GATATGAGCGGTTTCAGTGAATAATCCTTATTGATTGATAGCGATCGTGTCCGCTGAAGA
> GGTTCTGGGTACCTTGGAGTCTTCTAAAGTTATACTTACGAGAGATTTGACTTTCATGCA
> GTTCAACTGCAGTTGTCAATTCTTCCACCGGATAATTGCCGCCTACAACGTCGTTACCAA
> TAGGAACTATTATGTTCCAAGTGCCGTTAATTTACAGTTCTCGCAGAGATATCCAGTTAT
> ATTGTCGGACAAATATAGGCAGCTAACAGCAAAGTAAGTTTGTTAATTAACGCTTGTAAT
> GTGCAAAAATTATACTATGAAGTTGTCAATTTGGTTTTGTTTAAAGAAAAACCGAGACAC
> TCCATTGCAATTCTCAGCGGATGTACGCAGTAATTTCCAGTGGAGGAGGCATTTGATGAT
> CTATTACATTCAGGTTACCATCGCCTTAAAATCAACCGCAATCCCGCCCTCCGTGGATAT
> GGCAGCATTTATTCGTCCATTGGGTGTGCCAACTACGTTCCCTACCCCTCGATTACCCTT
> TCCCCTGTCCCTTTACCCTCTGAGGTGTGATAGGGGACGTCAGGCGGTTCCTGCGATATT
> GACAGAACTCCCAGTGTATTAAAACAGAAATAACTTCAAATCTGTTCATATACATATCAA
> GTGGTTTAAATTGATTACCATGTTTTTAAAGTCAAAAAGTGCACTCCTCACTTAATGAAC
> GTGTCTGGTCCTCCCGTTAAGAAGTGTCGTTTCAATTTATGGAGACTGAATTAAGTCGTA
> TAACTGTAATTTGCTCAACTCTCACTGTGCTTTGATCAAAAACCGTAATTCTTTAAGTCG
> CTTACCCTCACACACCGCGATGGATTTGGAGTGCGTTACACCGCGATCTGCAATATATAA
> CTATTCCTGCTATGGGGCAATTGGAAAGATCTCGTTCAATACTACACAAAGTAAGTTTGT
> TTTGCAAACTATTGAATGTCAAAACATCTTCATGTTATGATAGTCTCCACAAGCCAGAAA
> AAGGGCTCTTAGTAAACTGCACTTTATTGAGTACGTAGCCTTTTGTTCCCGTCGACTCGA
> TCTTTTATCATGTAAGAAATAATAAATTCAAGGTCCTTAGCGCATGGAATGCGCCTTATG
> TTAGTTGAAAGGACTTAAAGTGGTATATCCTTAGATTAATAATGGTAGAAAGACGATATA
> GACTCCACGGTCCCAGTCGCTAGGCACTAGCATAACGGGCGCTATACGGTTATGTGTTCC
> CGGTGTTCGTGCAATCAAATTCCGCGTTATGTAAGAAAGAATTGAACCAATATTAATAGG
> GGCCGGTCTATTATGATTCATTCCTCGAGCCCTCACCTTGAGTATGCCTTCTAGGACAGA
> AGCATTCTGATATAAAAACAGGAGATATAAAATAATTAACAATGAGGTTTGAATCAAAAT
> TATGTTCCTGTCAATAGCAGTGTCATTTCCTGGCAAATATCCATAGTTTAAGCCGTAAAT
> CTTATTAAAAGAAGGGCTGGAATACAGGCCTCCAGATATAGATACAAAGTTTGTCCAAAC
> CTTAGCGTGTCCAGTCGAAAGAATGAATTATGTTTGTCTAAATTTTCCTCCCTCTCGCAG
> ACAAGATTGAGGTCTTTTGTTTGCACATACATGCCCCATACACGATGGGCTATCAAGATA
> TGGTTAAGCTTTAATTCTGCGATCTTGTTTATCTGAATAGTTGGATGAACGTGGACTACA
> GCAAAAGGAACGAGCGTGGTTCGCAGAGAACGACAGTATTTCGGGAGATCGCAAAAAGTG
> CAGTTTAACCTATAACCCATATTGTGGGGCCTGAAGAATGTAGTCTACACGCCCCACTCT
> CTGCCTATTCTGTAATTCCTAACGATTTTCATGCAAGCCTCTCTAAGCTCCTACTTATAT
> TGTTAACTTGAAAAATGAAAAGGACTCCTGTATTTTTCTGTTCTTACAGATATTGGAGTT
> CGCCTCCTCTTGCGTTTCTAGGTACCCAGTCCTACCAGATTACGTAACGTGCTTGTCCCT
> TTTTCGTATAAGCTTAATAGATGACCCTAAAGATCGGCAACATCCGATAAGTCGCTCCAT
> TATGTCAGGTCAAAATTTGTTTAAGTATAAACGCAAGACAGCTTTATCACCACATCACGA
> CGCTACCAGTAGTCGAGCAACCATTGCTACCCGTAATGGAAGCAGTGTTTTGTCTTGTAT
> AAAAAGGCTGATTTTTGTTACGATGGAGAAATGAAATTTAAGCGTTAGCCTCATTGATAT
> GGAATTTTGTAAATGGGGTATTCAGATCATCAGGATAGTCTCCACAGTTAAGAGTTGATT
> AAGTAGCTATAGCTTATTCTATCTAGGAAAATCAGAGACACAATCTTCAGCGAATCTCAC
> AATCATAATTGCCGTTTTCATACTGCTCTCTCCAATGAAACCTCCTTGGACTGCAGTACC
> CCCTGCGGTTGCTAACTTAATGAGGATTCTCCTTCTTGTTGCTAATAGCCAATATTATTG
> AAAAGTCATTTTTATATCCTCCTTCTTGTATTATGCACAAAATCGGCACTACAATGGGTT
> ATTGTCTACAGAGTACGATTATAACGATTTGTGCATCGCACCATCATTTGACCACCTCAA
> ATAATCAACGGTCTTATAAGACCACCAACTCACTCTAATTTTTGAGAGGAAGTTGCTGAG
> GGTATGAATGTCAGCAAACCTTAAGTGTTGGGGAATCACTAACCTAGACCAATCGCCTAT
> ATTGAAAAAAAATGTATGATAAGGACCCGCAGTCCAATTTGCCGCTGAGCATTACGAGGT
> GTTCGCCAACACTATGCTAGTAAAAGGATCCGATAAGAATTCATCATGTTTTCTAGTTAT
> ATGACCTTTCGAATAAAACGCATTGCCTGAATTCAGTATGTGTAGGCAATATTTATCTTT
> TCACTTCCTACATTGGTCAGACCATTATTCGACACGTGGCGTCATTTTGTCATACCGGGT
> AATGTTGGAAACAAAACGTACTGATAAAATACTGAGTTGTAAACTCTAATCAGATAACGC
> GCTTGGATATTAAGATTCACACAGGGGTTTCGGCTGTAAAAAAACTTGTGGAGCTGTTCT
> GGGACAGATAAGTTGTACCTCGTACTTAGCTAATTAATGAACCAACTGATTACGATAGAA
> CAATTCTGAGGCCGCCAGGACAGCCAAATTTTAATCTTATAAAGCTGGAAACAGCCGGTA
> TTAGCTTCTCGCATACTTTGCCTGCATTGGTACCTTACAGATATCAGCGTAGTCATATAC
> ACCTCGGTCTCAGCTAAGCTTGTATCTCTTAGAGTAGTTCAAAGATAGTGGACAATACCT
> GTGGAATCGATTGCAGATATGGATTTATTTAACTACTGAGTCTCATTCACAAGCTAAGCA
> AGGAGCACGTTTTGGTGCCGGCATACCGATTTGCTATCATGTCAGCAAATTTGCGTTGTA
> TTCCTAGTTGCACCCATTAAGGCCACACTCCGAACCTAATTATTACATCGCAAAGACATG
> TACGAAGGACCCGATGTCGAATAGAAGGGAGGACTGTTCATTGGAAGCTAGACCAGAGGA
> ATCGCAAAGATGCAACTCTTACAATAAAAATCTAATTTCAGTCAACACGCAATTTCTATA
> AGGTTTCCGATAATAATGAACCGTCTTCCACAGGGGAATTTGCCATGCTCGTAAAAGTAG
> TTAATCCAAGTAGAAGAAATTTTGATAATGTTTTAAGTTGGCACGAAGGAATTCAGAGAG
> ATCTTACCTAACAAAGGCATTAGTAGATGTTCCTTGGTTCACACTCGGTCAATCAGAGCA
> CATACTACGGGCGATACCGGGAATGACACAACATCAATGAGATTGTTAAGTGAGGTAATT
> GACTTTAGAGGACTCGATCAGTATACTGTCACTATGAACATCGTATTAATTGTTATCCGA
> TATATACACCACCGATTTGCTTGTGCAAGGTTACAGACCCATTCGATAAATACAAACACG
> GAGCGATATTATTTAAGGAGTGCTGTCTTCAAAAGAATTATTCCCACACCGACATAAGAA
> CTTCGCTCCGTCATTCCAGATTTAAATAACATAACGTAACGCTTTGCTGATAACATAACA
> TAACCGAGAATTTGCTTAGGAAATTTGGAGCAATATTGCATTGTTTCTCAGTCATCACAA
> GGCCCGCCAAAGAACTCTGAGAATCAGGATTCAACATGATTGGTAAGACTCTATATATAT
> AACTTAATTCTTGTGTCCGGAGATAGAAAGAGGACGAGAGATACTACGAAAGAAAGTGTA
> CTTCGATGTATCAATTCAGACGCCTTCTCTATCATCAACATTATAGGTCTCGTATATGCT
> CGGCGCGATCTGCTTCTCTCCGCCAATAGCCCCATAGTGTATTTCAAGCGCAGTAACAGT
> GAAATCGTTACGAAGGTAGGGATGTTGCTTATAATTGTCGTAACTTATCGCTTATGTATC
> TTTCAAGAATGAACGGCAGCATATACATACGTTCTACCTTTAGCTACAAAGCATCCATAT
> ACTCCCTCTCATGATTGAAACTCTTCCCTATTTTGTAGCCAATAGTGAAAGCGTATTAGT
> ATAAATTCGTCGGTTTTTCACTCGCAACTGTTATACTCTGCAAACAAACGAAAGCCTCAT
> AGTACAAACCTAAAGCTACATACTTCATCATTGGCAGACCAGTGGCGGTATTTCTACGGA
> AGCATCACTATAGATATAAAGTTTCCCTTCATGTACGTCTGTTAACCATATCACAAGAAA
> CTGCTATCTCTGTCACGTAACAATTCACGCGCCTTATCGCCAAATGTTCATATATGCGCG
> GTATACGTATGAACGAATACTAATTAGTATAACGGAGGATTCACGGGAGGGATACTTGGG
> GCATTTATAAATCGTCTAAAAATTTTCTATCAGCACTTGCGGGTTATAGTGGATTACTAG
> GCAACATAATATTCTGTATTGGTCCAAATGACGCTATAGATAAATTAGCAAAATACATTG
> TTTCCATTTATGTAAGTCGAAACTCCAGGACTCCCGGGAACCAGTTAAACCGTCTGGAAA
> AGACACATTGTGAGCGGGACTTCAATGATAGCTTTCAATGAGCTTCTCATGCTTGGGGTC
> TGTACATATATGTTGGCGAAATTATCGTCTGTATTCTGTTATGCTTTGATCATGGGTTAT
> TAGTATAGTGTCCGGTTAAGTACCAATACCGCTAGAGACCCGACCTAAGTCGATAACTAA
> CGATCATCGACGTAAGGATCGTCTCGATCAGTACTTCAGTCTAGATCTGGGAATAGTAAC
> TCGTTAGTGAACTATGTCGTGTCATAACTCTAAAATGCAATCAAATCTTATTATTGAGTA
> TTGATTATATAAAGCATCCGCTTAGCTTTACCCTCAAATGTTATATGCAATTTAAAGCGC
> TTGATATCGTCTACTCAAGTTCAGGTTTCACATGGCCGCAACGTGACGTTATTAGAGGTG
> GGTCATCATCTCTGAGGCTAGTGATGTTGAATACTCATTGAATGGGAAGTGGAATACCAT
> GCTCGTAGGTAACAGCATGACCTATAAAATATACTATGGGTGTGTGGTAGATCAATATTG
> TTCAAGCATATCGTAACAATAACGGCTGAAATGTTACTGACATGAAAGAGGGAGTCCAAA
> CCATTCTAACAGCTGATCAAGTCGTCTAAAAACGCCTGGTTCAGCCTTAAGAGTTATAAG
> CCAGACAAATTGTATCAATAGAGAATCCGTAAATTCCTCGGCCAACCTCTTGCAAAGACA
> TCACTATCAATATACTACCGTGATCTTAATTAGTGAACTTATATAAATATCTACAACCAG
> ATTCAACGGAAAAGCTTTAGTGGATTAGAAATTGCCAAGAATCACATTCATGTGGGTTCG
> AATGCTTTAGTAATACCATTTCGCCGAGTAGTCACTTCGCTGAACTGTCGTAAATTGCTA
> TGACATAATCGAAAAGGATTGTCAAGAGTCGATTACTGCGGACTAATAATCCCCACGGGG
> GTGGTCTCATGTCTCCCCAGGCGAGTGGGGACGGTTGATAAACACGCTGCATCGCGGACT
> GATGTTCCCAGTATTACATAGTCACATTGGATTGCGAGTAGTCTACCTATTTATGAGCGA
> GAGATGCCTCTAACTACTTCGACTTTTAAAACCTTTCCACGCCAGTATTCGGCGAAAGGG
> AAGTATTAAGGGTTGTCATAATTAAGCTGATACCACTTCAGACTTTGCTCTACTTCTGTC
> TTTCATTGGTTTAGTAAAGTCTGTCCATTCGTCGAGACCGTCTTTTGCAGCCTCATTCTA
> CCAACTGCTCCGACTCTTAGTCTGCTTCTCCCAGCGTTATAACAAGAGGCATTTTGTCAT
> CCTTAAAACAATAATAAAGAACTCGGAGCACTGATATAATGACTGAATTAGAACCGCTTA
> AAAATACAACGAATAGATAAGACTATCGGATAAGATCTAATATGTAGTGATTAAGCCCTT
> TATTAATTAATAATAGTTACCCTTTCTGATGTAACGCGACATATTACGATTTAGTGGCAC
> GTCTGAATTGCAAAGCAGATCTCTACCCGATTTTTATTATAAATCCCGTATACATCTTGA
> CTTGAGTAATTGTTCATCTTTTTATATCTCTTCGTACTACAAATAATTAATATCTCAACC
> CGTATTGTGTGATTCTAATTACCAACAGAATACGAGGAGGTTTTTGCTTAGGGCCATATA
> TAATGAATCTATCTCGTTTATTCGCGGAACCCGAGATAACATTACGATGTAACTATTTTA
> GAGAACTTAATACAAGAAACATTGCTGATTACTCATAACTAAATGCTTGGTAATATATCC
> TCAGTGCCCCTACCATCTTTTACGCAGGGATGTAATTACTTAGGATTCATTGTGTAAGAA
> TTACAATGAACGATGGATATGAAGGCATGTTGCGAGGTGTTCCTTGGTATGTGAAGTTCG
> CAGGGCAACAAAAATTTCGCAGAATAGGCCTCAAAGTATTGGTAAAGAAGACAACTAATC
> ATCACGAGCTTCTGATATCAATACGAACGAGTCCTGTGATGGATGAAAGAAAGTCGTATC
> GAAAATGTCAAGAGTCTGCCCAATGTAACTTACTTCAAAAAATAACGCTTCCGCCAAGTA
> CGTTCGAATAAACGTAATTTTAAAAATACATAAGGGGTGTTAGAAAGTAAGCGACGGGAT
> ATAAGTTAGACTCAAGATTCCGCCGTAAAACGAGACTGATTCCGAAGATTGTTCGTGGAT
> CTGGTCATGACTTTCACTGAGTAAGGAGTTTCGACATATGTCAATAAACACAAAAATAGA
> AGCTATTCGATCTGAAAAATATTAGGACAAGAAACTATCTCACGCTAGCCCAGAATATTC
> ACTCACCCACGGGCGATACTAAAGCACTATATAGTCGCGTGATTACTATACATATGGTAC
> ACATAAGAATCACGATCAGGTTCTCAATTTTCAACAATATATGTTTATTTGCATAGGTAA
> TATTAGGCCTTTAAGAGAAGGATGGGTGAGATACTCCGGGGATGGCGGCAATAAAGAAAA
> ACACGATATGAGTAATAGGATCCTAATATCTTGGCGAGAGACTTAAGGTACGAATTTTGC
> GCAATCTATTTTTTACTTGGCCAGAATTCATGTATGGTATAAGTACGAACTTTTTTGATC
> ACTTTCATGGCTACCTGATTAGGATAGTTTGAGGAATTTCCCAAATATACCGATTTAATA
> TACACTAGGGCTTGTCACTTTGAGTCAGAAAAAGAATATAATTACTTAGGGTAATGCTGC
> ATACATATTCTTATATTGCAAAGGTTCTCTGGGTAATCTTGAGCCTTCACGATACCTGGT
> GAAGTGTTTAGTAACGAATCATTAGATTAGATCTGATTCTGTGCAAGAAATATCCTCAAC
> TATTTAACTCAATGTGGCTAATTGCCATTCGATATTCGTTGCTAAGGACGAATGTTTTAT
> CTCGAAATTTGTCAGACGACACGTCTATATAATGGTTGCGGAGGAAGAATCAGGTGATGG
> TCCCTTACCTCTACCACTCTATTACTAGAGCAATTAAAACGTTAAGCTTGCCAATATAAT
> AAGGTCATAACTTTATGGTTGTTGTTAACTTGTTTGGCTAGATTTAAATATATAGTTTAA
> GGTCGAACCCGCGACCGTTACTACTGCTCTTAAATTTCCCAACCTATTATCATCCCTTAG
> AATTACGGCATCTCTTTCTGCTAAAAGCCTCAAGGGATATTGTCCTTGAGATACAAGTGG
> TCGAAAATGTAGCAGAATTAATATAACAAATTTCCTTTCGAACTTTACCATTCAACACTA
> TGGCGAAGTGCTGGACCCAATAAAATTCAAATTGGATGGTCTATTCGTTGTTTAGTTTCT
> ACGCTATCCCGTGTCAAACATGTTTTCACAGCGCTATCGTTTTATTTTTAATCTCGGCGC
> AATGATACCCGGAGAAAGGAAGCCCGTAGATCATGAATATCGAGTAGTTTTTGATCCAAA
> TCCAAAACTTGGGTACGAGACATAAGCTCGGTGATCGCTCACGGACTAGTCTACTGTTAA
> ACTTAATGGGATAGACACTAGCCCAAAGTTCCAATAGCTACATGCGCAAAGTAAGGTTAG
> CGATTTTGCTGTGTAATCAGACAAGTGATATGTAATACTTATGTCAGGAAACCCAATGTA
> GGGGCTGGTTCGCCGCCTTCCATACTACACTGGCTACTGTAAAATATGAGACATTAAGCT
> ATTAAATCAGATGACGCTAGGAGCGACATGCATGAAAAGAGTGCCGGGATATTAGCACCT
> GGTAAACAGAACACATAGTTGTAAGGGTAAGCTCCGAGTTCGTGACAGCATATTGATTAG
> CGAAACAGATTTAGAATAAACAGGATATGCTTTCCATTCAACCTGTCATTATGCTATCAG
> TTCATGTTTGGATAGGAAAGTGACTCTCGGAATAACTAGAATATGAACCTTTTACGTTAG
> GAGATGTCTCAACGGGTTAAACACCTTCCTCGTCAGTAATAGATTCCTCCGGGTTTTAAA
> ATGGAATTTTTCTCTTTCATTTTAACCAGGTGAGCACACCCTGCCGCAATACGAGGGTGG
> CCAATACTGCTTATAGTAAAATATACGGTTGTACGTATGTCTTTTTCCCGGCAAAAGTCC
> GCTAACAAGGTAGCAAACCCATCTAGATACTCACGTGCTGGTCTACAACAGTAGTAACGA
> GTCTACATCCAAATTCAAATCGTATCTAATTATCTCGCGCCATGGATACAGTAACTGCGT
> TGTAGAAATACGAATCTAACTATCATCGCCAAGTGGCAAGAAAGCCAGATTACTTGTAAC
> CTAATAGGGGTAGTTGTAGAAAACTATACACTGAGAAAGACACCCACTATTATTTTGCCA
> ACCACTCCCAATGGTTCTTAAAAAGTCAAGCATATTTTACTATAAGAGGAATCCTCTTAC
> CCATTAGAATGGATTACATAGCAAAACGTAGTATCGGTGACGCTATGTATAGACGCATGG
> AAGTACGCGGTGGTTTCATCCAGCCTGGACTTCAATGCGTTTCCTTCGATAAGAGCACAG
> CCTACACGGGTATACATTGCAGACAACATCACAAGTTATATATCGTTAGTAAATCGATAA
> GGCGCCATTACTAATTCTGGGGAATTTGGTTAATCTTACGCCGCCTCGTATACAATGTCA
> GTCGATTTTCTACAAACATATAGCTCGTCTTCAGATACTAAGATGCTGGCTCGTCAAAAA
> GAAATACATATCTAACAAAAATGTCTCTACGGCGTGTTTTCAGACAATCTAACGTCTATA
> TCTATTCAGGTATTACACACTGCCGTCATATAATAATACTTCTTGATCAAGCACCTAGTT
> AAAAGCGTCTTAAAGCTGGGCAATAGTTCAACCAGTATACGGTTGTGTACTAATATATTT
> TATTTACCGCGAAGTCTGTATATGTTTGTTAATAGTTATGCTACGATAAGGTAGATGAAA
> TTTGGTGTGTGTGATTCAGTCCATATATTCAGGGGTGGGATGTGAATGTGGCCTGCAATG
> GACGTAGCAGAATTCCTACGCACACACTTAAATGTACTTTTTGGTAACGATACTGTGCAT
> TTTGCAAACGTTTGTCACAACACGTTCAACCATCTCGTCAACTCTAAATTAGGTAGTTTG
> TGTAAGTTTAAGAAGAACTTAATGGAAGCATGAACGAGACATGTTACTAGTGCATCCTGT
> TGTTCAAGAAACCTAAGAAAGTAAGCAGTAAACTGTCCGTGCATCCAATCATAAACATTA
> GAAACTTCCGTTTAAATACCAAGTAAATAAGTTTTTCCTCCAATCTATGCTCGACAATAA
> GAAAATTTAAATGTTAGTAAATTCTTATCTTATTTGTATCCGCTGTGCAACGTATATAGA
> TGGACCTACCTTTGCATAGATCAAGATCCATACATGCCTTTACGTCTAAATCGGCGACAC
> CACTACCATGAACGTACCGACAAATAAACATAATATTCTTACGGATGCATTTATAAGCTA
> CACCGAGATAGATTAACACCACCGACGAATGATATTCCGCTCACTGAACCACTAGACCCT
> TACAATCCTGTGATGTGCAGCTAACCATGTGCCAGGAAAGGTTATGAAAGGTCCGAAGAA
> ACAACATGAGAGAAGTATGTGTGTTGCCCAGAGTATCTTTGTTAACGCCGTCAGATCAAA
> AGACGTCATTTGACCATACTGTGTCCACAAATAGACTATAACGCAACACAAACACTAGGC
> TACACGTAGTCGAGACTTCTAACGAAGCACAAGATTTAGCTATTTCTGAGGATCGGCTCT
> GCTCACAGTACAGGGATCGTAGCGGGTCTGGCATTAGTATCAAAATACTACGTGTTCCAC
> GTACCTTGAGCCAGAATAAACAAGCTAGTGGACTCAACATTTTTTTACACATGGAACTCG
> TTTACGAGCTGTAAATTTGGCGAATGATCAGGAATCGACATCTCAAAATTTCTGGCTTCA
> ATTGGGGATTGATCTTTACCTATGAAGGAACCATTTTCGTTAATGACTTAATTTCCGTTT
> TGAAGTGGCAGCAAATCAATAACCCTAGACATATTACAGCAACAGAGTAAGAACTAGTTT
> CACTGTAGGGCAATAAAGGTGGGACGTAACTGTTCAACAGCATCTTTATTAGCTGTCTAC
> CTATCAGAACAAATAACAACTGTTTACCGATTACGGTGATTATAAGACTGTTGATTAATG
> ATCTAATATGCGAGACGGTAACACAGGCTACAATAACCCTAAGTGCCCTGAGCAAGAGTA
> TTAGGAATTCGTACACATGGATGATATCGGAATCCTCACACTTTGCCACGTGCGAGCGAT
> GGGGTAGTGTAGCTTAGCTAAAACATGATAGTGATGACAGCATTATCATTTTTACCTACG
> CGACGGACTATTTCGTACCAGAGGTTAACCGAATTGCCCAGAGATGTCAGATACGGTCAT
> CAAAATATCACGTCTGGACTTGAGAAACCAAAATTAGGTCATCAGTCCTTTCACTAGCTG
> TTCGTAGAAATACCGCATACGACACATTGCTGAGGTTGCAGGCAATAAGCATGTGTGAGT
> GTTTCCCATAGGGTACCATCAAGACGTTCTGGCGAAATGGGAGTAGTCTAAAGGTATTAT
> TAACAGAGAGTGCACGTTATGCCACTTCTACTCCACTGGGAAATTATTACTAACCATTTG
> TGAAGACTTCATAGTCGGGAACTAGACGTTAGATTAGGTGACTACTGCCGTGAATTGACA
> GTTCTCGCACACATAGACACTTATTTTCTCGGTCTATTAGAGCATGCTAACAGATATGTT
> ACGTTGTGAATTTAAGCTTCTATTGTCATAATATTATACTTGGTACTGGGCTATTTCCTT
> GTCTGGAAACAAAAAACGTCACAAGCAATTCCAATTCTCAGACCTTCTTCGAACTAATGT
> CAAGTGGAGGAGGAATGGCTGGAGCTTTTACATTCAGCTGAAAATCGAATTATATTCTTA
> ACAATTCCCCCCCTCCGTCCATATGGCTGAATTTATTACTACTTTGGGTCTGCAATATAA
> CGTCCCGTCCCATCGATTACAATGGAACAGGGCCAGTTACCCTCGCTGCGGTGATAGGGG
> ACGTCTCGACGTTCCTGAGATAGTGACACAAATCCCAGGGTATGAAAACTGTTATTTAGT
> CTAAGATGTGCATATACATATCTACTGGGGGATTTTGTTGAAAATGGTTTGAAACGAATT
> AACTGAACTAATCAAGTAATGAAAGTCGATGCTCATCCAGGGATGATCTGTAGTGTCATG
> TTATCGACAAGCATTTTAGGAGTATAACGCGTTGTTGATCTACTCTCTCTCGGAGGTCTG
> AAAATTACCTAATTAGGGAAGGACATTACCATATAAAAACCCCTTGCATTGCGTGTGACT
> TTAACCCCGATCTCAAATATATAAATTTTACTCCTAGCCGGAATTGGGATAGATCTCGTT
> AAAGACTTATCAAAGGAACTTTGGTTTGCTAACTTGTGAATCTCTAAAAAGAGGCTTGTG
> ATGATTGGCTAATAAAGCCTGTAATAGCGATCTTAGTTAACTCCAATTGATGGAGTAACT
> ACCAGGGTGGTAACCGAGTCTCCATCGTTTATCATGTATGAAAGAAGTATTTCATGGTCC
> GTACCCCAGGGAATGCGAAGTATCTTTGGGGTAAGGACTGATACTGCGATTTCCTTAGAT
> TTATAATGCTTGTAACTCCATAGTGACTCCAACGGACAAGTCCCTTGGCACTAGCATATA
> CGGCGATTTACCGTTTTGGCTTCCCCGTCTTAGTGCAAGCAAATTCCGAGGTAGCTTACA
> TTGAATTGAACCAATATGTTTAGCGCACCGTATATTAGCATGCATTCATAGAGACAGCAC
> CGTCACTATGAATGCTTGCAAAGATGCTTGCTCAGATAAATAATCGTGATATAAAAGAAT
> TAAAAATGAGGTGTGAATAAAATTTAGGGTCATCTCATGAGATGGGGCAGTTCCTGGAAA
> ATATCAATACGTTTAGCCGTAATTATTATTAAATCAAGGGCGCCAATACACGCCTACACA
> TATTGATAAAAAGGTTCTCCTAACAGGAGACTGTAATGGCGATACTTTGTTTTATGTTTG
> TCTAAATTTTACTACATATCGCTGACTACATTCTGGTATTTGGTTGCCTAATAAATCAAA
> AATAAACCATGCGCGTGAAAGTTATCGTTAAGCTTTTATTATCAGATATGCGTGTTCTGT
> ATTCGTGGATCAAACTGGACTTATGAATAACGAACGAGAGTCGTGCCCTGAGAACGACTC
> TATTGAGGGACAGCCAATAAACGGAAGTTGAAACTTGAAACCATTGTGGCGGGCCTGAAG
> AATGGTCTATACAAGACCCACGCTATGCAGAGTCGGGAATTACGATCGATTTGAATGAAA
> CCCTATAGAACCGCCTACTTAGTGGCTTAACTGCAAAAAGCTATAGGAATCATCTATTTG
> TCTCTGATGACACATATTCCACTTCGCAGCCTAGTGCCTGGAGACCTAAAAACTCATTAA
> AGATGACGTTTCGTGCTGGGACCTGGTTCGTAGTAGAGTTTTAGATCACCATAAACTTAC
> GCATCATCAGTTAACGCCATCAAGGATGGAACCGCTAAAGTGCTTGAACGTTATACGAAA
> CAATCCTGTAGCAAATAAGCACGACCCGACCAGTACTCGTCCAAAAATTGATTCCACGAA
> TGGTAGATCTGTTTTCGATTCTTTTAAATGGAGCTTTTTTGTTAAGATCGTGAAAGGATA
> GTTAAGCGTTAGCATCATTCTTTTGCTATGTTGTATTTGGGGTAGTCAGATCTGAAGGTT
> AGTCGAAACAGTTAAGACGTCATTATGTAGCTATAGCTGATGAGATAGACCAAAATAAGA
> CAATAAATCTGAACACAATCTAAAAATCATATTTCCACTGTTAAGACTCATAGATCCAAT
> GTTACCTCCTGGGACTCAAGTAAAAACGCCCGTTGAGAACTTTTTGAGCTTGCGCATGCG
> TGGGCCGAATAGACAAGAGTATGGTTAAGTAATTTTGTTAGACTCCTTCTTGGATTAGGC
> TAATTAGCGCCAAGAAAAGGCGTTAGGCTATAAAGAGTACGAGTAGAACGATTGGGCAAT
> CGATAAATATTTGCACCAAATCATTGTAGATACGCGATTTTATCACCACCTTCTCAATCT
> AATTTGTGACACGAAGTTCCTCAGGGGAGGAAGGTCTGCAAACCTTTAGTGTTCGGCTAT
> CTATAAACTAGTACTTTACCATAGATTCATATTAAATGTTTGATAACCACCCCCAGTACA
> ATTTGCAGCTGAGCATTTCGAGGTGGTCCCATACTCTATGCGTCGAAAACCATAACTGTA
> CATTTAAGATGGTGGTCTAGTTATAGGTACGGTCGAATATAACGCAGGGCCTGTATTAAG
> GAGCTCGTCGCAAGAGTGAGCTTGTCACTTCCTACATTGCGCAGAACATTATTAGTAACG
> GGGCGTAAGGTTCTCTTACCGGGTTATGTGGGATTAATTTCCTACGGATTAATTTCTCAG
> TGCTAAAAGCTTAGAACATAAAGCCCTTCCAGATTAACATTAAAACTCGCCTTGCGGCTG
> TTAAATTAATGGTCCAGCTCGTATGGGAAAGATAAGTTGTACCTACTTCTTAGCTTTTTA
> ATGTACAAAATGATTAAGATAGAAAAAGTAGGAGGCCCCAAGCACAGCAATAGTGTAATC
> TTATAATCAGGGAAAAAGCCCCGATGACATGATCGCTTACTGTGACTCCATTGGGTCCTT
> TCTCAGATAAGAGTAGTAATAGACACATACGGATCAGATAACAGTCTATATATGACTGTA
> GTTCAAAGTTAGTCGACATGACATGTGGAAGAGTGTCCAGATATGCATGTATTTATCTTC
> TGACTATAATTATAAACCTAAGAATCGAGATCGTTTTGGTGCCCGCATACACTTTTCAGA
> TATTCGAAGCTAATTTGCGTTCGAGGACTAGGTGAACAAAGTAACCCCAAACTAAGAACA
> TAAGTATTTCATCGCATAGAAATCGTACATGCAACCGTTGTAGAAGAGTACGGAGGTAGG
> TTAATGCGATGCTTGAAATGTGCAATCGCAAAGATCCTAATATTAAAAGAAATATATATT
> TTAACTATACTAGCTTTGTCTAGTAGCTTTCAGAGATTTATGTTCACTCTGAATCACCGG
> TATTTCCCAGGCTAGTAAAAGGACGTAATACAACGACATGATATGTTGATAATGTGTGAT
> GTGGGCACCTTGGAATGCACACAGAGCTTTACTAAATTTGGCATTTGTACAGCGTACTTG
> CTGATAACGCGGTCAATATCAGAAATTACTACGGGCCATACCGCGTAGCACAATACATAA
> ATGTGTTGGTGAAGTGTCGTAATGGTCTTGACAGCAATACTTAAGTTTAATGTCACTTTG
> AAATTACTTTTAATTGGTATCACATAGATAAAAAACCCATTGCCTGGTCCAACCGTAAAG
> ACCAATTAGAGAAATAATTACACCCTGAGATATTATTTTTGCACTGCGCTATTAAATTGT
> TTGTTGCCAAAAACCAATTTTGAACTTAGCGCCCTCTTTACACAGTGAAATTACAGAACC
> TAAAGCTTTGCTGATAACATTTAAGAAACGAGTATTTGATTAGCTAATTTGCAGCTATAT
> GCAATTGTTTATAACTATTAACATCGCCAGAAAAAGATAGCTGACAATCACGTGTCAACT
> TCTTGGGTAACACGAGAGAGATATTACGTAATTCTTGGGTCCGCTCTTAGAAACACCACG
> AGACTGAAGACGTATGAATCTGTAATTCCATGTATATATTATGACGAATTAGATAGCAGC
> AACTTTATACCTATCGTAGATGCTCGCCGCGATATGCTTAGATAACCAATTAGCAACAGA
> CGGGATTGATAGAGAAGGATATGGGAATGCCTGAAGATCCTACCGATGTGGCTTATAATT
> GGCGTAACTTTTAGCTTATGTTGCTTGAAAGTTTCTAAGGATCATTTTTAATTAGTTCTA
> CCTGGAGCGTAAAAGATGCCTGATAATACATCTATTCAGGCAATATATTCCCTATGTTGG
> ACACAATAGTGAAACAGTATTAGTTGAATGTAGTACCTGTTTAAATAGCAACTGTTATTC
> TATCATATAAAACGTATCCATCATAGTAAAAACCGTAACCTAATTAAGTCATATTGCCCA
> GAAATGTGCCGCTATTGCTAAGGATCAATCAATATACAGATTAAGTTTCAATGCAGGGAC
> GTATGGTAACCATATCAAAACTAACTCATATCTATGGAAACTAAAAATTCAACCCAAGGA
> TCGCCTAATCTGCATAGTTCCGAGCTATACCGTTCATCGTTGTATAAGGACGATATCCGA
> GGATTCAAGGCAGCCATACGTCCGGAAGTTATATATACTCTAAATTTTTTATTGCACAAA
> TGCAGCGGTTTAGGGCATTACTAGGCTACTTTAGTTTATCGAGTCGTCCAAAGCACGATA
> TAGATATTTGACCATATGAAAGTGGGGCCTTTTATGTATCGCGAAACTCAACCACTCCAG
> GCAAAAACTTTTACCCGCTGCATATGTAACATGGTGAGCCCGACGTAAATGTTACAGTTC
> AATGAGCTTCTCATCCTTCGCGTCGGGACTTATTGCTTGGCGAATTTAGAGTCTCTATGC
> TCGGAGGATTTCATAATGCGTGAGTTCTAGACTCGACGGTTAAGGACCTTTACCCCTAGA
> CTACACACATTAGTCGAGTACTTACCAGAATACAAGGAACGATCGGCTCCATCTCTAATT
> CACTCTTCATATCCGATTTGTAAAGAGTTAGTGATATTGGGAGTGTCATAACTATATATT
> GAAAGCAAATATTATTATGCTGTATTCAGGATAGAATCCAGCCGCTTACCTGTTCCATCA
> ATTGTTTGTTCCTTGGTAAAGCGAGTGTTAGCCGATAATCAACTTCACCGTTCTCAGGGC
> CGCTAACGGTAGTTTTTACACGTGGGTCAGAAGATAGGTCCATACTGATCTTGTTTACTC
> AGGGTAGGGGAACTGCAATTCCAGGCTCGTAGCGAACTCCAGGACCTTTATATTATACTA
> TGCGTGTGTGGTAGAGCTATTTTGTTAAACAAGTTCGTAACATTATACCCGCTAATGTTA
> ATCTCTTCAATGTGGCAGTCATATCCATTCTATAAGCTGATCTAGTCGTCTATTAAAGCA
> TGCTTCACACGTTACAGGGTTATGCCAGAATTAGGGTATCTATAGTCAAGCCGTTTATTC
> CGCCGCCATAAGATTCCTAAGACATCACTTTAAATATACTACCCGCAGCGTAAGTAGTGA
> ACTTATATAAAGATATTCTAAAAGTTTATAACCAATTGATTTAGTGGAGTACTAATTGCC
> AAGAAGATATGTCTGCGCGCGGCGTTTGATTTACTATGACCTTTTCGCAGTGTAGGAAAT
> TCCATCTACTCGACTATATTCCGTTCACAGAATCCAATTCCTTGCTCAACAGTCCTTTTC
> TGAGGAAGAATATTCACAACGCCCGTGGTCGCATGGCTACACTGCACACTGGCGTACGTG
> GATATACACCATGCATAGAGGAATCATGTTCCAACTATTACTGTGGATAATTCGATGCCG
> AGTTCTCTTCATATTTAGGAGCCTGACATGCCGCGAACTTAGTCGAATTTTATATCCGTT
> CCAACCCACTAGTAGGCCAATCCGTAGTAGTTAGGGTTCTCATAATTAACAGGAGACCTA
> TTAACTCTTTCATCTTCTTATCTCTTTCATTCGTGTAGTTTACTCTGTAATGTACGCGTG
> ACCGTAGTTTGATGACTCATTCTAACATAGGATACGAATCTGAGTCGGCTGATCACACCG
> TGTTTTAAACTGGATGTTTGGCATCATTTAAACAATAATATAGAAATCGGAGAACGCAGT
> TTTTCTCTCAATTTGAAACCAGTAAAAATACAAACTTTTGAGATCTCTATAGGATAAGAG
> ATAAGTTGTACTGTTTAAGCAATGTATGAAGTAAGATTTGGTTCACGTTCGCAGGTAACC
> AGAAATATTACGATGGTGGCGAACGTCTCTAGTCAAAACCACATCGCTTAACCATGTGTT
> TGTGAAAGACCGGAGACTTATTCACTTGAGGATGTCTGCATCTTTTGATATCTCTTCCTA
> AGACATTTAATTATTATCTAATACCCTAGGGTGTGATTCTAATTTAAAACTGAAGTAGTG
> GTGGGTTTTGCTTTGGGCCTTTTAGAAGCTTTCTTGATCCTTGATTCGACGAACAACAGA
> TTAAAGTTCCAGGGTTATAGTTGACAGAACTTATGACATCAAAAATGCCTGATTTCGAAG
> AACGAATGCATTGCTAAGATTGAATATGTCCCCATACAATCTGTTACGCTCGCTGGGAAT
> GTATTACCTTTCAGGCTCTTAGAAGTACAATGATACATCCAGATCTAGCAAGCTGCAGTG
> GTCTTCCTGCGTATGTGAAGTGCGCAGCCATAAAATTATTTCGATGAATACGCCTCATAG
> TATTGGTAAACATCAAAAATAATCTTCTCGACCTTCTCTGTGAATTACCAACCTGTACTC
> TCATGGTTCATACTAAGTAGGATCGAATAGCTAAACTCTCTGCACAAGGGTACGTAATTA
> AAAAAATAACCCTGACGCATACTAAGTGCCTTTAAACGTTAGTTTAAAAAGTCATTTCCG
> CTCTGAGTAAGTAAGAGTCGGGATATTACTTAGACTAAACATTACCAACTAAAACGAGAA
> GGATTACCAAGAGTGTTAGTCCATCTGCTCATGACGGGAAAGCACTTAGGTCTGTCGTAA
> TATCTCAATATAATATATATTAGATGATTTTCCAGCTGATAATTATTACGACAACATTCT
> TTCTCAACATACAAAAGTATATTCAATAAAACTCCGGCCATAATTTTCCAATAGATAGTA
> CACTGAGTTATAGACATTTCGGACAAATAACAATCAACATAAGGTGAGCAATTTTATAAA
> AGTGAGCTTTTTGTCCATAGGTTAGATTAGGACTTTTAGTGTTCCATGGCTGACATAATC
> CGGGGATGGCCCAAATAAACAATAACTACTGAGCAGTATTAGGTTCCTAAGATCGGCGAG
> ACAGTCTTAACGGTCGATTGTTCAGATATCTATGTTTTTCTGCGCCAGAAGTAATGGTTG
> GTATAAGTTAGATATTTTTGGATCACTTGCATCGCGACCTGTTGACGAGAGGTTGTGGTA
> TTTAACAAATAGAACCAGTTAATATAAAATTCGCAGTGTAACTTTGAGTCAGAAAATCAT
> TATATTTACTTAGCGTAATGATCCATACAGAGTATTAGATTCCAATCGTGCTCTGGGTTA
> TCGGGTGCCGTCAACTTACCTGCTGATGTCTTTAGGAAAGAAGCTGTTGAGGAGTTAGGA
> TGCTGTGATAGATAGTTAAGCAACGATTGAACGCTATCTGCATTTTGCCCATTACAGAGG
> AGTTCCTATGGAACATGGTTTTAGCTACAAATTTCTCAGACCAAACCTATATAGAATCGT
> TCCGGTCGATCTATCAGGTGATCGTAAAGTACCTCTTCCAAGCTTTGTCTTGTGAAAGTA
> TTAACGTTTCCTGGACAATATTATATCGGCATTAAGGTATCCTTCTGGTTAAAGTGGTTG
> GCTACAGTGAAATATTTAGTTGAAGCTCGTACAAGAGAACGTGTCTTCGCCGATTAAATT
> TACAAAACTAGTATCATAACTTAGAATTTACGAATATATGTATGAGTAATCACGCTAGGG
> TTAGTGTAAGTGACAGTAAAGTGGTACAATATGTAGCTCTATTAATATATCAAATGTCAT
> TTCCAACTGGTCCAGTCAACTCTTGGCAGTAGTGATGGACAAAATTAATTGCTAAGGGGT
> TGCTAGTGTACTTGTTGAGGGTCGACGCTTTAACGTCGCAAACTTGTGGTATCACCGCTA
> TCCTTTTATGTGGTATAGCGGCGCAAGGATTCACGGAGAAACCAAGCCCGTAGTTAATCA
> ATTGACTGTTCTTTTGGAGCCTTTGCCTAATATTGGGGACGTGTCAGAACATAGCTCTTC
> GCTCTAGGAATAGTAGACGGTTAAACGGATTGCGATTGACTATTGACCAAACTGCCAAGA
> GCTACAGCCGCTTACTAACGTTAGCGATTTGCATCTGGATTCAGAATACTGTGTTCTAAG
> ACTTTTCTCAGGAAACCCATTCTAGGGGAGGGTTCGCCCACTTAAATAATACACGGCATA
> ATCTAAATTATCAGTCATTAAGCGTTTTAATCTGATCAAGAGTCCTCAGTCTTCATTGAA
> ATGACTCCCCCGAGTTGTCAACATCGTATAAACAACTCATTCGGGTAACCCGAAGAGACC
> TCTTAGTGTCAGCTGTGTCATTAGCCTATAACATTTAGTATAAACAGGATATGATTTCAT
> TGAATACTCTAAGTTTGCTAGAAGGTAATGGTGCGATAGGAAAGGCACTCTACCTATAAC
> GACTAGATCAAAATGGGTCCTGTCGAGAGGTCTCAAAGGCGTAAACTCCTGACGAGTCAC
> TAAGAGATTCCGCACCGGGTTATAATGCAAGTGGGCGCTTTCAGTTTAAAATGCTGACAA
> AACACGGCCCAAATACGAGGCTGGACTATACGGCGTTTAGGTAAATATTCCCGTGTACGT
> ATGTATGTTTCAAGGCAAAAGTAACAGATAAAGGTACCAAAACCTTATAGATTATCACGG
> GCTCCGCTTAAACACTTGTATACAGTCTTAATCCATAGTAATAGACTTTATAATGTTCTC
> GAGCAATCGATAAAGGAAAGCAGTTGTACAAATACCATTCGTACGATATTCGCAATCGGG
> CATCAAACCAACATTACGTCGTAAATTATACCCGTAGTTCTTGATAACTTGAAAATGACA
> AACACACAAACGAGGATTTTCCCAAACTCGACAAATCGTTATTAAAAACTCAACCTTATT
> TTAAGTTATCAGCAATCCTCGGACAATTGAGAAGGCAGGAAATAGCAATACGGTCTATAC
> GTCACGCGAGCTTGAGAACCTTCGTACTACGCGCGGCGTTATTCAAGACTCCAAGTATTT
> GCCGTGCATGACTTAACAGAAATCCCGAAACCCGTATTCATTGATCACTTAATCACTTGG
> TATAGTGCGTTACGATATCGATAAGCCGCCATGACGTTTTCGGCGCTATGTCCTTAATCG
> GAAGAAGCATCGGATTAATTCTCTGTACATGTTATACAAAAAGATAGCTCCGCGTAAGTT
> TAGATCATGAGGGATAGTCAAAAAGTATTTCATTTCTTTAAAATATGTCGCTACGCCGTG
> TTTTAACACTTTCTATCGTCTTTTTATATTCTCGGATTAAAAAATCACCTAATATTAGAA
> GAATGAGGCATCAAGAAAATAGTGAAAAGAGTCTTTAAGATGGGCAAGACTTAAACCAGT
> ATACGCTTGTGTACTAAGAGATTTTATTTTCACAGTTCTCTGGAGAGGGTTGTTTATAGT
> TATCCGACCATTACCTAGATGTTATGGGGGGGCTGTCATGAAGGCCATAGTTTCTCCCCG
> CGGAGCGCTATGGGGCCGGAAATGCACCGACCACAATTAATACCCTAACAATTTAATGTA
> CGTGTTCGTAACGATTCTGTGCTTTTTGAAAACCTTTGTCAAATAAACTTCAAACATCTA
> GTATAATATTAATGTGGGAGTTGGTGGTAGGTTTTGTAGTAATGAAGCGTTCATTCTAAC
> AGTAATGTGACTTGTCAAGCAGCGGCTTAAAGATACATAAGATTCGTTGATGTTTACTCT
> CAGTCATTAAAATCAGAATCATTTGATACGTCCGGTGAAATACCAACGTAAGTTGTTGTT
> AATCCAAGATAGGCTACAAAAGTAGATATTGTATTGCGGACGAAATTCTTATCTTATTGG
> TAGCACATGTCCAACCTTGTTAGATCCACCTACAGTGGAATAGTTAATGTTACATTAAGG
> CCGTTTCGTCTTTATACGACTAACCTCGAACAGGAACCTTACGAAAAATTAACTGATTAT
> TAGGAAGGAGGCTTTTTGAAGCTTCACCGAGATTGTTGTACAAAAACGAAGATTCATAGT
> CAGATCTATGAACCAATTGACCAGTACAATACTGTGTTGTCCTGCTTACAATCGCACACG
> ATTGGTGTTCTAAGGTCACATGTAACTACATGACTCTACGATGGGTCGTCCACAGTCTAT
> ATTTCGTATAGACGTAACAGCTAATGACGTAATTGGTCCATTCTGGCTAAACAAATTCAC
> TTGAACCAAACACATTCACTAGGCTACACGGACGCCAGAATTATAAAGAACCAAAAGATT
> TACCTTTTTCTGACGATAGCATCTGCTCAAAGTACACGCAGAGGAGCCCCTCTGCCATTA
> GTTTCATAATACGACGGCTTCCACGTTCAGTGTCCAACATTTAAATACCTAGTGGACTAA
> AATTTTTTGGAAACAGCGAAAGCCGTTTAGTGCGGGATTTGGCCACAATCATCACGATTA
> CTAATCTAAAAATTTCTCGATTCTATTGCGCATTCATCGGTACATATGAACCTAAAAGTG
> TCCTTTTTGACTTATTTTCCGTGTTCAACTCGCAGAAAATCAATAACAATACAATTATTT
> AAGCAAAACACTTAGAAAGAGGTGCTATGGACCGAAATTAAGGTCGGACCTAAATCTTAT
> TAAGCTTATTTTGTACATCGCTTCCTAGCAGAACAAATATCAACTGGTGACCGTTTACGC
> TGATTTTAAGAATGTTGATGTTTGAGCTAATATGCCACACCGTAAAAAAGCCTAAATTAA
> CCCTATCTCCCCGGAGCAACAGGATTTCGAATTCGGACACATGGTGGATTTACGAATCAT
> AACACTGTCCAAACTCCCAGCGATGGGGTTGTCTAGATGACCGAATACATCATACTGTTC
> TCACCAGTTTAATGTTTTACGACCCCTCGGAAGTGTTCGTAAATCAGCTTTAACCAATTG
> ACCACTGTTCTAAGTTAACCTAATCATTAGATCACCTCGGGACTGGACAAACCAAATTTA
> GGTCATCTCTACTGTCTCTACAGGTGACTTCTAATAACGAATAAGAAACATTGCTCACCG
> TGAAGGCAATAAGCATGTGTGAGGCTTTCACATAGGCTAACATCTAGTCGTTAGCCCGAA
> ATGCCAGTAGTCGATTGGTTTTATTTACACTCAGTGCTAGGTATGCAACGGATTATCCAC
> TGCGAATGTATTACTAACCATTTGTCAACAATTAATACGACGGAAATTGTCCTTAGTTTA
> GCGGAATTCTCCAGTGTTTGGTAACTTATACATCTCAGAGAAACGTTGTTGCTACCTATT
> TTAGTGCATCCGTAAACATATCTTACGTTCGGAATTTAACCGTCGATTGTCATTATTGTT
> TACGTGCTACTGCGATTGTGCCGTGTCTGGTATCTTAATAAGTCACAAGAATTGCATATG
> ATATCACCTGCTTACATCTATTGGAATCTCCACCTCCAATGGCTGCAGATTTTAAAGTCA
> GCTGAAAATACAATTATTTGATTAACATTTAAACACCTCAGTCCATATGGATCATGTTTT
> GACGAATGTGCCGCTCAAATATAACGTAAAGTACAATACTGGAAAATGGAAAAGCGAAAG
> TTAAAATCGCTCCGCTCTTACCCCAACGCTCCACGTTACTCACTTTGGGACACATAGAAC
> AGGGGTTGTAATCTCTTTTTTAGTATAAGATCTGCAGAGTAATTGATTCTCCGGGTTTTT
> CTGGTAATGGGGTTGTATCGATTTATCGCAAATAAGCAAGGAATGTAACGCGATCCGCAG
> AAACGGTTGATCTCGACTGGAATGGTAGCCACAAGCATTTTTCGACTAGATCGCGTTGTT
> CATCTACGAGATCGCGCAGGTCTGATAATTAACTTTTTAGGGAACGACAGTAAAATATAT
> AAACCCCTTCCATGGCGTCTCACTGTATAACACTGCTCAAAGATAGTTAGTGGACTCAGT
> GCCGCAATTGCGTTAGATATACTTATAGACTTATAAAAGGTTCTTTCGGGTCATAAATTG
> TCAAGCTATAAAATGAGGATTCGGTGCTGTCGATAATATACACTCTAATACCCAGAGTAC
> TTTTCGCCAAGGGATGCACGTACTACAAGGGTCGTAAACGACTATACATAGTTTAGAATG
> TTTCTTAGATGTATGTAATCCTCCGGACACATGGCAATCCCAAGGTGCGTTCGGCTTTCC
> TAGGTTACGCCGTTTTAATTACATGTTGATGCCGTGTAACTACATAGTCTATAAAACCGA
> AATGTACCGTCCCAATAGAAGATACCCAGATTGACCCGTTTCGCTGCCCCCGCGTACTCA
> TAGCTTATTAACACGTTGCGTACATTCATGTGATAAAAGTGGTTTAGCCCACCGTATTGG
> AGCATGAATTAAGAGAGAAAGATAAGTCACGTGCAATGAGTCCTAAGTTCATGGATCAGA
> GAATTAATCCTGTTTTAAATGTTGGATATTTCAGCGGGCATTAAAATTTAGCGTAATCGA
> TTGAGATCGCGAAGGTAATCGAATAGAGCAAGTCGTTTTCAACTTTTGAGTATGTATTCA
> TGCCAGCCTTTAAACCAAGACACTTTGTGTGTAAATCGGTCTAATAAAAGGTGACTGGAA
> TCGACATTCTTTCTTGTTTCGGGCTAGATTGGGTAAGAAAGATACATGACTACAGTCTCC
> TAGGGGGTGGCATATGAAATCAAAAATAATACTGCCCAGTGATAGTTATCCTGATGAGGG
> TTGGATCACTTAGGCGGGTGAGCTATTCGTCCTGCAAACTCCAATTATCAATTTCCTACG
> ACACGCGGGACCTGTCTAACAATCTTGTGACCCACAGCCATTAAACGCAACTGGATAATT
> GTAACAAGTGTCGCCCCCAGGATGATTCGTCGATTAAACACAAAAGATATCAAGTGTCGC
> GAATTAAGATACAGGGGAATCAAACAAGATAGTACCGAATACGTTGTGGCTTTTCGGCAA
> ATAGCTATACCAATCATCGAGTGGGATCGGATGAAACTGATTCCTCTGACAAGAAGAGGG
> ACGGGAGACCGTAAAACGCATTAATCATGACCGTTCCTCCGGGGAACTGGGTACTAGTTG
> AGTTTTTGATCTAAAGATACTGACGATTCATAACTTATCGCCATAAAGGATCGAACCGAT
> AAAGGGCGGGATCGTTATTACATACAATCATGTAGCAAATATGAACCAACAGTACTCGAC
> TCCTCATAAAAGGCAGTAAACGATTCGTACATCTCGTTTCGAGGCTTTTAAATCGAGCTT
> TTGTCGGTACATCCTCATTGCTTTGTTTAGCGGTTGCATAAGGCTGTTCCTAGGTGCGAT
> TTCCCCGAGGAACTGATGATCCTGACTAGAATCTGTGTTGACGTCATGATCTTCATTTAC
> ATGATGAGATAGACCATAATAACACAATAATTAGGAACACATGCTAAATTGAATATTGCA
> ACTGGTAAGAATCATAGATCAAATCTTTCATAATGCCAATCATGGAAAAAAGCACGTGCA
> GTTATGTTGGTGCTGGCGAATGCGGCGGCAGTATTCAATAGTGTTTGCTTTTCTAAGGGT
> GTTAGAAGACTGCTTCGATTAGCATAATTTGACCATAGTAATGGCCTTAGGCTAGAATCA
> CGAACAGGAGATACTTTGCGCATTCGATAATGATTGGCAAATAATCATTGTAGATTAGCG
> ATTTTATCTCAAACTTATAAAGAGATGTTGTCACACGAACGTCCTCTGCCGTGCTAGGTC
> TCAAATCAGTTACTCGTCCCCTTTATAGAAACTTCTAATTGACAAGTGTGGCATATTAAT
> GCGTTGTTTTCCAACCCAACGACTATTGGCAGATGAGAAGGTACTCCTCGGACAATTATA
> GAGCAGTCGTATTCCTTAACTGTTCTTTGATGATGCTGGTATACTTTTAGGTACGGGACA
> TGATATACAAGGGCATCTTTTAAGGAGCTCGTCCAAAGAGTGAGATTGTATATTAATAAA
> TTCCGAACTAAAGGTTGACTAAACGCCACGATGGTGCTCTGAAACGCTTATCTGCCTTTA
> TTTTCCGTCGGAGTAATTTCTCTCGGCTATTAGATTTGAACATATACACAGGCCAGATGA
> TCTGGAAAAATCCCCTGGCGCAGCTTATATTAATGGTCCACAGCGTATCGCAATCATTAG
> GTCTAAATACGTAGTACATTTTTAATCTTAATAAGCATTAACAGACAAAATGGAGGACCC
> ACAATCCAAACAAATTGGGTTAGATTAGATTCAGCCTAAAAGACCCGATGTCAGGAGCCA
> TGAATGTCACGCAAGGGCGTCATGTATCTGATAACACTTCGAATAGAAAAAGACGGATCA
> GATTACAGGCGTGATATGACTCTACGGAAATGTTAGTCCAAATGAAAGCTCCATGACTGG
> CCTCATATGCTTGTATTTATATTATGACGAGAATTATAAACAGAACATTCGTCATCCTTG
> GGCTCAACCAAGTAACTGTTCAGATATTCGAACATAATTTCACTTCGTGGAAGTCGTCAT
> AAAAGTATCCAAAAAAGAACATCATAAGGATGTAATACCTTTGAATTCGTACATCCAACA
> CTTGTAGTTGAGTTCCGAGCTAGCGTATTGCCATGATTCAAATCTGCATTCCCTAACTGC
> ATAAGATTTATAGATATATATTTGGGAACTATTATACATTTGTCTAGTTCCGTTAACTGA
> TTTAGCTTAACTATGAATAACCCGTAGTTCCCAGGAGACTAAAAGGACGGAAGAAATCGA
> CTTGATTTGTGCATTATGTGGGTTCGGCCATACTTCCATTGAACTCAGTGCTTTACGAAA
> TTTCCAATTTCTACTGCGTAAGGCCGGATAAAGACCTCATTATCTGATATTTCTAACCGA
> CTTAAACCCTAGCTAAATAAATAATGGTCTTGGTGATCTCTCCTAATGCTAGTGTCACCA
> AGACTTAACTTGAATGGAACGTTGAAATTACTTTTTATGCGGATCACATAGATAAAAAAA
> ACTGTGCAGGCGCAAACCGTAAAGAAAATTTAGAGTATGTATTACTCCCTCACAGTGTAT
> TGTTCCACTCAGCTATTATATTCTTTGTTGACATATAACAATTTTCAAATGAGAGACCTA
> TTGAATCTGGGAAATTAAAGTAACGTTAGATGGCAGGAGTAAATTTATGAAAACACTAGG
> GCATTACCTAATGGGCACCTAGATGCAAGGCGGTATAACTATTATAATCCACAGAAAAAG
> ATAGAGCACTTTAACCTGGCTTATGCTTGCGGATCAAGAGAGAGTTAGTAAGTAAGTAGT
> CGCTACCCTCTGTGTAACACCAACACACTGTAGACGTATCAATCGCGAAGGACATCTTTA
> TATGATCTAGAATGAGATTGAAGATAATTTTGACCTATAGTAGTTCATCGCACAGTTATC
> CGTAGATAACCAATTTGAAAATGACGCGTGGGATAGACATCGATATCGCAATGACGGAAC
> TTCCTTCCCATCGGCAGTTTATTTCGACTAAATGTGACATGAGCGTGAGTGATTCTTGCT
> TACGATCATTTTTAAGTACTGAGAACGGGTCAGTATAACATGAATGATAAGAAATAGATG
> CAGGCTTTAGATTACCTAGGTTGGTCAATTTACGCAATCACTAGGTCGTGAATGGACGAC
> CTGTTTATAGAGCAAATCTTATTCGATCATATAAATACTTTCAATAATAGGTAATTAAGT
> TTCATAATTAAGTAAGATTGCCATCAAATGTCCAGCTTTGGATAAGCTTCATGATATAGA
> CTGTTTAACTGTAAAGGAAGCGTACGATCGGAACATTTTCTATACTATAGCATATAGATC
> GAAACTTAAAATTATACACAAGGATCCAATAATCTGCTTAGTTCACAGCTAGTCCGTTCA
> TAGTTGTATATGGTCGTTATACCAGCTGTATACGCTGCCATAAGGCCCCATGGGAGATTG
> ACTATAATTTGTTGATTGAACAAATGCACCGGTTGACGGCATTTATACCATAATTTAGTT
> TAGCGAGTCCGAATAAGCTAGATATACTTATTGGACAATATGAATGTCGGGAATTTGATG
> GATCGACAAACTCATCCTATCAAGCCTAAAACGGTTAAACGAGGCATATCTAAATGGGTC
> TCACCCTCGTAAATCTTACAGTGCATTGACAGTCGATTCATGCCCCTAGCGTATGAGTGC
> TTGCAGATTGGAGACTCGCTAGGAGCGGTGGAGGTCATATGCCCTGTGGTCTAGTCGCGA
> CCCTTATCGTAATTGTCCCAGACACTAAACAAATTTGTAGTGTACTTAACAGAATACAAG
> GATCCAGAGGAGACTTATCTTATGATCTAGTCTGATCCGATGTGTATAGAGGTACTGATA
> TTGCGACTGTCTTTAAGAGTTATGCATAGAAATGAGTTGTAGGCTGTAGTCAGGAGTGAA
> TCCAGAACAGTTCAGGTTAAATCTATGCGTTGTGCATTGGTAAAGACAGTGTTAGACGAT
> AATCATCTGCTCCGGGATCTGCCAAGATTACGCTAGGGTTGTCACGTCCCGATGAAGAGA
> GCTCCATACTCATCTTCTTGTATCAGGCTAGCCCAACGCCATGTAATGCAGCGTTCCGAA
> CTCATGGTACTTTATTTTATTCTTTCCCTCGGTCCTACAGATATTTGCTTAATCATGTGA
> GTTAAATTATACCAGCTAATCGTAAGCTATTCAATCTCCCTGGAATATAAATGATTTAAC
> ATCATATTCTACTATATTTTACAAGGCTGATCAAGTTACTCGGTTTTCACACAATTAGGC
> GTGATAGACTCTAGACCTTTTTGAAGACCACATAAGAGTCCTTTGACATAAAGTGAAATT
> TAATACCCGCTGAGTATGTAGTGAAAGTATATTAAGTTATTATTAATCTGGATAACCATT
> TCATGGTCTGGAGTACTATTGCAAAACTTGATATGGATGCGCCCGGACTTTGATGTACGT
> TGAACTGGTACCAGTGGACGAAATGACAGCTAATCGACGATATGCAGTGCAATGATGACT
> TTTCCTGGCTAAACAGGACTTTTATCACCTAGATTTTTAAAATACCCCCGCCGAGCATCG
> CTACAATCCACTCTCGCCTACCTGCATATAATCCATCCAGACAGGTATCAGCTGAAAACT
> TTTACTGTCGATAATGCGTTGCACTGGTCGAGTAATAGTTTGCTCCCTCACATCCCGAGA
> AAGTAGTACAAGTTTTTATACGTTCATACCAACTAGTACCACTATCCCTAGGAGTTACCG
> TGCTAATAATTTTCAGGAGAAATAGGATCTCGTTCAGCGTCGTATCTATTTATGTCGGGT
> TCTTTACGATCGAATGGACGACTCACACGAGTGGCATCAAGAATTATAAATTAGCAGAAC
> AAGAGGTGGAGGATGAGAAAACACTGTTTTAATCTCCATGTTTCGCTTAATTTATTATAG
> TATATACAAATAGCACATAGCTGTTTTTCTATCAATGTGAAAACAGTTATATTTATAACT
> TTTCAGATCTATTTACCAGTACAGAGATGTTGGTCTGTTGTACAAAGGTAGGATGGTTGA
> TGTCGTTCAAGGTAGCAGCTTTCCACAATTAGTTACATGGTCGCGAAACTAGCTTGGCAT
> AACAACATCGATTAAACATGTGTTTGTGTAAGACAGGTGACTGATGCTATGGACGATGGC
> GGATTAGTGTGTGAGATATTACTTAGAATTTTTATGATGTTATATTAAACGAGGCGGGCT
> GGCGAATTTAATAATCTAGTAGTCCTGCGTTTGCATGTCGGAATGTTAGTTGCTTTAGTG
> AGACTTGATTCCACGTACAACAGAGTTAAGTTACAGCGTTATTGTTGACACTTATTTTGT
> CTTCTAAAAGGCATCTTGTAGAAGAAAGTATGCATTGCGAAGATTGAAGATGGCCAAATT
> AATGATGGTAACATCCCTGGGTATGTAGTACCTTTAAGGCTCTTACTAGTTATAGGATAC
> ATCCAGTTCTTCCAAGCTGCACTGCTCGTAATGCCTATCGGTACTGCCCACCCATAATTT
> TTTGTACATCAATACCAATAATTCTATGCCTTAACATCTATAATAATATGATACACAGTA
> TCTGTGAATTTACAAACTCGAATCGCATCCTGCATTCTTACGACGTTACTATAGCTATTC
> TCGATCAAATAGCGTAAGTAATTAAATATATAAACATGACCCATACGAAGGGCCTTGATT
> CCTTAGTGTAATATGTCAGTTCCCCGCTGAGTATCGAACACTACCCTGAGTACGGACTAT
> AAACAGTAACAACTTTTAACACAAGCATGAACTACTGGCGTAGGCCAGATCCTATGCTCG
> GGAAAGCACTTTCCTCTGTCCTAAGATCTAAATTTTATATTTATGACTTGATTTTACTGA
> GGATTATTTGGACCAATACTTTCTTTCGATACAGACAAATCTAGATGAAATAAAAATACC
> CACATTATTTTCAAAGAGTTAGTACACGGAGTTAGAGAAAGTTCCGTCTAATTACATTAA
> ACTTATCCTGAGATAGGTTATTAAAGTGAGCGTGTTGTCAATTCCGTTGATTTCCAATGT
> TAGTCTTCCATCGCGCACTGAATACCCCCAGCGACCATATAATCTTTAAATACTGAGCTC
> GATGACCTGAATATGATAGGCCACACTCTATGTACCGTACATTGGTCACATATATAGGTT
> GGTAGGCCAATCATGTAAGGGTTCCGAGAACTTACTTATGGTGGCATAAATGGAAGCGCG
> TCATCTTGACCAGTGGTTCTCCTTGTTAACAAATAGAAACAGGGTAGATTAAATTCCCAG
> TCTATAGGGCACTCAGAAAATCATGAGATGTAATGACCGTAATCATCATGTAAGTGGATG
> AGAGTCAAATCCGGATATCCGGTTGAGGCTCCAGGCTACTTAAAGCCTCTTCTCGTTAGG
> TAACAAGCTGTTCAGGAGTGAGGTTGCTCTCATACTTAGTTAAGAAAAGAGTGTAAGATT
> TCTGCATTTGGCAATTTACTGAGGACGGCATATGGTACTTGCGTTTTGATACAAAGTTCT
> CTCACCTAACCTAGATTGATGCGTTCCCCTCGTTCTATATCCTCAGCCTAAAGGACCGAT
> TCCAAGAGTGGTATTCTCATAGGATTAACGGTTCCGGCAAAAGTTTTTATCCGCATTAAG
> GTTTCCTTCTGCTTATAGGGGTGCGCTACAGGGATTTTGTGACTTGAACCGACTAAAACA
> CTAACGGTAGTAGCAGAGGTTATGTAAAAAAATAGGTTCTTAAATTACTTTTTACCATGA
> GAGGTATCAGTAATCAAGCTACCCTTAGTGTAAGTGACAGTAATGGCCGACAATATCTAC
> CTCTTTGAAGATATAAAATGTAAGTTACAAATGGTACAGTATAATAGTGGCAGTACTCAT
> CCTCAAAAGTTTTGGATTAGGGCTGCCTAGTGTACGTCGTGACGGTAGACGATTGAAAGT
> CGATAAATTCTGGGATATCCCATATACTTTTTGGTGGTATAGACCACCTAGCATTAAACC
> TCATACCATCAAACTAGTTAAGCTTTTGACTCTTCTTTGGCAGAATTTGACTAATAGGCG
> CGACCTCTCAGTACATACCTCTTCCATATACCAATTCGAGTAGCTTTTTAGGATTCCCTG
> TCAATAGTCACAATACTGCCTTGTCATTAAGCCGCTTTCTAACGGTACAGTTGTGCATCT
> CGTTGAACAATACGCTGTGCTAAGTATTTTCGAACCAAAAAAATTCGACGCCAGGGTTAG
> AACAATTAAATAATTCAAGCCATTAGCGAATTGAGCACTATGGTACAGTTTTAAGATCTT
> CTACAGTCCTCACTCTTCATTGTTATCTCTCAACCCAGTTGTCAAAATCGGTTAAACATA
> TAAGTCGGCTAACCCGAACAGACCTCTTAGTCTAACATGTGTCAGTACACTATAACATGT
> TCTTGTTAATCCAGTGCAGTGCATTGATTAATCTAAGTTTCAGTGAACGTAAGCGGGCCA
> GACGAAACGCTATATACCTTTTTAGACTAGATCAAAATGGGTCCGGTCCACAGCGATCTT
> ACCCGGAAAATAAGGAAGACGAACTAAGTCATTAAGAACCCGGTGATATTCCAAGTGGGA
> GAGGGATGGTTATAATCCGGACATAAAAAGGCACATTGAACACCCTGCACTATACGCAGG
> TGTCGTAATTAGTACCGGCGTCCTAGCTAGGTTGAAACCCAAAAGTAACAGATAAACCGT
> CATTTACATGAGACTTTATCTACGCAGCCGAGTAATAACTTGGTTACAGTAGTATTACAT
> AGGAATTGACGTTAGAATGTTAGACAGAAAGCCTTAAACGAAAGCACTTCTTCTTAGTAC
> ATGAGTTAGATATTACAATTCGGCCTTCTTTCCAACATGTAGTCGTTAATTTGACCCCTA
> CGTCTTGTTTAATTGAAAATCACAATCACTAAATAGAGGTTTGTCACATACTAGAAATAT
> CCTGATTATTATCTCAACATTATTTTAAGTGATCTCCAATACTAGGTAAATTGTGATGCC
> AGGAAATACCAATTCCGTCGAGACCTCTACAGAGCTTGACTACATTCCTACTAAGACCGC
> CGTTATGAAAGACTCCTAGGATTTCCCGTGAATGACTGAACAGAAATCAAGTAAACCCGT
> GTATTTCATCTATTAATATCTTCGTTTAGTGACGGACGTTTTAGTTATCCACCATGGAAG
> TTTGAGCCCCTAGGGCCTGATGCGGAACAACAATACGTGTAATGCGATCTACTGGTTATA
> AAAAAAGAGAGATCCGAGTAAGTGTAGATCATGAGCCATACTAATATTGTATGTCTTTTA
> TTTATTATATCTAGCTTCCCACGGTGGTAACTCTTTCTATAGGAGTGTGATAGTATCCGT
> GGAATAAATCAACTAATTTTAGATGAATGAGGCTTCATCATAAGACTGTAATCAGTCTGT
> TACATCCCCAAGACGGAATACAGTAGTCCCTTCGGTACGAAGTGATGTGATTGTAACACT
> TCTAGCGAGTGCGTGGGGTTTTCTTTTCCGAACTGTACCTACTGGTTATGGGGGCGCTCG
> CATGAACGAAATTGTTGATCCCCGCCCAGCGCTATCGCCCCGCAAATCCTCCGACCACAT
> GGAATAACATAACAAGGTTTTCGAAGGGGGCCTTAACATTAGCGCCTGGTTCAAATACTG
> TCTATATTAAACTGAATAAAGCTACTATTAGAGTAATGTGCGAGGTGCGCGTTGGTGTTC
> TAGTTATGATGCCTTCATTCTAACAGTAATCTGTATTCTCAAGAAGCGGCTTAAACATAA
> ATAACTTTCGTTCATCGTTACTCTCACGCATTAAATTAAGATTAATGTGATACGTACCGG
> GAAATAAAAACGTTAGTTCTGGGTAATAAAAGATTGCCGACTATTGTAGTTATGGGATTG
> CGGACGAATGGCTTATAGGTGGGCTAGAACAGCTCAAAACGTGTGAGTTCCTCCTAAAGT
> GCATGTCTTAATCTTAAAGTATGCAAGGGTAGTCTTTAGACCACTATCATAGAAAAGCTT
> ACGTAACAAAATTTATATGATTAGTAGGAACGTGCATGGTTGATCATTATAACACATTCT
> GGTAAAAAAAACAACATTCAGAGTAACATATAGCAAAATAGTCAACAGTTAAATACTCGC
> TTCGCATGCTTACATTCGCAAACGATTGCTGTGCTATCCGAACATCTTTCTAAATCACTC
> TACGAGCGGTCGGCAAAAGTCTATAGGTCGTATACAAGTATCTGATATTGTAGTATTGGC
> TACATTATGGCTAAACATATTCAAGTGTACCATAAAAATTAAATAGCCTACACGGACGAC
> AGAATTAGAAACAACCAATAGATTTACATTTTTAGCTCCTGAGCAGATGAGAAAACTACA
> CCCAGACGACACCCTCTCCAATGACTTTAATAATAAGTACGCGGAAAACGTAAGTCTCAA
> ACATTTAAATACATTCTCGTCGATTATGTGTTGGAAAAAGCGTAAGACGGGTACTCAGCG
> ATTGGGCCACAATCTTAACCATTACTATTATAAATATTGAGCCAGGATTTTCCGCTTTCT
> TAGGGAAATAGCATCCTAAATGTGTCCTTTTTCAAGGTTTTGCCCGGTTCTACGCCATCA
> AATGAATTTACAATACTATTTTTTATCAAAATCTCGTACAAAGTCGGGATAGGGACCCAT
> ATTAAGCGCGCTCCTAAATCTGATTAACATTAGTTTGTACATCGCGTAATTGAACATATA
> ATTTAATATGGTGAAAGTTTAACCTCAGTTTTACTATCTTCATGTTGCAGCTATTATCAC
> TCAACGGAAAAAACCATAAATTTAACATTTCGCAAAGGACAAACTCGATGTCCTATGACG
> TAAATGCCTGCATTTACGTTTAATAACTCGGTCAATACTCACACACTTGCCCTTCGCGAC
> ATGACCGTATAATTCATTCTCTGCTAACCAGGTGATGGTTGTACGTACCCTCCCAAGTGT
> TAGTAAATCACCTGTAAACTTGGCAAAACTCTGCGAACTTAACCGAATCTTTTGATATAC
> GAGCGACTGGACATAACAAATTTTCGTATTATCTAAGGGCTATTCAGGGGACTTCTTTTA
> AACAATAACAATAATTCATCACCGTGATCGATTTTACAAGGTCGCACGCTGTAACTGACC
> CGAACAGCTTCTACGTAGCCACTAAGCCCACTACGAGTTTCGGTGTAGGTACACTCTCTC
> CTACGTATCCATCGGATTAGAATAGCCCATTGGAGTAATAACCATTTGGCAACAAGTAAT
> ACGACCGTAATTCTACTTACTTTTGCGCAATTAGCAACGCTTGGGTATCGGATACATATC
> TGTCAAAAGTTGTTGAGACCTATTTTTCTCAATCAGTAATCATTTCGTTACGGCGCTTGT
> TTACAGTAGATGCTAATTATTGGTGAAGTCCTACTCCCATTGTGCAGTGGAGCGTTTATT
> TATAACTAAAAAGAATGGAATAGGATATCAAATGATTACATATATGGGAATCTCCACCTC
> CATGCGATGCTCAGTTTAATGTATCAGGTAAATACAAGGTTTTGATTAAAATTGAAAAAA
> AGAACGAATGAGCCATCATGTTTGGACGAATGTCCCGATCAAATAGTACCGAAACTAAAA
> GACTGGTAAATCCAAAACCCAAACTGAAAAGACATCAGCGCTGACCCCTACGATACAACT
> TAATCACTTTGGCAAACATAGAAATCGCGTTGTTTTATCTTTGTTACGATTTCATCGGAT
> GTGTATTTGATTCTCCCGGTTTTGCTGCTAATGCGGGGCTATACATTTTTAGCATAGAAG
> ATACGTAGCTAACGCCAGCAGAAGAAACCGTTCTTAGCGACGCGATTCGTAGCCACTAGA
> TTTGTTCGACGTGATACCGTTGTTCAGATTAGAGATAGAGCACGGATCATATTTAAAGTT
> TTACGCAACGAAAGTTAAATATATATAAAAATGCATGGGACTCTCAAGGTATAAAACTGA
> TAAAAGTGTGTTAGTGGAAGAAGTGACCCAATGCCCTTTCTTAGACTTATTCTAGTATAA
> ATCCTTCTTGCGGGTCATATATTCGCTTGAGATATAATCAGGATTCGCTGCTGTCCAGAA
> TATTCAATCTATTTCCCAGAGGTCTTTTAGCAAAGGCATGCACGTAATTCAAGGGGCCGA
> AAACACTATAATTACGGTTGATTCTTTCTTACATGTATGGATTCCTAAGGAAACATCCCT
> AGCACAACGTGCGGTCCCCTTTCCTAGGTTTCGCCCTGTGAATGTCTTGTTGTTGCAGTC
> TTTCTACAGTCTCTAGAATACCCAAATCTAAAGTCCAAAGTCATGATACCCACAGTGAAA
> CGTTGCGATGAAACCGCGGACTCATAGATTTGGAACACCTTCCGTTATTTCTTGGCATAA
> TTGTGGTTGTCCCCAAACGATTGGTGCTTGAAGGAAGACACAAAGATAAGGATAGTGCAA
> GCAGTCCTATCTTCATGGAGAAGTGTATTAATCCTCTGTGAATTCTTGGTTATTGCTCCG
> GGCATGATTTTTGACCGGAATCGATTCTCATCCCCAACGTAATCCATTTGTGAATGTAGG
> TTTCAACGTTTGAGGTGGTTTTCTTCCCACAATTGTAAACAAGAATCTGTGTCTGTAATT
> CCGGCTAATTTAACCTCAATCGAATCCACATTCTTTCTTGGTGCGGGCGAGTTTGGGTAA
> GAAAGAGACATCTATAATGTATCCTAGGGGCTGCAATATGTATTCAAAATTAATACTGCA
> CAGTCATACTTAGCCGGTTCAGGGTTGGAGAACTGAGGAGGGTGAGCTATTACGCCTGCT
> TAATCCTATTATCATTTTCCTTACTCACGCCGGAAATCTCTTACTATCGTGGCACCCTCT
> CAAATTATACCCAACGGCTTAATTGTTAAAAGTCGCGCCCCAAGCATCATTCGTAGATTA
> TACAAAATAGATAGCAAGTCTACCCTATGAACATACTGGGCATGCATTAAAGATAGTAAA
> GAAGAAGGTCTGCAGGTTAGCATAATTGATTTTCCTAGAAGAGTGGGGGAGAGGAGCAAT
> ATGTGTACTCGGACAACAAGACGCAAGCCACTCCGTAAAACGAATTAATCTGCAACGTTA
> CGCAGGCGAAAGGCGGACTACTTCAGGTTTTCTGATAAAGTTTATGAACATTATTAACTT
> TTACAAAGAATCCTGCCAAACCATTAAGGCCGGGTTACTGTTTACATTCTATAAGGTAGA
> TAATATCAAACTACACTAATCGACTACTAATTAAAGGCAGTAAAACTTGCCTACATATCG
> TGGACAGGAGTTTTTTTCCACATTGGGTCGGTACTGACTCTTTCCTTTCGTTTCACGGTC
> AAGATGGATGTGCATAGGTGCGTTTGCCCCGTCGAACTGATGATCCTGTCGAGAATATCG
> GTTCTAGGCAGGATCTTCAGTGACATCTGGACATACTAAATAAGAACTATATAATGAGCA
> TCAATTGAGATATTGATGATGGCAACTGGGATCTAGAATAGAGAAAAGCTTTAAGAATCC
> CTATCATCGTAAAAAGAAACGGCACTTATGTTGCTCCTGGACAAGCACGCCCAACTTGTC
> AATTCTCGTGGCTTTTCTAAGGGTGTTAGAAGAAGGATTCCATTACCATAATTTGACAAT
> ACTATTGCACGGTCCAGAGAATCTCGAACTGGACTTACTTGGCGAATGACATAATGATGG
> CATAATAAGATTTGTTGATTACAGAGGTGTTATAAAAATTAGATAGAGTTGGGGTCTATA
> CAACGGCAGATCCCGTCCTTCCGATCATTTAAGGTTCGCGGACCATTTATAGTTAATTCT
> AATTGAAAAGTCTGGATTTTTTATGCGTGCTGTTAATAAACATCGAATTGGGCAACAGCT
> CATGGTACTCCGCCGACAATTATAGTGCAGTACTATTAATTAACTCTTCTTTGATCATGC
> TCCTATACGTTTTGCTAACCGACATGTTTTACATGGCAAGCTTGGATCCACATACTACAA
> TCTCGGTCAGTCTATATTAAGTAAGTCAGAACTAATGGTGGACTATACGCCACGATCCTG
> AGATGTAACCCTTTGCGGCCTTTATTTTACGTACCTGTTTTTTATCTCGGAGATTAGAGT
> TCATCTGATACACAGGCAACTTGTTCTGGATAAATACCAGGCACCAGCGTATATTTATCC
> TCCTCAGCCGATCCCTATCATTTCGGCGTAAGAAGTAGGTCATTTTGAATCTTAATAAGC
> AGGTACAGACTAAATCGACCACCAAAAATCCTATCAATTTCGCTTAGAGGAGATTCAGCC
> TATAACAAAACTGCTCAGCAGACATGAAGGGCAAGCATGGCCGTAATGTATCTGAGATCA
> CTTCGAATTGAATAAGAACCAGAACAGTTCACGCGTGATAGGTATCGTCGGATTTCTGTC
> GACTAATGTAAGCGCCATGACTGGCATCAGTGCATTCGTGGGATAGTAGCTAGAGATTGA
> TAAACAGATCATTACTCATACGGGGCCGCAAACATGTAACTGGGCACTTATGCCATCATT
> TGTGCACTTACTCGAAGTCCGCATAAAACTTTAAAATATAGAACTTAAGATGGAGGTATT
> ACATTTCAATTCCTAAATCAAAAACTTCTACTTGTCTTACCTCCTAGCGTATTGACATCA
> GTCTAATCTCAATGACATTTCTGAATTAGAGGTATACTTTTTTAGTTGGGATAGATTATA
> CATTTCGAGTGTTCAGGGAACTCTTTTAGCTTAAATATCAATAACCCCTAGTTAAAACCA
> GACTATTACGTCCGATGAATTACTATTCTTTGGGGCTTTTTCTGGGTTCGCCCATACTTC
> CTTTGATATCTCTGATGTAAGATATTTCCAAGGTCTTATGAGGAAGGCCGGATATAGACC
> TAATGATCTCATATGTAGTACCCACTGTAACACTTCATATATAATGATTGCTCTTCCTGT
> TCTCTACGAATGCTAGTCTATCATAGACTTATCGTGAAGCGATAGTTCATATGAAGTGTT
> TTGCCGATAAAATTCTGTAAAATAAATGTCAAGCCGCAATCCGGTAACTAAATGTACTCT
> TTGTATTTATAAATCACTGTGTTTTGTTCATCGCACAGATGATTTTCTTGGTGCAAATAT
> AAATATTTTCATAGGACACAACGATTGAATATCGGTTTGTAAACTTAAGTTACAGGGCAG
> CAGTTATTTTATCATAACTCTAGGGCAGGACATTTTGGCATCATTGTTCAAAGGCGGGAG
> AAATATGATATTCCAAACAAATACATACAGCTATTGATACTCGATTATGCTTGCCGTTCA
> ACACTGTGTGTGTAAGGATGTAGGCGCTAACCTCTGTCTAACACCTACACTATCTAGAAC
> TTTCATTAGCGTAGGAAAGCGTGATTGGATCTACAATGAGAGTCATCATTATTGTGTACG
> ATACGACTTCAGACAACACTGAGCAGGACAGAAAAATTGTCAAAATGAAGCCTGGCATAC
> ACATCCATATCCCTTTCAAGCTACTTCAGTACCAGCGCCAGTTGATTGCCACGAAAGGTG
> ACAGGAGCGTCAGTCATTCTTGCTTACCATCATTTGTATGTACGGAGTAAGGGTCAGTAT
> TACATCAATCAGAAGAAATAGATGATCGCTTTAGATGAAAGAGGGTCGTAAATTGTCGCA
> TTAACGAGGTCGTGATTCGACGAAATGTGGATAGACAAAAGCGGTTTAGATAATATATTT
> ACTTTAAATAATACGTATTTAAGTTTAAGAATGTACTAAGATTCAAATCAAATCGCCACA
> TTTGCATAACCTTAATGATAGTGTATCTTTTACTGGAAAGCATCCCTACGAGCGGTTAAT
> TTTATATTATTTAGAATAGAGAGCGATACGTTAAATTATAAACAACCTGACAATTAGAGC
> ATGTCTGAACACCGTGTACCTGAATACTTCTAGATCGTCCTTATAACACCTGGATACCCT
> CACTTAACGAACCATGGGTGTTTGACTATTTTTTGTGGATTCATCATATCAACCCCTTGT
> CCCATGGTAGACCATAATGTTGTTGAGACTCGCCGAATATCATACATTGTCTTATTGCTA
> ATTTTCAATGTCCCGAATGGGAGCGTTACACTTTATAATAATAGAAACCATTAATCGGTT
> TAAACAGCAATATCTAAATGGCTCTCAAACTAGGAATGCTTAAAGGGATTGCTCAGTAGA
> TGCAGGACCCGACCCTATGTGTGCTGCCACTTTGGTCACGAGATAGCAGAGCTCCAGGTA
> TGATGCCCTGTGGTAGAGTCGCGAACCGTATCCTAATTGTAAAAGTCAATAAACTAAGTT
> CTACTCTTAGTTAAAGATTAAAACCTTCCAGACGAGAATTATCTTAGGATCGAGTATGAG
> ACCTTGTCGTTACACGTACTCATAGTGCCACGCTATGTTAGAGTTTTGCATAGAATTGAG
> GTGGTGCCTCGTGTCTCCTGTCTTTCATGAACAGGTCAGCTTAAAGATTTGCGTTGTGCA
> TTCCTATACACACGCTGACAACAGAATATTAGGATCACGGATATGCCAACATTAAGCTAC
> GGTGGTAAACGCCCGATCAAGAGACCTAAAGAATCATATGCTTGTATAACCCTACCCCAA
> AGCATTGTAATGCAGACGTCCGTAATAATCCTAAGTGATTTGATTAGTGCACTCGCGCCT
> TCTCATTGTGGCGGAATAATCTGACTTAATTTTTAAAAGCTAAGCGGTAGATATGAATTC
> TCCATCGAATATAATTGAGTTATCAGCAGATTCGACGATATTTTACAAGCCGGATAAACG
> TTCTCCGTGTTCAATCTATTACCCGTGATAGTCTATTCAACGTTTGGAAGAACAATTAAC
> AGGAATTTCTATGATAGTGATAGTTTATTAAAGCTGACGTTCTTCGCTTAGGTTTGTTTG
> TTATTATTAATCTGGATAAACTTTTCAGGGTCTCCAGGTATTTGGCAAATCTTCATATGG
> ATGACCCCCCACTTGCAGGTTAGTTGAAATGGTACAACTCGTCCAAAGGAAAGATTATAC
> AAGATAGGAACTGCAATCTTGAATTTTCATGCCTATTCACGAATTGTAGCACCTAGTTGT
> TGAAAATACACACGCCGACAATCGATAAAATCAAATAGCCCCTAACGGCTGTTAATACAT
> CATGACACCTAGATGCTGAAAAAGTGTAATGTCCATATGGACTTGAACTCGTAGAGTAAG
> TGTGTCCTCACTCTCAGCAACACATAGTACTACTAGGTGTTATAAGTGAATACAATCGTG
> GACCACTTTACCTACGTCTTTCCCGGAGATGTAGGTTAACCAGTAATAGGATATAGGTAA
> GAGTAGGAGAGAGGGATGTACGCGTCGTTAAGAGCGAATGGAAGACTCAAACGAGTGGCA
> TCAAGATTGAGAAATTAGCAGAACTAGAGCTCGAGCAGCAGAAATAACTCTGTTATTCTC
> CATCGTTCGATGAATGTATTATTGTAGTTACAAAGACCTCATACCTCTTTTTATATAATG
> GTCTTAACACTTTTATGTATAAATTGTCTCTTATAGTTACCAGTACTGAGTTCTTCGTAT
> CTTGTACAAAGCTTGCTTCGTTCATGTCGGTAAAGGGAGCTCCTTTAAACAATGTGGTAC
> AGCGTCCACATACTAGATTCGAATATCATATTACAGTAAAATTGGCGTTGTCTATCAAAC
> GTGTATGATGCTAGGCTCCATCGAGGATGAGGGTGTGTGATATTAATTAGTATTTTTATG
> TTGTGATATTAAAAGACCCGCGCTGGAGAAGGTAATTATCTACTACTCCTCCCGGGGCAG
> GTCCCAATGTGTGTTCATTGAGTCAGACGTCTGTACACCTAAAAATCTGTTATCGTACAC
> CGTTATTCGGGAAACTTAGTTTCTATTATAAAAGCCATCTGGTACAAGTTACTTTGCATG
> CAGATCTGTCAAGATCGCAAAATTAATGAGCGGTACATACCTGCCTTTCTAGGTACTGGA
> TGGAGAGTTCTTGGTATAGCATAATGACTCTTCTTCCAACCTCAACTCCGAGGAAGCACG
> ATCGCTACTGACATCAAATTATTTTTGGGACATCTAGACCAATAATTCGTGGCCGTAAAA
> TCTATAATTTGATGATACTAAGGAGATCTGAATGTACATACTCGAAGCGCTTCCTGATTT
> ATTTCGACGTGACTTTTCATATTATAGATCAAATAGCCTTACGTAGGAAATATAGATACA
> GCAACAATACGAACGGAATTGTTTACGTTCGGTATTATGTATGTTCACCGCGCACTTTCG
> TTCACTACCCTGTGTTCGGTCTAGATTCTGGAAAAACTTTTAACTCTACCAGGAACTACT
> CGCGGACGCATGATCCGATGCTAGGCATAGCTCTTTCCTCGCTACTATGTTAGAAAGTTT
> ATATTTATGTCTTCAGTTGAATCAGCTTTATGTGGAACTATAATTTAGTTAGATACAGAC
> AAATCTAGATGAAAGAAAAATAACCAATTTAGTTTCAAAGACTGTCTAAACGCACGTAGA
> GTAAGTGACGTATATTTACTTTATAATGATCCGGAGATAGGGTATTAAACTCACAGGGTT
> CGAATGTCCGTTCATGTCCAATGTTACTCTTCATGCCCGCAATGTATAACCCCTGCCAAA
> ATTGTATATTTTTATACTCTCATCGATGACCTGAATTTCATACGACACTATCTAGGTTAC
> CTACTTTGGGAACATATAGTGCGGGGTAGCCCAATCTTCTAAGCGTGCCGAGTACGTACT
> TAGGGGGCCATATAGGCAAGCCACTAAGCTGCTACTCTCCTTCTCCTTGGGAAAATAGAC
> AAAAACGGTTGTTTATATTACAAGGCGATAGGGCACGAACTATTTAATGAGATGGAATGA
> CACGTTTCATAATGTAACTCGAGGTCTGGAATTTCCGCATAGCCCGTTGAGCCTCAAGGA
> TACTGTAAGCAGCTTCGAGGGACCTTACTACATCGTCTGCTCTGACCTTCAGCTCATACT
> TTGTTAACATTACAGTGTTACATTGAGCCAGTTGCAAATTTAATGAGGACGGAAGATCCT
> ACTTCCGTTGTGAGAATAAGTGATATCTACTATAAGAGAGTGATGCCGTCACCTCCTTAT
> TGATCCGCTGCCGAAACGAAAGAGTAATACAGTGCTAGTCTCATTCGATTAAACGTTAAG
> CCAATAGTTTTGATCCCATGTTAGCTTGCAGGCGCCGGTTACGCCGGCCATTCTCGGTTT
> TTGTGTCGGCTACAGACTAAAACACTAACGCTAGTAGAACAGGTTTGGTAAATAAAGAGG
> TTATGAAAGTTCTTGGTACCATGAGAGCTATCAGTATTCAAGATACCCTTACGCGAACGC
> AATCTATTCGCCGACTTTTGCGTCATCTTTGTTGAGTTATTAGCGAAGGGACTTAGGCTA
> AACTATTATAGTGCCACTTCTCAGCCTAAATTGTTTTGGATTTGCCCTGCCGACTCTACG
> GCGTGACCGTAGTACAGTGAAACTACATTAATGCTCGGATATAACAGAGAATGGGTGGGG
> CTTGACACCACATACCAGTAAACCTCTTTCCTTCAAACGTCTGAAGATTGTGAATCTTCG
> GTGGCTGAATTTGAATTATAGGCCCGTACTCTATCTACATACAGATTACAGATACCAAGT
> CGAGTAGCGGTTTACGATGCCCTGTCAATAGTCAAAATACGCAATTCTCATTAAGAACAT
> TTAGAACCGTTCACTTGGCCAGCGCCTTGATCAATTCGCTCTGCGTTCTAGGTTAGAACC
> TTTAAATTTCGTCCCCACCCGGACAAAAAGGAATGAAGTATAGCCAGTAGAGAATTGTGC
> TCTATGGTTCAGTGGTATGATCTGATACACTCCTAACTATGAATGCTTTTCTAGAAAACC
> ACTGCTCATAATCCGTTTATAATATATGTACCCTATCACGAACAGAAATATGACGCTAAC
> ATCTCTATGGTCAATTTAAATGGGTCTTGTTTATCCAGTGCAGGGAATGGATTAATAGAT
> CGTTCAGTCAACGGATGCCGCCCTGTCCAATCCATAGAGAACTTGTTAGTATTGTGATTA
> AGCCCTAAGCTACTCACCGATATTACCAGGTATATAAGCAACACGAAAGTAGTCTTGAAG
> AAAACCCGGTTATGCCAACGCCCACAGGGATCGGGATAATCAGCAAATAAAAACCAACAT
> TGTACTCCAGCCAATTGTACCAGGTGTCCTTATTTGTAAACGCGTACGTGCGAGCTGGAA
> ACCAAAAACGAAAACATATTCCGTAATTTAAATGAGTCTGTAGATACGCAGAAGAGTATT
> AAAGTCGTTAATCGAGTATGAATTTCGAATTCACGTGAGTTGCTTAGACACAAAGCCTTA
> ATCCTTAGAACGGCTTATTTGTAATTGAGTTACAGATTACAATTCCCCATTCTTTCAATC
> AGGTACTCCTTAATTTGAACACTTCGGCTTCTTTAAGTCAAAAGCACTTTCTATAAATAC
> AGGTTGGTAAAATAATACAAATTTCCTGAGGATTTTAGAAACATGATGGTTAGTGTTATC
> ATAGAATACCTAAATGCTCATCCATCCTAAGTCATTTTACCTAGTGACCGCTACACACCT
> TGTCTAAATTACTTCGTACACACCCCGGATGAAACAATACTACGATTGCAACTCAAGGAC
> TGTAAACATATCAAGTAAAACCGTGTATGGCATCTATTATGATATTCCTTGTGTGACGGT
> AGTTTTACTGTTCAACAATGCTACTTGGACCACCTTGCGAAGGTTGACCAACAACAATAC
> CTGTAATGAGATCGACTGCGGATTATTTATGTGACAGACGACTAACTGTACTTATGCACC
> CAGACGAATTTTCTTTGTATTTTATTTATTATAGCGACATTACAACGCTGGGAACTATTT
> AGTTACGAGTGTGATTGTATACGTGGAATATAGAAAATAAGTTTTCTTCTATCAGCCTGA
> ATCATAAGACGCTAATCACGATGTTTCAGCCCATTCAAGGAATAATCGAGTACCTTCGCG
> TAGTAGTGAGGGGTTGGTAACACTTAGAGCGACTCCCTGCGGTTTTCGGTTAACTACTGT
> AAAGTCTGCTTTGCGCCCCCCGCGAAGCAACGAAAGTCTTGATAAAACCCCTCACATTGC
> CCCAACCATTGCATACCTAAACTTGGAATTACATAAATAGGTTTGCGAAGGCGGCCGTTA
> CTGTAGCGCATGGTGCAATTACGGGCTATATTAAACGGAATAAAGAGACTATTAGAGTTA
> TCTCCGACGTGCGCGTTCCTGTTCTTCTTATCTTGCCTTAATTATTACACTATGCGCTAG
> TCGAAACAAGAGGCGGATACTTTAAGTACTTTAGTTCATCGTTAAGAGAACGAATGAAAT
> GATCTTTATTGTCTTAACGAACCGGAAAGAAAAAACTTTCTTCTGGGTAATAAAACAGTC
> CAGAATATTGTTCTTATGCGATTGACCTACTATGGATGTGAGGTGGGCGTCAACAGCTAA
> AAAAGTGTGTCTGCATAAGAAACGCCATGTCTGATTCTTAAAGTATGCAACGGTACTAGT
> TTGAACACTATAATAGTAATGCTTAAGTAACAATATTTTTATCATGAGGAGCTACCTCCA
> TGGGTCATCAGTATAACACTTTCTGGTAAAAAAAACTACATGCTGTCGAACATATAGCTT
> AATAGTCTAAACTTATTTAAGCGCTGCGCATCAGTTAATTACAAATCCTTTCCGCTGATT
> TCCGAACATCTTTATTAAGCAATATACCTGCCCTCCGAAAATCTATAGAGGGACGTTACA
> ACTATATCATATTCTACGATGGCCTAATGTATCCATAAAATTTGTCTAGTCTTACATAAT
> ATTTAAATTCCAGTATACGAACACTCTAGTAGAAACATAATATTCTGGGACATTGGGAGC
> TACTGACAAGATCAGATAACTAATACAACACCTCACCCGATCCATGGTCGTTAATATGTA
> CTACCCGGAAAACGTAACTCTAAATCTTGTATATTAAGTCGCCTAGATTATGGGTTCGTA
> AATCACTAAGAACGGTACTCACCCATTGCCAAAATAGCTGAACCTTGAATATGATAATTT
> TTGAGACAGGATTGGCCCATTGATGACCGTAATTGCTTAATTAATCGGGACGGTTGCAAG
> GTTGGGAACGGGTATTAGACATCATATGAATGTTAAATTCTATGTGGTATCATAATATAG
> TACTTACTCCGCATAGCCTAACATTGTTTCCGCCCTAAGTTAGCGGATTAACATGAGGGT
> CTAAAGACAGTAATTCATCTTATATGTTATTATCGGCAAACTTGAACATCAGGTGTTCTA
> GCGTCATCTTGCAGAGATTTTCAATCAACCGTTAAATCAATAATTTTTAAAGTTAGCAAA
> CCTCATTATCCTTGTACTATGACCTATATGCCTCCTGTTACCTTGAATATATAGCGCAAT
> ACTCACACACTGCCCCGTCGAGTCAGGACAGTTTAATTCTGTAGCTGATATAATCGTGAT
> GCTTGTAACTACACTACCAAGTCTGACGAAATAACCGGTTAAATTGGCAAAAATCTGCGA
> ACTGAAAAGATGATTTTCTTATACGACCCAATCCTCATTAATATTTTTCCGATGATCGAA
> GCGATAGTAAGCGGAAGTCTTTTTAACAATAACAATATGGCAGATACCGCATCCATTGTT
> CAAGCGCGCTCCCGGTAAATGACCAGAAATGATTCTACGGAGCCACTTTGCAATCGACGA
> CTTTCCGTGTTGGTTATATATCGCATACGGAGCAATACCAGTAGAATAGCACATTCGTGG
> AATAAAATGGTCGAATATAGTATTAACAACCTAATTCTAATTTCTGGTCAGCAATTAGAA
> ACGCTTGCCTATAGGAGACATATATCTCAATACGTCTGGAGAACTATTTGTCTCAATCAC
> TTATATGTTAGGTACGGCGCTTGGTTAAACGAGTTGCGATTTTTTCGTGTACTCCGTAGC
> CCATTGGGAAGGCGAGCCTTTATTTTTTACTATATTCAATGCAATTGGAGATATAAGCAG
> GACATAGTTGCCAATCGACTAATCAATGCCATCATCAGTGGTATCGATCAGCTTTTGAAA
> AGGTTTGCAGTAAAATGGAAAAAAAGAACGAATGTGCCATATTCGGTGGAACTATCGCAC
> GAGCAATGAGTAACGAAACTAAATGACTGCTAAAGCCAAATCACAATCGGTAAAGACAGC
> ACAGATGTCAACTAACAGAATACGGAAGATCTGTCGCTATATTTCAAATCCCGTGCTTTT
> ATAGTTGGTACGATTTCAGAGCATCTCTATGTCATTAGACCCCTTTGGCGGCTAATCCCC
> GGCTTTACATTGTTAGATTAGAACATACCTTGCTTTACACTGAAGATCAATACCTGCTTA
> GCCACGCCATGCCGTCAATATACATGGGTTCCAAGTCTTACACGGCGGAAGATTACACAT
> ACACATCCGAGCTTTTGTAAAGTTGGACCCTTACAAACGTAAAGTTTTATAAAAAGGAAT
> GCCACTAGATAGCTATAAAACTGAGAATTCTGTGTTAGGGGAAGAAGTCAACCTTTGCAC
> TTTCTGAGACGGATTCTAGTATATTTCCTTAGGGACGCGAATTTAGGCGATTCAGATTTT
> ATCACCATGACCTCATGGCCAGTTTTTTAAAGATTTGTAACTCAGGTAGGTTAGAATACC
> CTGCCTACTAAGTAATCCCGACGAAAACAATAGAATGACGGGTGATGCGTTATTTCTTCG
> TTGGATTAAGAACCTAAAATCCCTTGAACTACCTGACGTACCCGTTCCTACCTTTAGCAC
> TGTGAAGGTATGGGTGTTCCACTCGTTATAATGTCTATAGAATAACCTATTCGAAACTCC
> ATAGTCATCTTTAACACTGGCTAAAGGTGACAGGAAAAACACGTAGAATTCATTTGGAAA
> TACGTCAGTTATTTCTTGGCTTAATTCTCCTGGTCAAAAAACGAGTCCTCATGCATGGAA
> CTCTCTAACATAACGATAGTGATTGCACGAATATCTTCATCCAGATCTCTTTGTATAATC
> TGTGTTTTCTTGCTTATTGCTCAGCGATTGATTTGGGTCACGAAGAGATGCTCTGCCCCA
> TCCGAAGACATTTGTCAATGTACGGTTAAAAGTTTCTCGTGCTTTGATTCAAACAATTGT
> ATAAAACTATATGTGTCTCTATTTACGGAGAATTTAACCTCTAGCCAATACAATTTATGG
> AGGGGTGAGGCAGAGTTTGGCGTACAAACAGAAATCTATTATGGATAAGTGCCCCGCCAA
> TATGTTTGAAATTTGTATAATCCACACGCTTTCGGTGAAGGTTCACGCGTCGAGAAATGT
> GCACCCTCAGATTGTACGCCTGATTTAGCATAGGAGAATTTTAATTACTAACCACCCAAA
> TCTCTTACTATAGTCGCTCACTATCAAATTTTTACCATAGGCTTAAGTCTTAAATCTCGC
> CAAAAAAGCTTCTTGCCTACAGTATAATAAATACAGAGAAACTCGACCCTTGGTACTTAA
> TCCCCTTGAATTAAACTGACTTAACAAGTAGGTCGCCAGGTTACCATTTTTCATTTTCAT
> TGAAGAGTCGCCCAGAGCTGCTATATGTGGAATAGCACAACAACACGCAAGCCTCTAACT
> ATATAGATGTATTATGCTACGGTACGAAGCCCAAAGCCCGAAGTCTTCACGGGGTCTGAT
> AATCTTTAGCAACATTATGAACTGTTACAAAGATTCCTGCCTTAACATTTTCCCAGGCTT
> ACTGTTTAATTTATTTAAGCGTCATAAGTTCATAATAAACTAATAGTAGACGAATTTTTC
> GCAGTAATACTTGACTTCAGAGACGGGACTCGAGTGGTTTGACACATGGGGGCCCTAATG
> AAGATTTCATTTCGGTTCACCGTCAAGATGCATCGGAAGTGCGGACTTGGACACGTCCAT
> ATCATCATAAGGTCGACTATATCGGTTCTACGATGCTTCGTAAGTGTCAGCTGCTCTGTC
> TAATTTTGTTATATATATTGACCTTAAATTGAGATATTGATGTTGGAATAGCGGATCTAG
> AAGACTGAATTGCGTTAAGAAGCACTAGAATCGTAAAAACAAACGCATCTTAGCGTGCTC
> AGCCACAAGCACCACCAACTTGTATATTCTCGTGCAGTTTAGATCGCGCTGTCTACAAGC
> AGGACTGGTCAATTTGGTCAAAATTCTATTCCACGGTCCAGACTATCTACTAATCCTCTT
> AATGGCACAATGACAGTTTCTGGCCATAATTAGATGTCGTCTGTACACTGGTGTTATAAT
> AATGAGATACACTTCGGCGCTATACTTCCGAAGATCCCCTCATTCCGAGCATTTAAGGTT
> CGACGAACATTGAGACTTTAGTATTAGTCTAAAGTCTCCATTTTGTTTCAGTGCTGTTAA
> TAAAAATACAATTGGCCATCAGCTCATCGTACTACGACCAAAATTAGACTGAACGACTTT
> TAATGTTATCGTATTGCTTCATCCGCCGAGTAGGTGTCCTAACCGAATTGTTTTAAATCC
> CAAGAGTGGTTCCTCAGACTAAATTCTCGCTCAGGCGATAGGAAGTATGGCACATCTAAT
> GGTGCTCTTTAACCAAAGATCCGCAGATCTAAACCGTTGCGCAATTTATTTTAAGTACCT
> CTTTTGTAGATCCCAGTTTACAGGTCATATGTTTAAAACGAATCTGCTTATCCTTATAGA
> AAAGGCACAACAGTTTTGTTAGCCGAATAACACGTGCCATATATGTTCGGCGTAAGAAGT
> ACGTAAGGTGGTTGAGTATTTACATGGTACTGTATTATTCCTCCTAAAAAAATAATATCA
> TTTTCCCGTTCAGGTCTTGAACAATTTTTCAAAACTGCTATGCACAAAGGTAGCGCAACA
> ATGCCCCGAAGCGATATCTGATAACGTACTTGTCTATAAGTACCTGATCAGTTAACGAGT
> GTGAGCTAGAGTCGCATTTCTGTCGAATATTCTATCAGACTTCTCGCGAATATGTGCATG
> CGTGGGTGAGGAGCTAGTCTTGGATATTAACTTCTTTACTAAGAAGGGCCCGAAAACATC
> TAAATCGGAACTGATGACATAATTTGGGAAAGGACTCCAACTACGATTAAATCGTTAAAA
> TATAGTAATTATGTTCCTGCTATGACATTTCTATGACTAATTCATTAAATGCGACTTCTC
> GTAACTCATACACGATGCAATTCAGGATATTATCATTGAAATTTATCAATTAGTGGTTTT
> CTTTGTGAGTGCCCTTAGAGTATTCATTGCGAGTCGTAACGGATCTCTTGGTCAGTATAG
> AGCATTATAACCTTGGGAAATCCAGAAGTTTTCCTACCTTGTATTACTATGCTTTGCGGA
> TGTTGCGCGCTGACCCCATAAGTCATTGCATATATCTCAGGTTAGTTAGGTACATGGTAG
> TATCACGAACGAACCTTTTACAAAGATTGTGATCATATGTAGTAAACAATGTAACAATTC
> ATATTTTATGATTCCTCGGCCGCTTAGCTACGTTGCATAGGCTATAATACAATGATCGTC
> TTGCGATAGGGCTTTTGTAGTGGTTGGACGTGAAATGTCTGTTTAATAAATCGCAAGCAG
> AATTAACGTATCTAAATGGTCTCTTTCTTTGTATAAATAACTCTGGTGGCTGCATAGCAC
> AGAGGTTTTTATGGCTGCAAATATAAATAGGTTCTTAGCACACAAAGATGGAATATCCCT
> TTGTTATCTTAACTTACAGGCAACCTCTTATGGTATCTTAACTCGTCCCAAGGTCAGTTG
> GCCATAAGTGTGCATTCCACCGAGTTAGATGATATTAAAAACTTTTTCTTACACATATTG
> ATAAGCCATTATCATGCCCCTTATACTCTCTCTGTGTTACGTTCGACGCCAGAAAATATC
> TCTTTATAATAATCTAGCTACTACTTGATTTACACTAGGAATGAGTGTGTGCATCTACAA
> GCTCTGTCATCATTATGGTGTAAGTGACGTCTGAAGACAAAACTGTGAAGGTCAGTTAAA
> TGGTCAAAATCTACACTCGCTGTCACTTACTGATACATTTCAACCTTATTAAGTAAATGA
> GCAACGTGTTGGACAAGTTAGCTCTAAGGTCCCTCAGGCTTTATTCATTAACATATGGTG
> GATGTAAGGACTAACCCTAACGATTTATTCAAGCTGTACAATGACTTCATCCATTTACAG
> GAAAGTCCGGCCTAAATTGTCCATTTAAAGTGCTACTCTTTCCTCCAAAGCGGGATACTC
> ATTAGAGGTGTACTGAATTTTTTTAATTGAATGATGTCGTATTTAACTTTAAGTATGTTC
> GATGTTGCAAATATAATCGAAACAGTGCCAGTTCATGAATGATAGTCTATCTGTTTAGCG
> AATCCATCACTAAGTGACGTTAATGTGATTTTATTTACATGTGAGAGCCATTAGTTATTG
> GATAAAAATCCTGACAATTTGAGCATGTCGGAACTCAGTCTAACGGATGACGTCTAGTTC
> CTACTGTTAAATCATCGATTACATCAATGTACCAAAATTCCCTCTGTCAAGAGTTTTGCG
> GGAGTCATAATAGCAACACCGTGTACCATGGTAGTCAATTATGGTCTGGACACTCGAACA
> ATTTCATACTGTGTATGTGGCCTAATGTGCTTTCGACCCAAGGGCTGCCTTACAATTTAG
> ATTAATAGAAACCATTAATAGGGTTAAACACCATGTTATTTATCCCGATAAAACTACGAT
> TGAGGTATCGCATTGCTAAGGACATGAAGCAAAAGACACTATGTGTCAGGCAACTTGGGT
> CAAGACAGTCCACACCTCCTGCGATGTTGCACGCTCCTAGTCTAGACTAACGGTTCCTAA
> TTGTAAAACTCTAGAATATATGGTCGACTCTTAGTTAATCTTGAATACCTTAATGACCAC
> AATGATAGTTGCATAGAGGATGTGAACTTGTCGTTACTCGGTCGCTGAGGCACAAGCGAT
> GTTACAGTTTTGAATTCATTTCACGTGGTCCATCGTCGATCCTGTCTTGAATCAAAAGGT
> AACCGTAAAGATTTCAGGTCGCAAGGCCGTTTCACTCGCTGTCAACTGTTGATTAGCATA
> ACCCATATCCAAACAGTAACATACGCGGCTATACGAAAGATCTTCAGACCTAATGTAGCT
> GAGGCTTGTAGATCCCGTCACCTTAGAATTCGAATCCACACGTCACTTATAATCCTAAGG
> GTGTGGTGTAGTGAAAGACCGCCGTCTCATTGTGCCGGTTTATTCTGACGTTATTGTTAA
> AACAGTTGACGTACAGATGATTGAGAAATCCATTTGAATGCAGTTATAAGATGATTCGAC
> GAGTTTTTAAAACCAGCATAAACGGTATCCCGGTGAAATCTTTTTCCACTCAGTCTAGAT
> TCAAAGGTTGGAACAAAAATTATCACGAATTTCTATGATACGCATTGTGTAGTAAACATC
> ACGTTCGTCGCTTACGTGTGTTTCTGAGGAGTAATCTGCATTAAATTTGAAGGCTAGCCT
> CGTATTTGCCAATTATTCTTTTCGATCACAAACCACGTGCTGCGTAGTTCTAATGGGACA
> ACTCCTACTTAGCAAACAGTAGACAAGTTTGGAACGCATATCTTCAATTTGAAGCCAGAT
> TATCCAATGGTAGCACATACTTGTTGAAAATAAAAACCCCCACATGACAGTAAATAAAAT
> AGCCAAGTAAGCATGTTTATAAAGCATGTATCCTAGATCAGCAATTAGTGGTATCTACAT
> ATGCACTGCAACTCGTACACGATGTCGGTCATAAATCTATGAAACACTTACTACGAATAC
> GGGTTTGAACGGAATTAAATAGTCGAAAAATTTAAATTCGTCGGTAACGCAGATGTTGGT
> TATCCTCTAATTGGATATACGGATCACTAGGAGAGAGGGATGGACGCGTCGGTTACAGAG
> TAGCCAACACTATAAAGACGCGCAGCAAGATGGAGTAATTTCCACTACTTCACCTCGACC
> AGCAGAAATAAAGCTGTTATTATACATCGGGACATGAAGGTTTTATTCTTGTGTATTAGA
> CATCTTACATCTGTTGATAGATTGGGCTTAAAACGTTTTTGTATTAATTGTATCTTAGAG
> TGTCATCTTCTCAGTTCTGCGTAGCTGCTTCAATGCGTGCTTCCTTCTTCTCCGTATACC
> GACATCAGTTAAAATTTGTCGTACTGCCGACACTTACGAGATTCCAATTTAATATGACAG
> TTAAATGCGCGTGCGCTTTCAAACCTCTATCAGGATAGGCTCCTTCGACCATGACGCGCT
> CTGAGAGGAAGTACTATTTGTTGGTGCTGAGATTTAAACTCCCCCCATCCACTTGGGATT
> TAGATTCTTCTAATCACGGGGAAGCTCCCAAGCGGTCTTCATGGAGTCTCAAGGCTGGAC
> AACTTAAAATCTGTTATCGGAATCACTTTGTCGGCTATATTAGGTGCTATTATTTATGCA
> AGATGCGACATCTTACTTTCATGGCAGTTCTGTCAACAGCCAAAAAGTAATCAGCCGTAA
> ATAAATCCCTTGCGTGGTAATGGATCCAGAGTTATTCGTATTCCTTTATGAATCTGATTA
> AATCAGCATAGCAGAGGAAGCACGTGACCTTAGCACATAAAAGTATTGTTGCGAATGATT
> GTACAAGATGTAGTGGCAGTTTATGATATTAGTTGATCAGAATAACGAGATCGCATTGTA
> ATTAATCGAAGACATGACTCATGTAGTTACACCTGACTTTTCAGTTTATACAGAATATTC
> CCTTACGTAGGTTTTTTTGTTAAAGCAAAATTTACTTCGCAAGTCTTTAAGGTCGGGTTT
> TTCTATCGGAACACAGCTCTTTACTTATATAACCTCTCTTAGGTCTAGATTATGGTAATA
> AGTTTTAATATACCTGGAAATTATCCCCGTCCAATCAGAAGATCATACCCATACATAGGT
> ACTAGCGAATATGTGAGATTGTTTATTGTTTTGTCTTCTGGGGAATCACCTTTTGGTCCT
> AATATTATGTAGTGACATTATCTAAATTATTCTGCATAGATTAATAACCAATGTTGGGTA
> ATTCTCTGTCGAATACCTCGTTCTCTATCTGAACTATATGTTATTGATAATGTTACGCTC
> ATTCGGGTTTATTCGCTCACGCTGCGAATGTAACTTCTGGTACAAGCGTTCGATGAATGC
> CACATATCTAGAACAAATGACAAAATTGTTTATTTTTAGTAGCTCATAGTTGTCCTCAAG
> TTCTGACCACAATATATAGCTTACCTAATGGCGGAACTTTGAGTGCGGGCTACCACAATA
> TTCGATGCCTGAACTCTTCGTACTGAGCCGCCATGATAGGCATGACACTAAGATGCTACT
> CTCCGGCGCATTCGGTAATTTGTCTAAATCCGTTGTGTTTAGGAAAACGAGTTAGCGCTC
> GATCTTTTTATTCTGTGCGTAGGTAACGTTGATGAATGTATCTCCAGCTCTGGAATTGAC
> GCAGAGAACGGTGACCCTCAACCATAAGGTAACAAGATGCGAGGGTCCTTTATTCAGCGG
> CTCCTCGCTCCTGCAGCGAATTATTTCGGAACATTACTGGCTTACATTGAGCAAGTTCCA
> AATGGAATCTCCTACCAAGTGCCTAATGCACGGGTCAGAATTTCGGAGATCTAATATAAG
> AGTGTCTTCACGGAAACTACTTATTGATCCGATGACGAAACCTAACAGTAATTCACTCCG
> AGTATATTTCGTTTTAACCTTAACCAAATTCTGTTGTTACCATGTTACCGTGAAGGAGCA
> GGTTTCCCCGCCCAGTATCCCTTTGTCTCTAGGCTTCAGACTTAATCTATTACGCGACTA
> CAACTGCTTTGGGTATTTAAGTCGTGATGATAGGTATTGGGTAATTCTGTGCGAGCACTT
> TTAAACATTCACGGTCGCGTTCGCTATCGATTCCAACAATTTTGAGTAAGATTGCTTCTG
> TGATTTGCGAACGGAATTAGCCTAATCGATTATAGTCCATCTTAGAAGCCTAATTTCTTT
> TCCATTTCCCCTGAAGACTCGAAGGCCGCTACCGACTACAGTCATACGACATTTATGAGC
> CGTGATAAAAGTGAAGGGGTCCGCCTTGACAACACATTCATGGAAAACTATTTAATTAAA
> AAGTCTGATGATTGTCTATAGTAGGGCCCTCAATTGCAATTTGAGCACACTAAGCGATCT
> TATGACAGATGACAGAGAAATTGTCGTCTACCGGTTTACCTGGAAATGTCTAGACTAAAA
> TTTAGCAATTCTAAGTATCAACATTTAGTTACCGTAACTGGGCAAGAGACTGCATCTATT
> ACCGCTGAGTTCTAGGTGAGATACTTTAAATGGAGTCCCCACCCGGACAAAAAGGAATGT
> TGTATACAATGTTCAGTTTGCTGATATATCGTTCACGGGGTTGATCTGATTAACTAAGAT
> ATAGGATTGCTTTTCTAGAAAAAATCGGCTATTAAGACCTGTATATTATATCGACCCGTT
> AAACTTCTCAAATAGGTCGATATAAGCTCGATCGTCAAGTTATATGCGTATTGTTTATCC
> TGTCCAGGCATGGCATTAAGAGTTCGTGAACTCATACGATCACCCACTGTACTTTACATA
> GAGAAATTGTTACTATTCTGATTAAGCCCTAACCTAATCTCCGAGATTACAACCTTTATA
> ACCAACTACATAGTTCTATGGAACAAAAACCGCTTTTGAATTCGCCCACACCCATCCGGT
> TTATCACCTATTTTATACCAAAATTCTACTACAGCCAATTGTACCACCTGTACTTTTGTC
> TAAACGCGTAAGTGCGAGCGGGAAAACATTTTCGTAATCTGATTCACTAATTTTAATCAC
> TCTGTAGATACCAACAACAGTTTTATAGGCCTTAATCGAGTATGAATTTCCATTTCTACT
> GACTTGCTGAGACACATTCACTGTATCCTTACAAAGGAGTATTTCTAATGCACTTACTGA
> TGACATTTACCCATGATTTAATTATGCTACGACGTAAGTTGTAAAAGTACGAGTCTTTTA
> GTCTTTAGATATTTATATATATACTCCTGGCGAAATTAATACTAATTGAAGCTGGTTTTT
> AGATTAAGGTGGGGTACTGTTATAATTGAAGACCTATTTGCTCTTCCATCCTTTGTAATT
> GTACCGAGTGTACGATACACTCAGTCTATAAAGGAATTAGTACAAACCACGGAGCATTCA
> AGAATACGATTGCAACGCATGCTAGCTTATCATATAAACTTTAAACCTCGATGGCATATA
> TTATGATATGACGTGTCTCACCCTACTTTGACTGTTAAAAAATGCTACTGGCACAACAGT
> CCCAAGCTTGACCTAATACATGAACTCGATGCAGATCGTATCCGGTGTATTTATCTCTCA
> GAACACGATCTCTACTGATGCACCCAGTAGATTTTTCTTTCTATGTGAGGTTTTTTTGCG
> ACAGTACAAAGCGGCGATATAGTGAGTTACGACTGTCAGTCGAGAACTGGTTTATAGAAA
> AGTTGTGTTCTTCTAGCACCATGATTATTAACTAGCTTTTCACGAGGTTTATGACAATTC
> TAGCATTAATCGTCTAAAGGCCCGTACTTCTCTGCGCTGGCTAAAACTGAGACCCTCTCA
> CGCCGCTTGTAGGTGAACTAATGGTAAGTATCCTGTGCCCCCACAGCCATGCATCCAATG
> TCTGGATAAAACACATCACATTGACACAACATTTGCATAACTAATATTCCTAGTAAATAT
> ATTCCTTTGACTACCCCCACGTTAATGTACACCATGCGGCATTTAAGCGCGATATTATAA
> GCATTTATCAGTCGATTACTGTTTGCTCACTCCGCAGACTTCCGCGTCTTCGTAGCTTCA
> ATTAATGATTAATCTATGAGCTAGTCGAATCAACACCAGGTTTATGTATGTTATTTACGT
> AATACTGTAGAGATCCATTGTATTGATCTTTATGCTCTTTACGAACCGCTTTGTAATTAC
> GTTCGTAGCCCGTAGAATTCAGTCAACAATATTCTTCTGTTGCCTTTCACCTACTTTCCA
> GGTGAGCTGCCAGTCATAACCGAATTAAGTCTCTCTGAATAAGTAACGCATTCTATGATG
> ATGAATCGTTCCAACCCGACGAGTTTCTACAATATAATACTAATCCTTAACTTAATATTT
> GTTTAGCTTGTCGTCCTAACTCAATCCGTCTTCAGTATAAATATGGATGCGTATAATTAA
> TACTGGATCTCGAAATGAGTCCTTAATAGTCTAAACGTATTGAAGACAGGCCAAGCAGGT
> AATGACATATACTTTCAGCGGATTTAACAAATTCGTTAGTATGCTAGATTACTCCCCGAC
> CAAAATCTAGTGTCCGACGTTACTACGTTATCAGTTTCTACGATGGCATAATGTAGCCAG
> ATTATTTGTATAGTCTTAAATTATATTTATAGTCAAGTATACCTACAATCTAGGACTTTC
> TTAATATTCTGGGTAAGTGGGACATAATCACATCAGCAGATATAGTATAAATCAACTCAA
> AAGAGAAATGCTCGTGATGTTGTACTACCAGCAATAACGAACGATAAATATTGGTTTTTA
> AGTAGACTACTTTTTGGCGGCCTATATCACTTTCAACGCTTATAACACTTGGCCAATATT
> GATGATAATTGAATTTGAGATTTTGGCACACACGATTGGCACATGGATGACCCTATGTCA
> TTAATTTATCGCGAAGGGGGATACGTTGGCAAACCGGATTACAAATAATTTCATTGTTAT
> AGTATATGTGGTATCATTTTATACTTATTACTACCCATTGCCTAAATTTGGTTCCCACCT
> AAGTTAGAGCATGATCATGACGGTCGTATGACACGAAGTCATCTTATTTGTTATTAGCCG
> CTAACTGGTAAAGCTCGGGTTATAGCGGATGCTTGATCAGTTGTGCAATATAACCTTTTA
> TAAAGTATGGTTAAAGTTACAAAACCTAATTATACTGCTAATTGGAACTATATGAAGCCT
> GTGAACTTGAAGATATAGCGAAATAAGAAATCAATGCACCGGCGAGTATGCTAACTTGTA
> TGATGTAGCTCAGATAATCGTCATCCGGGGAACTAAAATAAATACGCGGACGTAATATCA
> GCTTAAATTGGAAAATAGATCAGTTCGGTAAACATGATGTTCTGATAAGACACTAGCCTA
> TTTAATTTTGGTCCGATGATAGTAGCGATAGTATCCCCAAGGATTTGTAACATGTTATAT
> ATGGCAGATAACGCATACATTGTTCATGCGCGATCCAGGGAAATCTAAACTTATCAGTAT
> AACGTCAAACTTTGCAATAGTAGACTTTACCTCGTCGGTATATATCGAAGAACGTGCATT
> ACCAGGTCAATACCACTTTCCTCGTAGTTAATGGGCCATTATACGATGTACAACCTTAGT
> AGAAGGTCGGGTCACCTAGGAGAAAACATTCCCTATACGTGTAATATATCTATATACGTC
> GGCACAAAGTGTGGTCTAATGAACTTTTATGTGACGTACCCACCTTCGGTTAACGACTGG
> AGATGGTGTCCGGTACGAAGTAGAACTGGCGCAACGCCAGACTTTAGGTTGTAAGATATT
> CATGCCAATTCCAGATATAAGCAGGAATGAGTGGCCATTAGAATAATAATTCACAGCATA
> TCGGGTATCGATAACCTTTTGAATTCCTGGGCAGGTTATGGCATAAAAAGAAACAATCTG
> AAAGATGCGGTCCTACTTGCGAAACAGATTTGTCTTAAGATACGTAATCAAGCCTATTGA
> CTTATCAATATCGGTATACACAGAACACATCTAAAATTACAGAATAAGGTAGATATGTCC
> ATATATTTCAAATACACTGCGTTGAGAGGGGGGTCGTGTTCTGACCATCTCTATGTCTGT
> AGAACCCTGGGGAGCATTTTCACCCCCTTTACTTGGTGACATTAGTTCATTCCTTCATTT
> ACAATGAACATCAATACCTGATGACACTAGCCTTGACGTCAATATTCATGGCGGACTACT
> CTGACACGGCGGATCAGTACACAGACACATCCCAGCTTTTGGTTACTTGGTACATTACTA
> TCGTTATGTGTTTTTAAAAGGAATCCCAAGAGATACCGTTAAAAAGCAGATTTCTCTCTT
> TCGCCTACATCTCAAAATTGCAAATGTATGAGTAGGTTTCTAGGTGATTTACGGAGGCAC
> CCGAAGTTAGGAGATTCAGTGTTTTGATCCTGGACCTCAGCGACTCTTGTTTAAAGAGTT
> GTAAATCTCCTAGGTTACAATTCCCTGCATACGTAGTATTCCCGACCTTAACTAGAGTAT
> GAACGGTCATGAGTGAGGTATTCGTGCCTTGAAGAACCTATAAGAAATTCAAATTACGCA
> CGGAACAGTTAAGTCCTGTACAAATGGCAAGGTATGCGTCTTCAACGAGTTAGTATCTAG
> ATACAATTAACTATGAGAAACGAAATACTAATCTGTAAATATCGCTAAACGGGACAGCAA
> AAACACCTAGAAGTCATGTCCAAATAAGTAACGTATGGATTCCATTAATTCGCCGGCTAA
> AATAAAGTGTCCTCATGCATCGATCTATATATCAGAACCATACGCATTCATCGAAGTTAT
> GAAGCCTCATCTCTTTGTTGAAGAGCTGTTTTATTCCTTTTGGATAACCCATGCTTTTGG
> CTAACCATGACTGGATATGACACTTACGTTGAATTTTCTCATTCGACCGGTAAAACTTGC
> TCCTGCGTGGATTAAATCAATGCTTTAAAACTATATCGCGAGCGTTTTACCGAGAAGTTA
> TCCGATAGACTTGAAAATGTAGGGAGGCGTCACCCACTCTTGCCCGTACTATCTCAAAGA
> TAGTATCGAGAAGTCCCCAGCCATGTGCTTTGATTTTTGTTGTATCAAAACGATGTAGGT
> CAACCTTAACCCGTCCTGATATCTCCACCCGCACAGTGGAAGAATCATTTAGAATTGGTG
> ATTGTGAAGTAATATACAACCAAAGATATTTATAGACTCGATAAATATCAATGGTTTAAA
> TTACCATTTAGGCTTTAATCGACACAAAAATCATGATTGACGACTGGTTTATAAATTCAG
> TCAATCGAGAAACTTGCTTCTGAATCCCCTTCATTTATACTGTCTTAACAACTACCGCGC
> AAGCTGACAATTTTTCAGTGTAATTGATCACTCGCCCTGACCTCATTTATCTGGAATACC
> AATTAATCTACAAACCCTCTAACGTTTTACATGGTTTATCCTAACGGAACAACCACTTAC
> CCCCTAGTCGGATCGGGGTATCATTATCTGTAGCTAATGGATGATAGGTTAAAATGATTC
> ATCACTTAACAGTTTCCCACCCTTACGGTGTTATTTATTGAACCGTCATTTGTTAATAAT
> AATATTAGACTAGAAGAAGTTTTCCATCGATTAATTCAAGTATGAGACGGCACTCCAGGG
> GTTTGAATCAGGCCCGACCTTATGAAGATGTCAGGGCGGTTAAACCTAATCTTCCAGCGG
> AAGTCCGCACTGGCAAAACTCCTTAGCTGCTGAAGCTAGACTTTATAGCGTATACCATCC
> TGAGGAACGCTAAGATCCTATGTATAATGTTCTTATATTGTTTGACCTTATATGCAGTTT
> TTCATCTGGCAATAGCCCTTATACATGTCTCAATTCAGGTATCAAGCAATAGATTACTTT
> TTTCAAAACCATATTTGCGGCATAAGCCACATCCACCACCAACTTCTATAGTCGCGTGCA
> GGGGAGTTCCCGCGGTCTACAAGCAGGAATGGTCAAGTTGGTCAAATGTCGTTGCAAACG
> TAAACTCTTGATACTAATCCTATGTAGGCCACATGCAATGTTTCTGGCCATAAGTTCATG
> GCGTCTGGTAACTCCGGTGATAATTAGGAGATTCACTGCGCCGATATAATTACGAACATA
> AACTCAGTAAGAGAATTGAACCGTAGACCAAAAGGGAGTCTTTAGGAGTAGGCTAATCTA
> TCCATGTGGTTTCACGCAGGGGAATAAAAATACTATTCCCAATAACATAATCCGAATAAC
> AACAAATGTAGACTCAACGAATTTTAATGTTAGCGTATGGCTGCTGCAGCAGTGTACGTG
> TCAGTACACTATTCTGTGTAATCCAAAGAGGCGTTACTAAGACGAATTTCTACCTCAGGC
> GAGTGGATCTATCGAACATATTTTCCGCCTAGTTTACAAAACTTCAGCAGAGCTTAAAAG
> GTCAGCAAGGGTTGGGAACGACATCGTTGGGAGATACCAGTGTTCAGGGATTATCTGTAA
> AACCAATCTGCTTAGCCTTTTTGAAAACCCAAAACAGGTGTGGTTGCAGAATAACACCTG
> AAATTTATGTTACCACTTTGTACGTCCTAAGGGGCTTGAGTATTTTCATGGTTATCTATT
> TTTACTCATAAAAAATGAATATAATTGGCCAGGTCAGGTCTGGATCAATTTTTATAAAAT
> CATATCATCAAAGCTAGCCATACAATCCAACGAAGCGAGATCTGTTATAGTACTTGTCTA
> TATCTAACTGATATCTTATCCACTCTGTGCTAGACTACCATTTAGGTAGAATATGCTATC
> ACAATGCTAGCCAAGATCTCAATGACTCGCTGACGTGATACTCTTGCTGTTTATCTTATT
> GAATATGAACCCCAAGAAAAAATCTATAGCGCATATGTGGACTTATGTTGGCAAAGGACT
> CCTTCGACCATTATTTAGTGAATATTTACTTATTATCTTCCTCCGTTGAAATGTATTTGA
> CGTATGAATTATAGGAGTAGGCTAGTAAATAAGTCACGTTGCAATGATCGATTTGAGAAT
> TCAAAGTTATCAAGTTCTCGTTGTCTGTGTGTCTGCCCTTACTGGAGTAAGGGCCAGTCG
> GAACCCATATCTGGGTCAGGATAGTGATTGTTAAAAGTCGGAAATCAACTAGTTTTACTA
> CCTTCTATTACTATGATGGCCCCATGGTGAGCCCGGACCAATGAAGGAATGGCATATATA
> GCAGGGTACTTTGGGAATTCCGAGTAGCACGTACCAACCTGTTTCTAAGATTCTGAGATT
> TGGTAGTAAAAAAGCTAAAAAGTCATATTGTATCTTGCAGAGGAAGCTTAGAGAACTTGC
> AGACGCTATAATTCTAGGTTACGCTTCACATACGGATTTGCTACGCGGTGCAACTGATAT
> GTATCTTTTTTAAATCGCAACCACATTTAACCTTTATTATTGGTATATTGCGTGGTATAA
> AGATATCGCGTGGCGGAATAGATCACTGCTGTGGAGGCCGGCTATGTTTTATTGGGGATT
> TCCTATCTAACAGGCTATATCCCTTTCGTTTCGTAACTTTATCCCAACATCTTATGGGTT
> ATTTAATAGTCCCATCCTAAGTTGCCAATAAGTCTGAATTCCACCGTCTTAGTGGTGATG
> AAAATATTTTTATGTATCATATTGTTAAGCCAGTTGCAGGCAACTGATTCTCTCTCGCTC
> GTTCCTTCGACGACAGTAAAGAGCGATTTATAATAATATAGCTTCTAAGTGATTGACACT
> TCCTATGAGGCTGTCCTGATTATTGCTCTCGAATCATTAGGCTCTAACTGAACTCTGAAC
> AAAAATAGGTCAACGTATGTTAATTGCGATTTTTCTACACTCCCTGTATATGACTGTGAA
> ATTGATACATTATGAACGAAATCACAAACGTGTTGGAAAAGTTAGCGCTAAGCTCACGCA
> CGCTTTAGGCAGTTAATGATGGGCGTTCGTAGCTCTAACCCTAACGTGTTATGCAAGATC
> TTCTATGACTGCATCCAGTGTCTGCTAAGTCCCGACTATTGTCTACATTTATACTCCTAC
> GCTTGCCTACTAAGCGGCTTTCTAATTACACCTGGACTGATGTGTTTTAAGTGATTGTTG
> TACTTTTTAACGTGATGTTGCTTAGATCTGGAAAATATTTGACAATAAGTGCCTGTTAAT
> GATGCATTCTCTAGCTGGTTAGCCATTCCTTCACTAACTGACCTTAATGTGATTTTAGTG
> TCATGTCTCTGACTTTAGGTTTTGGATTAAATTACTGAATTGTTGACCATGTCGCAAATA
> AGTCGAACGCATGTAGGCGTGTTCCGACTGTGTAATAATCGATTAAATAAATGTAACAAA
> ATGCCCTCTGGCTAGTGTTTGGCGCCTGGCATATTTGCATAAACGGCTACAATGCTACTA
> AAGTTGGGTCGGGTCAATAGAACATGTTAAGTATGTGTATGTGGCCTAATGTGATTGCGA
> CCCTAGCCCTCACTGACTATTTAGATGAATAGAATAAATTTTTACCGGTATACTCAATGT
> GAGTTATCCAGAGATAAAGACGTTTGAGGTATCCCATTGATATCGACATCAACCAAAAGT
> CACGAGCTCGCAGCAAAATTGCCTATACACAGTCCACACCGCATCCGATCTTCAAAGCTC
> CGACTCGACACTAAAGGTGACGTAGGCTAAATCTATAGTATATTTCGTAGAAGCGTAGGT
> AATCTTGTATTACTGAATCAACACAATGAGAGTTGCTTACTCGATCTGAAATGCGAGTTT
> CTACGTAGATGTCGCAATAGAGAGCTTACTCTGTGCATTTCTTTTCTCGGCCTCCAGACT
> CGATAATCGCTTGAATCTAAACCGATCAGGATTGAGTGCACGGCGCAAGGACGTTTAAAT
> AGAGGTAAAATGTTGATTACCATAAACCAGATCAATAAAGTTACAGTACCGGCTATAAGA
> AACATCTTCTCTAAGAATCTAGATGAGGAGGCGAGATCCAGTCAAATTACAATTCGTATC
> AACAACTAACTTAGATTCATTAGGGTGTGCTGTACTCAAAGACAGAAGTATAAGTCGCCA
> CGTTGATTCGCAAGGTATGGTGTAAACAGTTCACCTTCAGTGCATTGAGAAATACATGTG
> TATGCTCGGTTATCATGAGTACTAGAGTGGTTTATTCAAGCTGATTCGGTAGACCGGTGA
> TATATTGGTACACTCAGTCTAGATTAAAAGGGGGCATCTAAAATGTTCTCCAAGTGATAT
> CATTCGCTTTCTGTAGTAAACATCAACTTCGTAGATTACCTGTCTTTCGGTGGTGTTTTA
> GCCTGTTAATTGGATGCCGAGAATCCTAGTTGCATATTATTCTGTGCCTGCAAAAAAATA
> GGCATGCGTACTGCTAAGCCGAAATAGACTACTTTGCAATCAGTAGAATACTGTCCATCG
> CATTGATTCAAGTGGAAGCAAGATTATACTAGGCGACATAATTCTGGTGCTTATTTAAAA
> ACAACTCATGACAGTATTGAATAGAGAAAAGTAAGCATCTGTATAATGAATCTATAATTG
> ATCAGCAATTACTGGTAGCGACTGTTGCAATGCAAAGACGACACGATCTCGCTCATAAAG
> ATATGAAAAAATTTCGTCGTATTCCGCGGTGAACGCATGTAATTACTCCTAATAGTGAAA
> GTACTCGGTAAACCAGTTCTTGGTTATCATCTAAGTCCTTAGACCGATCACGACGTCACA
> GCGTTCGAACCCTAGGGTACAGACTTGCCTACTAGATAAACTCGCCATGATTCTTGCAGT
> TAGGTCATCTAATTCTCAGACTCAACATCTTATAAAGCGCGGTTGAGAATGCGGGACATG
> TTGCGTGGTTTCTTGTGTATTTCAAATATGTCATAGGGGGAGTGATTCCGATTTAATCGT
> TTTGCTTGTTAGGGGATCTGAGTCTGTAATCGTATCTCTGCGGACTAGAGGCGTATTTCC
> GTCATTACTTCTGCGACCGATACCCTCATCAGTTAATATTGCTCCTAATGCCGACAATTA
> AGACAGTCCATTTTAATATGACTGGTTAATGCGCGGGCGCGTTCTAAACGCTAGCTGCAG
> AGCATACTGCCACCATCTCGCGCTCTCAGAGGTAGTTCTATGGGGTGCTGCGCTGTGGTA
> AACTCCACACAGCCACTTGCGTTGTAGAGTCGTAGAAGAAAGGCCAAGCGAAAATGCGCT
> CTTAAGGGACGCTCAACGCTGGAATAATTATTATATCGTTTCCGAATAACGGTGGACCCT
> ATATGTGGGGATATGAGTTTTCAAAGAGGCGAATTCTTAATTGCATGGAACTTCTCGATT
> CTGACAATATGTATTCTGACGTAAAGAAAGCACGTGCGTCCTAAGGGATCCACAGGTATT
> CCGATTCATGTATCAATATGAGGAATTCAGAATAGAACACCTACAAAGTGACAGTAGCAA
> ATAAATGTTTTGGTCCCTATGATTCTAAATGATGGAGTCCAACTTTATGAGTTTTGTTGA
> GCAGTATAACGAGAGCGCTTGCGTATTAAGACTTGACATGAAGCATGTAGGTACTACTCT
> ATTGTCAGTTTAGACAGATTAGTCACGTACCTTCCTTTTTTTCTTTATCCTAAATGTACT
> TACCAAGGCTTGAAGGTCCCGTTTTTCGATCGGAAAACACCTAGTGACTTATAGTAAAGC
> TCGTACCTATAGTTTATCCTAATTAGTTTTAATATTAATGCTAATTAGACACGTACAATC
> AGAAGTGCAGACCCTTTCATAGGTAAGACAGAAGTTCTGAGTTTGTGGTGTGTGTGCTAG
> GATCGGCAATAACATGTTGGTCCTAATTGTATGGAGGGACTGTATCTATTTTAGTCTGCT
> TTGTTTTTGTAAAAATGTTGGGGAATTCTCTCTAGTATACATAGGTCTCTATCGCAACGA
> GTTGTTATTGATTAGCTTAACCTCAGTCCCGTGGTTTCGCTCACCCGGCGAATCGAACGT
> ATGGGAATAGCGGTAGAGGAATGAAACATATCTTGAAAAAATCAATAATGTCTTGAGTGT
> TAGTAGCTCATACTGCTAAGCTTGTGATGTCCAATATAGAGACCTTAACGAATGGCCGAT
> ATGTGTCTCCCGCCGTCCAAAATATTCGTTCACGCAACTCTTACGTATGTGCCGCCATGA
> TTCCCATCAAAATATCAGGCTAATCTACGGAGAAGTCCGTTATTTCTCTTTATCCCTTCT
> GGTTTGGAAATCGACTTTCCCATACATATTTTGATGCTCTGCGTAGCTAAACTTGATGAA
> GCGATCTCCTGCTATCCATTTGAACATGAGAAACGTCTCCAGAAACCATTAGGTATCAAG
> AGGAGACCGTAATTTATTCAGACGATCATAGCTCAGGAACAGATGTATGTCGGTTAATTA
> ATCGCGTAAAGTCACAATGGGCCAAATGGTATCTCCTACCATCTGAAGTATGCACGGGGC
> ACTATTTCGCAGATATAATTTAAGTCTCGCTGCAACGAAAAGAAGGAGTCTGAAGATCAA
> GTTTACTAACACGAATTAACGCAGACGAGATTTCCTGGTTACCGGAACAATTTTCTGGTC
> TGAAAATCGTTCCGGGAAGCACCACGTTTACACCCAAAGTATACCTGTGTCGCTACCCTT
> AACAAGTATTATATTTACCGTCGACAAATCCTTTCCGTTTTTTAGTCCTGAGGTTTCGTA
> TTCGGTAATTCTCTCCGTGATCGTTGATACAGTAAAGGTCGACTTAGATATAGTTGACAA
> CTATTGTCACTAAGAGGGCTTCTGTGATTTGCCATCGCTATTAGCAGAATAGAGTTGACG
> CAATAGTAGATCAATATTTTCGGTGCCTGTTCCAAGCAAGTAGCGTACGACGCTACCGTC
> TAATCGCTTAAGAAATTTAGCAGCCCTGTTAAAACTCAAGGCCTCCGCAGTCTAAAAAAA
> TTCATCGATAAAGATGTAATTATAAAGTAGGTTCATGCGCTAGAGGAGCGCCATCATGGG
> CTAGTTGTCCAAACTAAGAGATCGTATGTAACAGGAAAGAGTAATTGGACTCTACACCTT
> TTACTGCAAATCGATAGTCGATATTTTACCAATTCGAAGTATCAAAAGGTAGTTAACGTA
> TATGCCCATGAGACTGCATATTGTACAGAGCACTTATACCGGACTTAATTTAAATGGACT
> AAAATAAACCAATTATAGCTTTCTTGGATTCAATCTTCACTTGGCTCATAGTGCCGTATC
> GCGGTTCAGATGATTATAGAAGATAGAGGATGGATTTGATACAATAAATCGCAGATTTTG
> AACTGTTTATGAGATCGACAAGTTAAACTTATCTAAGAGCTAGAGTTATGCGCGATCGTA
> AAGTGTTATCCGGAGTCGGTAGAATCTCATCCCATGCCTTGTAGAGTTCGGGATCGCTTA
> CCTTCACCCAATCTAATTTACAGACACTAAGTGTGACTAGTCTGATTTTCACCGAACCGA
> ATATCACAGATTTAAACCTTTAGTACCTTATACATACTTCTATGGTACATAAACCCCTGT
> GGAATTCGACATATCCCATACCGTTTTGAACATATGTTTTTAAAAATTGCTTATAAACAA
> TAGTCTACATCCGCGACGTTTGTCGAAAACACTAAGTCACTCAGCCATTAAATTTTAGTT
> ATCTGTTTAACGAATGGTAAGCTCTAGCGTCAGAACATCAACTCGTTTATACGACTGTAT
> ACACGTGCAATGTACTTGGATACGCTCTTGAGGACTATATTTCAAGGTTTACTTTCATAG
> CAGTAGTTCTAATGCACGTACTGTGGTAATTGAAAAAGGATTTAATTATCCGAAGACGTT
> TGGTCTAAAAGTACGAGGATGGTACGATTTTCATATTTATATATTGACTCCTGCCGATAT
> GTAGAATATTTGAAGCTCGTGTTTAGATTAAGCTGGCGTTCGCTGAGAATTGTAGAAATT
> TTGGCTATTCAATCCTTTGTAATTGGAAAGACTCTAACATAAACTAAGGCTAGTAAGGAA
> GTACTAAAAAAAACGGTGCATTATAGAAGTCCTGGCAAACGCTTCCTAGCTTATATTTGA
> AACGTTAAAACGCGTGGCATGATTGGTTCATAGGAAGTCTCGCTACCTACTGTGAATGTT
> AATAAAGCCTACGGCCAAAAAAGTCCCAAGCTGCACCTTATTAATGAAATCGTTGCACAG
> AGTATCCCGTGTATTTTTCTCTAAGAACAAGTTAGCGTCTGATCATAAATCTACATTTTG
> AGTGCGATGGGAGGGTGTTGTGACACAGGAAATACAGCCGTTATAGGGACTGTACACGCG
> CTGTCGAGAACTCCTTTTTTGATAAGTTGGGGTCTTATTGCTCAATCATGATTTTCTACC
> TTTTATAGAGCGTTATCAAAATTCTACCTTGAATAGTCTAAAGGACACTACTTCGCTCCC
> CTGCCGTTATAGGACACACTCTCACGCACCGTGGACCTGAAATAAGCGTAACTATCAGGT
> CACAAAAAACACATCCTTACATTCTAGGCAGAAAACAAATAACAGTCACAAAAAATTTGA
> ATAAATAATATTCCTTGTTATGTTATTCCGTGCACTACCACCAACTTTATCGACACAAGC
> CGCATTTGTACCGAGAGTTGTTTAGCTTTTTTCAGTAGTGTTCTCGTTGCGAACTACGCA
> CACGGACGCGGAGTAGTTGCTTCAAGGATGGAGTTATAGTTGACCTACGAGATTCTTCAC
> CACCTTTATGTTTGTTAGGGACGGATGACGGTAGACATACATGCTTTTCATCTTGTTGCG
> ATGTAACTAACCCTTTGTATTTACGTTCGGAGCCCGTTGATTTATGTAAACTATTTGCGT
> AGGTGCACTGGCAACTAATTTCCAGCTGTCCGCCCAGTATTATCAGAATTTACGCGCTAT
> CAAGAACTATACCATGCTAGCTTGAGGTTTCGTTCATTCCCGAAGACGGTCTAATAGTTA
> AGACTTATCAGGAACGTTATTTTTGGTGAGATGCTCCTCCTTAAGAATGCCCGATTAACG
> AGAAATATGGAGCCGTTTTTTTTATTATGCATCTCCATATGTGTCATTTATTCGATTATA
> GGTTTGTACACAGCACAAGAACGTATTGAAATTTAATGGAAGCGCAGTTAACTTATGAGT
> TAGTTTGATAGAGTACTCACAGACCAATATAGAGTGTCCGAACTGTATAAGTGATAAGTT
> GATAACTGCCCAGTATCGTGACAGTTTATTTCGATTCGCTTAATTTATTTGGATAGTAAA
> CTATAACTAATATATTCGTCTTTATTAATTGTATGGGTAAGGCCGTCAGAATCTAATCAG
> AACATTTAGTATAAATCTACTATAAACAGAAATCCTACGGATGTTCTAATTAAACCTATT
> ACGTTCGAGATTTATGCGTTTGTAACTACAAGACTTTTGCGCGGCCTTTATAAATTTCAA
> ACCGTAGAACACTGGCCAAATATTGAGCATAATGCTAGTTGAGTTTGTGGCTCAATCCAG
> TGCAAAATGCATCACACTATGTCATTAAGTTTTCGCCAAGCGGGATTCCGGCCCAAACCC
> GATTACAATTATTTTCATGCTTATTGTATTGCTGGGTTAATTTGATACGTATTTCTACCC
> TGTCACTAAATTTGGTTAACAAATAAGTTTCACCTGGTTAAGCTCCGGAGTATGACACGT
> AGTAATATTAGTTCTGTTTAGACCCTAAAGGCTAAAGATCCGGGTAGTCACGATGAGGCA
> TCACTGGTGATAGATAAACTTTTTTAAAGTTTGGTTAAACGGACATTACATAATTAGACT
> GCGAAGTGCTACGTTATCAAGCATGGGTAATGCATGTTAGACCGAATTTAGATATATATG
> AAAACGACACTATCCTAACGTGTTTGATCTACAGCAGTTAATCCGCTTCCGGCGTAATAA
> AAGAAATTCGAGCTAGTTTGATAACCGTTTATGCCATTATAGAGCACTTAGCTTAACTTC
> ATGGTATGTGAACAAAATAGCATATGTAATTTGGGGAACAGCAGACTTCACAGTGTATCA
> CCTAGGAGTTGTTAATTGTTATTTATCGAAGATAAACATTAAATTCTTATTCAGACATAC
> AGCGATAGCTAAACTTATCAGTAGAACCTCAAAATTTCAAATACTACTCTGGAACGCGTC
> CGTATAGATACAAGTACCTGAATGAACTGGTCATGACAAATTGACTCCTTGTTAATCGGA
> CATTATTCGTTGTACTAAAGTTGGAGAAGGTAGCCTAACATTGGACATTACAGGCCAGTT
> ACCTCTATGAGAGCGATTTACCGCGCCACTAAGTGGGCGAGAATGATCGTTTATGGGACG
> GAACCACATTCCGTTATCCTCTGCACATGGTGGACGCTTCGAAGTACAAATGGCCCAACC
> ACACAAGGGAGGGTGTTAGATTTTATTGCAATGTCCTCTGATAAGAACGTATGACTGCAC
> TTGACAATAAGAATTCAAAGAAGATCGCCTTTCCTTAACATTTTCTATTCCGGGGCTGGT
> TATGGCTTTATTTCTTACAATCTCAATGATGCCCGCCTACTTGACAAACACATTTGTCGT
> AACTTTAGTTTTCTAGCCTTTTCAATTTTAAATTTACCTTTTCTAAGAAAACAGCTAAAA
> TTAATGAATAACCTTCATAGCGACATTTATGTCTTTTAAACGCAGGTGTGAGGGCGGTAC
> TGTTATCACATTAGCGTGCGATGGACAAAAAGGGCCAGCAGTTGCAACCCAGTGAATGGG
> TGACATGTCTTATTTAAGTCAGTTACAATCAACTTCTTTAAAGGAGGACAATACACTGGA
> CCTCAATATTAAGGCCGGAATACGCTGTAAAGGACCATCTGTTCTATGTCAAATAACAGA
> TGTTGGTTACGGCCTAAATTAATATCCGTTTCTGTGTTTTATAGCAATCAAAAGACATAC
> AGTGTTATAGCTCATTTATCTCGGTCGCCTTCATCGAAAAATTGCAAAGGTATCTCTACC
> TGGATTCGTGTTTGAAGGACCCAACCCATGTTTCGACATGCACTGTTTTGATAATGCACA
> GCAGCGAATCTTGTGGATTGAGTGGTAAATCTCCTACGGGTCATTTCCATCAATACGTAC
> TATTAAACAACTTTAATAGTCTATCTACCCTCTTCACGGAGGTATGAGTGCCTTGAACTT
> ACTATATGAAATTCATATTACGCAACGAAAAGGGAAGTAAGGTACAAAGCGCTTCCTAGC
> CGGCTGCAACGAGTGAGTATCTAGAGTCTTGTAAATTTGACTATAGAATTTCTATGATGT
> AAATATCGATTAACCGCAAACCTTTAAAACCTACATGTATGGTCCTTATAACGAACGTAG
> GGATGCCATGTTGGAGAAGGCGAAAATTAACTCGCCGAATCATTCCTTCTATATTTATGT
> TACAGACGCATTCATCGAAGTTAGGATGAATCATATCTTGGTTGAAGAGCGCTTTGAGGC
> ATGTGGCAGAACACATGCTTGTGCCTAAACTTCACTGGATATGAAAATTAACTTCAATGG
> TCTCTTTCGAACCGGATTACGGGCTACTCCGTGGAGGAAATAAAGGCTTTAATTCTTTAG
> CGCGAGCGTTGGAACCACTTGGTTTAAGATACACTTGAATATGGAGGCAGGCCGCACCCA
> CTCGGGCCACTTATTTCTCTATGAGTGTAGCCAGAACTCCCAACAAATGTGCTTTCATTT
> TTCTTGTAGCAAATAGATGTAGCTCAACCGGATCCCGGCCTCATAGCTCAAACAGCTCAG
> TCGAACAAGCAGTTACAAGTCGTGATTGGGAAGTTATATAAAACATATGAGAGTTATTGA
> CGACATAAAGATATATGGTTTAAATTACCAGGTTCGAGTTTTTCGACAAAAAATTCATGA
> TGGAAGACTCGTGTATTTTTTATCTCATTAGACTAAAGTGCTTATGTAGCCCATGCATTG
> ATTCTCTAGTATATTCTTCCGAGAAACCGGTAAAGTTGTAAGGGTAAGTCTTCACTACCA
> ATCACATCATTTAGCTCCAAGACCTATTATTCTACATACAATATAACGTTTTACTTCGTT
> GATCATTACGGTACATCAAATTTCAAACTACTAGGATACGGCGATCAGTTTAGGTAGATA
> ATGGTTCTTAGCGGAATATCTTTAATCAATTAAATGGTTAAAACCATGAAGCGGGTATGT
> ATTGATCACTATTTTGTGATTTAGTATAGTTGACTACTAGATGGTTTACATCGTTTAATG
> CAAGTATGACAACCCAATCCACGCGGTTGAATAAGCCCCCACCGTATCAAGAGGGAAGGG
> ACCGTATAACGATTCTTCCAGCGCAAGTCACCACTGGCAAAACGAATTAGCTGATGAAGC
> TACTATTGTGACCGGATAACATCATGACGATCGCTATCATCATATCTATAATGTTCTTAG
> AGTGTTGCTAATTATATGCTCTTTGGCTGCTGCCATTACACCTGATTCATCTATCTTTTC
> AGGGTTCTTCAAAGTCATGACTTTTTTAATAACCATAGGTGCGGCAGAAGCATATTCATA
> AAAAATAGTCGATTGTAGACGCAAGGGGACTTACCCAGCTATTATTCCTCCAATCCTAAT
> GTTGGGATAATGTAGTTGAAAACCTAAACTATTGAGACTTAGAATATGTAGCCAAAATGC
> TATGTTGATGCAAATTTGTTCTTGGAGGATGGTAAATCCGCGGAGTTTTTGGTCTGTATC
> TGACCACAGAGAATTAACATCAGAAAAGAAGTAACTGATTTGTTCCGGACACCAAAAGGC
> TGTCTTTTCGAGTTGGATATTCGAGCAAGGGGGTTGAACGCAGCGGAAGTTTATGACTTG
> GCCAATTATCAGATTCCGTAGAACAACTATTGGTGTATCATAGAAGTGGTAGCTTAGAGG
> AGGCATGATGAACAACTCTACCGCGAAGTTAACTATGCGGTGTATTAAATTCAGGCCTGA
> ATAACAAGAATTTAGACATATCCACTGTGCTTCTTTCCAAATTAGTTGCCGCCTAGTTTA
> AAATACTGAACAACTGCTTTAAACGTCACAAAGGGTGGGGTACGTAAGAGGGGCGTCAGA
> CAACTGGTATCGGATTATCTGTATATACAATATCCTGAGACTGTTTGAAAACCATAATAA
> CGTGTGGTTCAACAATATCAACTCAAAGTGATGGGACCACTTTCTACGTCCGATCGGCCT
> TCAGGTTGTTCATCCTTATCTATTTTGACTAATAATTATTGAATTGATTTGGAAACGTAT
> CCTATGGATAAAGTTTTATTAAAGCAGATCATATATGCTTCACATTCATTCAAAAGTTCA
> GTGAGATCTTATACGACTTCTATTTTTCTAAATCTTATCGGATACACGCTCTCATAGACG
> ACATGTGAGCTACAATTTGATTTCACAATGATAGACATGATCGCAAGCACTCCCTGTCGT
> CAGACTCTTCCTGTTTATATGATGGAAGATGTACCCAAACATTAATGCGTTAGACCATAG
> CTGCAATGATGTTCCCATACCAAGAATTCGAACATGTTTTACTGAATTGTTTCTTAGGTT
> CTTAATCCGTGCTATGGGATTGCAAGTATGATTTTTAGCACTAGGATAGGAAAGAAGTAA
> CCTGCAAATGATCGAGTTGAGAATGCTATGTTAGAATGTTCTCCGTGTATGTGGCTCGGA
> CCTGACTGGTGTATGGCACTCGAGGAACCCTTAGAGGCGTAAGGTTACTCATTGTTAAAA
> GTCCCATTTAATCTACTTTTAAGAAATTCTTTGAATAGGATGGCACCATCGGCAGACAGG
> AAAAATGTAGGAATGCATTAGATAGATCCGTTCTTTGGGAATTCCGACTAGAAACTTCCA
> ACATGTTTATAACTTGCTGAGATGTGCGTCGTAAATAGCTTTAAAGGAAGTTTGTTTCTT
> GCAGAGGAACAGGACAGAACTTCAAGTCCAGAGAATTATAGCTTACGATTCACTTTCGCA
> TGTGCTACGCCGGCCAACTCTTATCTATCTTTTTTTTAGACAATCAACATTTAAACTTTA
> GTTTGCCTATAGTGAGTGGGTGTAAGATATAGCCTCCAGGAAGACATAACTCCTGGGGAG
> GCAGCATTTGTGTTATTGCGGATGTCCTATATTACTGCCTTGAGAAAGTTCGTTTAGGTA
> CGGTATCCAATAATCGTTTCGGTGATGTTAGAGTAAAATCCTAAGTTCCCAAGATGTCTC
> AATTAAACCCTCTTACTGCTGTGGAATTTATTTGTATGTATCAGAGGCTGAAGAATGGTG
> CAGCAAACTGATTATATAGAGCGCGTTACTGCCTCCAAACTTAAGAGAGAGTTATAATTA
> TAGAGAGTATTAGGGATTGAAAAGTCCTATCACGCTGTCCTGAGTATTCCTATCGATGAT
> GTTGGCGCGAACTCTACTAGCATCTAATATAGCTCATCCTATCTTATTGGCGATTTTGAT
> AAAAGACATGTATATGAATGTGAAATTGATAAAGTAGGAACGAAATCACAATACGCTGCC
> AATACTTTCCGCTATCCTAAAGATCCATGGAGGCAGGTAATGATGCGCGTGCGTACCTCG
> TTAAAGATAGTGTTATGATTGATCTTCTTTCTCTGAAGAAAGGGTATGCTTTCTCACCAA
> GATTGGCGAAATTGATACTCCGAAGATTGAATACTAACACCCTGTCTATTTTCACCGCGT
> CTCATGTGTTTGTAGGGATTCTTCTACGTTGGTTAGGGATCTTGCGTACTTCTGCAAATG
> ATTTGACAATAAGGCCATCTTAAGGATGCTGTCTCGAGAGCGTTACCCTTTAATGAAAGT
> ACTCAACGGTTGCGCTGTGTAGGGTCATCTCTCTCAATGTACGTTTTCCTGTATATTAAT
> CTATTGTTCACATGCTAGCATATAACTCGTAAGCATGTAGGAGTCTGAAGAAGCTGTAAT
> AAGCCTGTAAAGAAATCTTACAAAATGAACTATGGATACTCTTGGGCCCCTCGATTATTT
> CAATAAAACGCGAAAATCCGTCTAATGTTGCGTAGCCTCAAGACAAATTGTGAAGTATCT
> CTAGCTGGAAGATTGTGATTGACAAAATTGCCCTCACTGAATATTTTCTTGTAGTCTTTA
> AAGGTTTACCGGTTTAATCAATGTGAGTTTGAAACAGATAAAGTACTTTCAGCTATACAT
> TGCATATCCTATGCATCAAAAACTAAAGTGCTCGAACCAATATGGCCGATACTCACTCAT
> CTAAGAATCCCATCTGCAAACAGACGACTAGACAATTAACCTGAAGTTGGCGTTATCTAT
> AGTTTAGTTCGGACTAGAGGTCGGTATATTCTATTAAGGAATCTAATCTAGCTGACGTCC
> TGACTCGAGCTCAAATGCGACGGTATACCTACATGTCGAAATACACTGCGGTATCGGGGC
> ATGTATTGGATACGCCTAAAGACGACATAAGCGATTGATTATTATCCGATCACGTTTCTG
> TGCACCGAGCATGGAACTGTATATACAGCTATAATCTTCTTGACCTGAAACCTGTGAAAT
> TATGGTAAAGTACAGCCGATAACAAACTGATTATCTAAGAATCTACATCACCAGGCGTCT
> TAAAGTAAAATTACAAGGCGTTGAATATACGAAAGTTGATGAAGTTCGCTGGGCTCGTCG
> CAAACACACAACTAGATGTCGCAACCTTGATGAGCTACGTTGGCGGTAATAAGTTCACCG
> TAAGTGCATTGAGAAAGACTTGTGTTTCATCGGTTATCATCTGGACTACTCTGGGGTATT
> CAACATGATTACGGAGAAAGCGGATTTATTGGTAAACGATGTCTAGAGGATTACGGGCCT
> TATAATTGGTTATCCATGGGAGTTCTGTCGCTGTCGCTTCGTTAAAGATACGGACTACAT
> GTCCTCGCGTGAGCTCGTGGTTGAGCCTGTTAATGGGATCCCGACAATACTAGTGCCATT
> TGAGGATGTGACTGAAAAAAAATAGGCATCACGACGGATTTGCCCTATTAGAAGAATTTC
> CTATAAGTTCAATACTGTCCATAGCATTGATGCTAGGGGATGAAACTGTATACTAGCCGT
> CATAAGTATGCGGCTTTTGTATAAAAAACTATTCAATCTTTTGAATAGACAAAAGTAACA
> ATCGGTTGTATCATGCTATAAGTCAGCACATTTTACGCCTTGAGAATGTTCAAAGCAATA
> GACGACTCGTTCTCCCGAAGATAGATATCATTATATTTAGTACTATTCCCCGGTGTTACC
> TTGTATTTACTACTAATAGTGAAAGTACGACGTAAACCACTTCGTCCGGTTAATATTTGT
> CCTGAGTACCATCTCGTCCTCACTCCCTGCCTACACGACGGTAATCACTTGAATAATAGA
> TTTACTACCCATGATTCTGCCTCTTTGGTAATCTTATTATAAGACTAATCATCTTTTATA
> CAGCGGTTGAGAATGACCCAATGCTTCCGTGGTGTAGTCTGTATTTCTAATATGTAAGAG
> CGGCAGTCATTCCGAGTTTATACGTGTGCGTGTTAGGCGAGATGAGTCGCTAATAGTATA
> TCTGAGCACGACAGCCGTATTTCACGCATGACGGATGAGAACGTTTAACTAATAACGGTA
> TATTGCGACGTATCAAGAAAATTTACTCAGGACATGTTATGATCTATCGTTTAGCACACG
> CAGAGTGATTTAAGAGTGCTCCAGTCCATAATGACACATGCTCCACAGCGCTCTCCTACG
> TATTGGGCGTCCTGAGCTCTGGTTTACTAAACAAAGACTATTCCGTTGTTGAGTAGTAGA
> AGAAACCCCATCCGAAATTGCGCTAGGAAGGCTCGATATACCAGCCTATAAGTTTTATAT
> CGGTTACGTATAAAGGTCGACCATATAGGTCCGGAGTGGAGTTTTCAATCAGCCGTATTA
> GTTAGTGAATCCAACTTATCGATTCTGAAATTTTCGTTGCTCAACTTATGAAAGAAAGTC
> AGTCCGAAGCCTTAAACACGGAGTACGTGTCATGTATCAAGAGCAGGAATTAACAATAGA
> ACACCTTCAAACTCACAGTACATATTAAATGTTGGGGGCCCTATGAGTCTAATTCTTGGA
> CTCCAACGTTATGAGTGTTCTTCTGCTGTATATCCTCAGAGATTGCGTATTTAGACTTCA
> AAGCAAGATGGGAGGGACTAAGCTAGTGTAACTGGAGACTCATTTGTAAAGTTACTTCCT
> TTGTGTCTTTATCATTATTGTAATTACATAGGCTGGTACGTACCCTTGTGAGTTAGGAAA
> ACACATAGGGAATGATAGTAAAGCTAGTACCGAGTCTTGATCCTTATTACGGGTTAGAGT
> AATCCTTAGTAGACAACTAAAATCTCAACTGCAGTAAATTTAATACGGAAGACACTAGTG
> CTCACTTTCGGGTGTGGGTGCTAGGATCGCCTAGATCAGGGTGCGAATAAGTGTAGGGTC
> GCTATGTATATATTTGAGTCTCATTTCTTTTTGTAAATATCGTCGGGATTTATAGCTACT
> ATACATACGTCTAGTTAGCAAAGTGTTCGTATGCTTTAGCTGAACATATGTCCCCTGGTT
> TAGATAAACCGCACATGCGAACGGATCCGAATTCCCGTAGAGGAATCAAACATAGATTCT
> TAAAAGCAATTATGTCGTGAGGGGGTGTAGAGAAGACTGCTAAGCTTCTGATCTAAAATA
> TAGAGTCCGTAAAGTATGCACCATATGTCTCTCACCCCGTCAAATTGATGACTTCAAGCA
> AATAGTACGTAGGTCAACCAATCTTTCCATTCAATAGTTCAGCAGAATAGAACCAGAAGG
> ACCTTTTTTCTATTTATAACGTCTCGTTTCGAAATACACTGTCACATACTTAGTGGGATG
> CTCTGCCTTCCTAAACTTCATCATGCGTTAGACTCCTATCCATTGGAACATCTCAAACGG
> CTAAAGATTAATGTAGCGTTCAACAGGACACCCTAAGGTAGTATGACGATAATAGATAAG
> CATCACATGTAGGTAGCTTATTTTATCCAGGTATGGCACAATCGGCAATTGCCTAGATAA
> TACAATCTGAAGTAGGAACCCCGATCTATTTCCCACTGAGTAGTGTACTCTCGATGCAAC
> CATAAGAAGGAGGCTGAACATCAACTTTACTTTATCGTTTTATAGAAGTCGAGATGGACT
> GGTTAACGGATCAATTTTCGCGGCTGAAATTCGTTAACGCAACCACAACCGGTAAAACAA
> ATCTATACATGGCGCGCTACCAGTAACTAGTTTTATAGTTACAGTCGTAATATCCGGGCC
> CTTTTTTTCTACGCTGCTTTCCTAGGCCGTAATGATCTCAGTCATAGTGGATTATGTAAA
> GCTACACTTACATATAGTGGACAAATAGTGGCACTATGAGGCATTCTCTGTTTTCACTTA
> CCTAGTTCAAGTTTACTGTTGTCGAAATAGTAGATCAAGTTTTTCGGGGAATGGTAAAAG
> CAACTAGACTACCAACATAAACTAGTATCGATTTACAATGTTTGCACAACTGTGATATCT
> CTACCCCGAACAAGTCTATAATATGTAATCGTTTAAGATGGAAGGATTTACGAGCTTCAG
> GCGATAGACGACCCCAAGATTGGGATTGTTGTCCAAAATTAGAGTGAGTATCTAACAGCT
> ATCTGTAATTCGACTAGTAACCGGGTAATGCAAAGCGATTGTCGATTTTGTACATTGGAG
> ATCGTTAATATGGGACTTAACCTATAGCCCAATCACAAGGCTTATTGTAAAGAGCACGTA
> GTCCGCACTTAATTGTTTTGCACTAAAATAAACCTATTATTCCTTGCTTCGTTTAAATCG
> TCACTTGGAGCATAGTGACGTATAGCCGTTCTGAGCAGTATAGAAGATAGTGCATGCAGG
> TGAGACATTAAATAGCAGATTTTCAAAGGGTTATGTGTTCGAAAACTGAAAATTATATTA
> GACCTACAGTTATGAGACAGACGATAGGGTTAGCACGAGGCGGTTGAATCGCATCCCTTG
> CATGGTTCACTTACGCATAGATTAACTGCAAAAAATCTAATTGAAAGTCTCTAAGGCGGT
> AGAGGAGCATTTTCAAAGTACAGAATATAACTCTGGTAAAAAGTTTGTTCATTATACTTA
> CGTAGATCCTTATTAAAAACCTGTGCAATTACAAATATCAATGAACCTGTTGAACATATG
> TTTTTAATTATGGCTTATAAACAATTGTCTTAATAAGCGAAGTTGCTAGTAAACACGTAC
> GCACTCACCCTTTAATTTTTACTTATATGTTTAAAGATGGGTTTGCTCTAGCGTCTGTAA
> ATCAAATCGTGGTTACGACGGTAGACTCGTGCTTGGGAATTGGATAAGCTATGCAGCTCT
> ATATTTCAAGCTTTAATTTAATACCACGAGGTAGTAGGATAGGTATCTGCTATTGGAAAA
> TGGAGGGATTTATCCGTACAAGGTTCGGCTAAAACTACCACGAGGGTTCGATTTTCATAT
> GGAGTGTTTGTATAAGCCACATTTGTTGTATTTGTCAACATCCTGGGGACTTTATGCTCC
> CCGTAGCTGAGAATTCTTCTAAGTTTGCAGATGAAAGAATTTCTATGGGGTAAGACTCTA
> ACAGTATATAACGAGAGTATGCAAGGACTTATAAAAAACCTGATTTATTCAAGTACTGGC
> ATAACATTCATAGATTATATTTGATTAGTTTAAACGCGTGCCATGAGTGGTGCTGTGGAA
> CGCGAGATACATAAGGGCTAGCTGAATATTGCATTAGGCCTAAAAAGGCAAAACCGGCTA
> ATTATTATTCTAAGAGTTGCACTGACTAGAACCTCTTTGGTTATATATCTAATACTTAGC
> GTAGGATCATAAATCTACTTGGGGAGTGAGTGCGCTCGGTGGTGTCACTATCGTAATACA
> CCCCTTAGTGGCTCTGTACTCGCGATCTCCTGAAAGCCTTGTGTCATTACTTCGCGTATG
> AGTCATAAAGCTTGATGTTATACAGTTGATACTCCGGTATCAAATTTATACCTTGTTTAC
> TAGTAACCAAACGTATTAGATCCCATCCCGTTATAGGACTCAATAGAAACCACAGGCGAC
> CGCATATTAGCGTAACTAGAAGGTCAAAAAAAACAAATCATTAATTTCGAGCCTGAAAAA
> AAATAAAAGGCAAAATTAATTTCAAGTAAGATTATGACTTCTTATGTTTGTACGGGCACT
> TAAAACAACGGTAGCGTCACATGCACCATTGGTACCCACTGTGGTTTACATTGTTTATCT
> ACTGGTCTCGTTCAGAAATAACAACAAGGAACCGGAGTAGGTCAGGAAAGGATGCAGTTA
> TAGTTCACAGTCGACATTATTAAAAACCTTTATGTTTCTTAGGGAAGGATGACGGTTCAC
> TTACATGCTTTGCTTATGGTTCCGATGTTACTTAACATTTCTTTTTAAGGGAGGACCACC
> TTCTTTTATCGAATCTAGTGGAGTAGGTGCAATGGAAAATAATTGAATCCTCTCCGCAAA
> CTATTATCACATTTTACGAGAGAGCAAGTTCTTTACAATGCGAGCTTGAGCTTTCGTGAA
> TTACAGTACTCGGTCTAATAGTGTTGTAGTTTAAGGTACGTTATTGTGCGGGTGATGCTC
> CTAAGTAAGAATGCACGATGATCGTGTTATAGCGAGCAGTTTTTTTTATTATGCATCTAC
> TTATCTGTAATTTTGTCGATTTTACGTTTCTTCAAAGCAAATGATCGTTTGCAAATTTAA
> TGGAACAGCAGTGAAATTATGAGGGTGGTTCATTGAGTAATAAAACAACATTTGAGACTC
> TCCCAACTGTATTACTGAGATGTGGAGTACTGCCAAGTTTCGTCAAACTTTTGGGCGATT
> CGAGGTATGTTGTGGGTTTCTAATCGTGTAATAATATATTCCTCTTTATGATTTGGAGCC
> CTATCGCCCTCAGAAGCTAATATCATCTTTTAGTTTAAATATAATATAAACTCAATTCCT
> ACGCTTGTTCTTAGTAAACCTTTTACGTTACAGATTGATGCGTGTGTATCGACAAGTCTG
> GTGCCACCAAGTTTTAAAGTTATAACAGTAGATAAATGGCAAAATATTCAGCTTAAGGCT
> AGTGCTCTTGGTCCCTAAATACTGGCCAAAAGCCAGCTAAAGTTCTCATGAAGTTTGACA
> CTACCGGCATTACGGCCCTTAAACCAGGACAATGATTTGATTGCGTTTTCTAGTGCGCCG
> TGATTTTGAGACGTATTTAGAACATGTCAATAAATGTCGTGAACAAAGTACGTTCACCTG
> GTTATGCTCCCGACTATCAATAGTTCGATTATGTGTGCGGTTGTCAACATTTAGCCTTAA
> CATACGCGTAGTCACCATCAGGCATATCTGCTCATAGATTAAATTTTTGAATCTTTGCGT
> TTTCGGACATTTAAGATTGAGAATCCGAAGTCCTAAGTTTGCAAGAATCGCTAAGGCTTC
> TTTGTCACATTGTACATATATAGCAAAACGACACTATCATATAGTGTTGCATCGACAGCA
> GTTATTACGATGCACCCGTTAGTATAGTAATTAGACCTACTTTGATAACCGTTTAGGCCA
> TTTTAGAGCACTTAGCTTAACTTCTGGGGATCTGTACTAAATTGAATATGTTTTTGGCCG
> AACTGCTGACTTCACTGTCGATAACATACGAGGGCGTTATTCTTATTGTTCCATCATAAA
> CATGAATGGCGGATTCACACAGAAACCCTTTGCTAAAATTTTCTGGAGTACCTAAATAGT
> TCAAAGACTACTAGGGAAAGACTACGTTGAGAGACATGTAACTCATTGTAATCGTCTTGT
> AAAATGGAATCCTTCTTTTGCCCACATTTTTACTTCTAATAAAGTTCGAGTACCTAGCCG
> AAAATTCGTCATTACAGGCAAGTGACCTCTATGTGTGAGATTGTACGACCATCTAACTCG
> CCGAGATTCATAGTTGATCGCACCGTACAAAAGGCCCGTATACTATCCACTTCGTCGACG
> CGTACAACTTCAAATCGACATTACAATCAAGGGTGGGGGTTACTGTGTATTGCATTGGAA
> TCTGATTTCATCCTATGTCGGCAATTGACAAGAAGAATGAAATCAAGATACCCGTGACTG
> ATAAGTTTCTATTCCGCGCATCCTTTTGCCTTTTTTTCTTACTTGCGCAATCATGACCGC
> ATTATTCACAAAATCATTTCTCGTTACTTTACTTTTCTAGAAGTTTCAATTTTAAATTTA
> CCGTTTCTATCATAACAGCGAAAAGTAATCTATTACCTTCATAGCGAAATTTTTGTATTT
> GAAAAGCAGGGGTCACCGCCCTACTCGGATCAAATGAGAGTGCGATCGTCAAAAAGCCCC
> ACAAGTTGAAAACCAGGGTATGCCGGTAATGTCTTATGTAAGGAAGGTAATATCATATTA
> TTTAAAGCAGCTAAATACAATGCAACTATAGTGTATGCCCCGAATTCGATGTATACCACC
> ATCTCGTATATGTATAATAACTCATGTGCCTTTCGGCCTAAAGTAATTTACGTTTCTCTG
> TGTTTTTCCATGAAATACACATTCACTGTTTTAGATCTTTTAGAGAGGTACAATTCTTAG
> ATTAATGCAAAAGCGAGCTCTACCTGGAGTCCTCTGTGAAGGTCCCAAAACATCGGTCCA
> CAGGATCTCGGTTGATAATCCAAAGAAGACAATCTTCTGGATTCACGGCGATATATACGA
> CCGGTATTGTAAAGCAAGTAGTTCGTTTAAACAACTTTTATACTCTTGCTAACCGATGCA
> CGCAGGTAGGACTCACTGCAACTTAATTTTTGAAAGTCATATTAAGATACCAAAACGGAA
> GTAAGCGTAATAGCCCTTCCGAGCACGAGGAATACACGGTCTTGAGACAGTATTGTTAAT
> TTGACTTTACAATTTCGATGATCTTAATATCCAGTTAACCCAATCATTTTAATACTACAT
> GTATGGGCATTATAACGATACGTGCCAGGACATGTTGGAGAACCAGATATTTTACTCGAA
> GATGCATGACTTATATATTTATGTTAATGTAGAATTAATACATGTGAGCATCAATCTTAG
> AGTGCGTCTACAGAGCTTGGAGGAAGGTGGCAGAAAAAAGGCTGGGCCCGAAACTTCTAT
> GCAGATCAAAATGAACTTCAATGGGAGATTGAGTAACCGATTAAGGCATAAGCAGGGCTG
> GAAATATTGGCGTGTATTATTGTGCGACAGAGTGGGAAACTCTTCGGTTAAGATTCAATT
> CAATATCGTCCCACCACGAAAAAACTAGGGAAACTTATTTATATATCAGTCTTGACTCAA
> CTAAAAACAATTCTGAGTGCTTTTTGCTTGTTGAATATACATGGACCGCTACAGGATAAA
> CGAATCTTAGCTAATAAACATAACTCCTACAAGATGGTTCAAGTCCTCATGCGGTAGGTA
> GATAATAAATTTCAGAGGTAGTCTCGACATAAAGTGATTTGCGGGTAATTAAAAGGTTCC
> AGGTTTGACACAATAAATTAAGGATGCAACTATCGTGTTTTTTGTATCTAATTAGACTAA
> AGGCCTTATCTAGAAAATGCATGGTTTATCTAGTTTATTCTTAAGACAATCCGGTAATGG
> GGGATCGCGAAGTCTTATAGACAAATCTAATCAGTGTGAGCCTTGTAATATTATTATAAA
> TTAAATAGTTAGTTTTTATTCCTTGAGCAGTAACCTAAATAAAATTTAAAACTACGACGA
> TACCCCGAGCTGTTTAGGGTCATTATGCTGCTTACCGGTATTTCTTGAAGAAATGTTATC
> GGTAAATAAAGGTACCGCGTATGGTGTCTTCACGATGTTCTGATGTAGTTTAGTTGAAGT
> CTACTTGGTTTAAATACTTTTAGGAAACGATCTCAACCCTATAATCCCCGGGCAATATCC
> CCACAAAGTAGCTACAGGGAAGCGACCGGATAAAGATTCTGAATCACCATCGAACAAAGC
> CCAAAAAGAATTAGATCATGAACAGACTATTGTGACAGGAGTACTGCAGCACGATCGCGA
> TCAGAATAGCTAGTTGGGGATTAGTGTCTTGCTAATGTTTGGATCTGTGGATGATCCATT
> TTCAAATGAGTCTTCTATCTTTTCACCGTTATTCAAAGTCTTGAAGTTTTTATTTACAAT
> AGGTCACCAAGATCAATATTAATAAAAATTAGGAGATTGGAGACGCAACCGGACTTAAAC
> ACCGATTATTCATCCAATCCTAATCTGCCGATATTGTAGTGGAATACCGAATCTAGTGAG
> AATTAGAATAGGTAGCCAAATTGCTATCTTGATCCAATGTTGTTATGCCACGATCGTATA
> TAACCGCTGTTTTTCCTCTGTATAGGACCACAGTGTATTAACTTCTGAAAAGAAGGAACT
> CATGGGTTACCGACAAATAATGGCTCTAGGTTCGACTTCCATTTTAGAGAATGCGCCGGG
> AAACCAGCGGTTGTTTTTGAATTGGCAAATTATCAGATGAACTAGAAAAAATTTTCGTCT
> AGAATACTAGGGGTTGCTTTCACGTGCCATGATCAACAACTCGAACGCGAACTTAAATAG
> GAGCGGTATGAAATTCACGACTGAAGATCTACTATGGAGACAGATCCACTGTCCTTCGTT
> ACATATTAGTTGAAGCATACTGTAAAATAATGAACATCTCAGTTAAACCGAACAAAGCCT
> GCCCTTAGTAAGACGGCCCTCTGAAATCGGGTATCCGATGTGCGGTATTTAATTTAGCAG
> GTGAATGTTTCTATTCAATAATAACCGGGCCGTCAACTTGATATACTCAAAGTGATCGGA
> ACAAGTTCTTACTACGATCCCCATGCACGTTGTTAATCCGTAGATAGTTGGAATAAGAAT
> TTTTGATGTGATTGGGAAACGGATCCGAGGCTTAAAGGGTTATTTTAGAAGTTAATATAT
> CAGTCAAATTATTGAAAAACTTCACTCTGAGCTGATACGAATGCGAGTGTTATTAATCTT
> ATCGGTTAATAGATCTCAGTCACGAAATGGGACCGACTAGTTCAGTTAAAAAGGATACAA
> TTGAGAGAATGCACGCCAGCTACTCAGTATATGCATCTTTTTAGGATGCTAGATCTAACA
> AAACATTTATGAGTTTCACCTTAGCTCCTATGATCGGCCCATACCTAGAATTAGAAAATG
> TTTGACGGTTTTGTGTATTAGGTTCTGAATAACTGCTATGCGAGTGCTACTTTGATTTTT
> ACCACTAGGAGACGTAAGAACTAAACTGCATAGCATCCAGTTCACATTGATATGGGAGAT
> TCGTATCCGTGGAGGGCGCTCGCAAATGTCTCGTCTATCCCAATCGACGATAACTTAGAG
> CCCTAACCTTTCTCATTCTGTTAACGACCTTTGAATATACTGGTAAGTAAGGATTGGTAG
> TGCAGCGAAAAAGCGGCACAAAGCAAAAATGTTCCAAGGCATGTGTGAGATCCCTTATGT
> CCCAATGCACACGTGATACTTAAATAATCTGTATAACTTGATCTGATGTCCGTCGTAAAT
> TGCGTTATACGATGTGTCTTGATGGAACACCAACAGGACACTACGGCAACTACAGTGATG
> TATTCCTGACCAGTCAATGTACCAGGTCATTACACGGCAAAATCTTTTCGAGCGTTTTGT
> TTGACATTAAAATTGGTTACGTGAGTTTGCCTAGAGGGAGTCCGTGTTTCTTAGAGACGC
> CACCATGTCATATCTCCTGGCCACCCACCATTTGTGTTTGTCCCGATGTCATATATTTCT
> CCATTGTGAAAGGGCCGTTAGGTTAGGTATCAAATAATAGGTGCCCTGAGGTTAGACGAA
> AATACTATCGGCAAATGATCGAGCATTGAAAAACTCTGTCTCCTGTGCTATTTATTGGGA
> TCTATAAGTGGCTGTACAATGGTCATCCAAAAGGTTTATAGAGAGCGACTTACTGACTAC
> AAACTTATCTCAGAGTGTTTTGTAGAGTCAGTAGTACGCAGGCTAAAGTAATTGCACGCT
> CGAATCAGTATTCATATAGATGATGGTCCAGAGTTCTCTACTAGCATATATTATAGCTCA
> TACTATCTTTTTGCCGATTTTGATTAAAGAAATCTATATGAAGCTCAAAGGCATTAAGTA
> GCTTCGTTAGCAAATTACGCGGCCAATACTGTCACATATCAGAAACATACATGGACCATC
> GTTATCTTCCCCCTGACTACATAGTTAAAGATACTGGTATCATTCAGCTTATTTCTATCA
> TGAATGGCTATCATTTCTAACCAAGTTTGGCGAAATGGTTACGAAGAACAGGCAATAATT
> TCACCCTGTATATTGTAACAGCGTATCTTCTCTGGGTACGCTTTCTGCGAAGTGGGTTAC
> GGTTCTTCAGTACTGATCCATTTGAGTTCACATTATCGCAATCTTAAGCTTGATGTCGAG
> TGAGCCGTACAATTTAATGAAAGTAATCAAAGGTTGCGCTGTGGTCGGTATTCTCTATCA
> ATGTTCGGTGGCCTGTTTTTTAAGCTATTCGGCTCATGCGACCTTATATCGAGTTACCTG
> CTACCACTCGGAAGTAGCGCTTATAAGACTGTAATGATTGCTTAATTAATGAAAGAGCGA
> TTCTCGGGCCACAATCCATGTTGTCATTATAACCAGAAATGCCGTAGAATCGTCCCGACC
> CTATAGACTAATTGGGATGTATCGCGAGCTCCAAGTTGCGCATTGACAAAATTCAAATAA
> AGCTATAGGGTCTTGTTGTCTTTAATGGTTGTAACCGTTTATAATTCGCACTGTGAAACA
> GATTTAGTACTGGCACCTTTACATGGCAGATACTATGATTAATATACTAAAGTCAGACAT
> CCAATAGGCAAGATAATATCGAATATAAGAATAACTGCTGAATACAGAACTATAGTATAT
> TAACCTGAAGTTCGAGTTTTAGAGTCTTTTGTTCCGACTAGACGTCCGTTGATGCTTGTA
> AGGTAGATAATATTGCTCTCGTCATGTCTACTGATCTTAGCACACGGTATAACTACAGCT
> CCAAATACACTGAGGTATAGCGCAATGGATGGGATACGACGAATCAAGACTGAAGAGAGG
> CTTGATTATAAGTTAACCTTTCTGGCAAACCACATTCCAACTGGATATACAGCGATTATC
> GTCTGGTCATGTTAAATCTGAAATTATCGTTAACTAAACCAGTGTACAAAATGATGATAT
> AACTTTAGTCAGCTCCACCAGTCTGAAACTAAAAGGTAATGGACTTGAATATACGATAGT
> TCTTGAAGTTCCCGCGCCTCGTCGAATACAAACAACGAGATCGCCAAAACTTGTTGACAT
> ACGTTGCCGGTTTTATCTGCAACGTATCTCCTGGCACAATGAATTCGCTTGCATCGCTGA
> TAAGCTCGACTACTCTCCGGTATTAATCATGTTTACCGTGAAACCGCATTGAGTCCGAAA
> AGATCTAGTCTGGATTACCCGCATTATTATTGCTTATACTTCGGAGTGCTGTACATGTCG
> CGTCGTTTATGATACGGACGACAGGTACGCGAGGGAGCTCCTCGTTGACAATCTTTTGGG
> CATCAAGACAAGACGTCGGCAATTGGAGGATCTCAATCATATATAATACCCATCACGTAG
> CAGTTCAACTATTACAAGAATTTCATTTATCGTCTATTATCTCATTACATGTGAGGATTG
> GCCTTCAATCTGGTTAATTCCCCTAATAAGTAGGCGCATTTTGTATTTAAAAATATTCAA
> TCTTTTCATTTGTCAATACTTACAAGAGCTTGTTTCATGATATAAGTCTGAACATTTGTC
> GCCGTCACAATCTGCATAGCATTAGAACTATACTTCGACCGAAGATTCAGTGCATTATAG
> GTACTACTAGTAACCGCTCTTACCTTGTTTTGTCGACTAATTGGCTTACTAAGACCGAAA
> AATCTGCGTCCGGTTAAGAGTTCTAATGTCTACCTTATACTACTCTATCACTGACTAAAA
> GACCCTTATCAATTCAATTATACATTTAATACAAATCATTATGCATCTTTGCTAATATTA
> GTATAAGAATAATCATATTTGTTACACACCTGGTCAATCACCCAATGCTTCCCTGGTGGA
> GGCGCGATGTCTAAGATGTATGACCCCCTCTCTTGCACAGGTTTTACGGGGGCGTGGTTC
> CCCAGAGGTCTAGCTAATAGTAGATAGGACCAAGTCACCAGTATTTAACGAAGGAAGGAG
> CACAACCTTTAAATATGAACGGTTTAGTGCGAAGTATCAACAATATGTACTATCGAATTG
> GGTTGTGCTATCGTTTTGCACACCCACAGTGATTTAAGAGTCATCATGTCAAGAAGCAAT
> AATGATACACAGAGATCTCCTTCGTAGTGCCCGGCAGCAGATCTGCTTTTAGAAAAAAAG
> AATATTCACTTGGTCAGTACTACAACAAACCCAATCACAAATTCACCGAGGATCCCTACA
> TATTCCAGCCTATTAGGTTTTGAGACGTGAACTTGAAACCTCGAAAAGTTAGGTCCGCAG
> TGCTGTGTTAATTCAGCACTATGAGGTAGGCATTCCATATGAGCCATTATCAATTTTTCG
> TTGATCAACGTATCTTTCAAAGGCACTAAGTTCCCTGAATATCCGAGGAAGTGTAAGCTT
> GCTTGAGCTCGATTGATCATTACAAATACTTAATACTCAAAGGACATATGATTTCGTGGC
> CGAACTATCAGGCGTATTCTGCGACGCAAACGGGTGCTGTGGTCGGCTCATCTAGTTACT
> CTCACATTCCGTTGGTTCAATTCTATGCAACATGCGTCGGAATAAGCTAGGCGATCTGGT
> CTATCATTTGTAAACGTACGTCCTTGGGGGCTGTTTCATTATTCTTAGTAAATTCCAGGG
> TACCGAAACGGGGGACTGACCTTATATAAGACGGAAGGATACTAAAGAGACGTAAGAGTC
> TGGTGACTTTTTTCGGGGTAGAGTAAGCATTTGTAGAAAACTAATTGATCATCTGAAGTA
> AATGTATGTCCGAACTAACTACTGAGCTCTGGCGCGTCTCGCGCAGAGCATCCCATTGAT
> AAGCGGCCGAATTAGTGGTGCCTCGCTATGTTTATTTTTGACTAGCATGTCTGTTTCTTA
> ATTGCGTCCCCTTGTAGAGCGACTTTTAATACCTAGAGTGACATAAGTGTGCGGTGGCTG
> TTGATGAAAATATGGAAACTCGTGTACAGATACACCACTTGAGAAACGAGCCGAATTCAC
> CTACACCTTGCAATAAGTGAGTCTTAAAAGAAATTTTGGAGGGTGGCGGTCTTCAGATGA
> AGCATAACATTCGGATCTAATATAGTGACTAAGGTAACTAGCCAACTTATCGCTCGAACC
> AACTAATATTGAGGACTTAAACCAAAGAGGAACTAGCTCAACAAAGCTGTAAATTATATA
> GTTAACCAGTAGAGAACCACAACGACCTTTTGGCGAGTTTTAAAGGAGCGTGTCCTATTA
> CAATGTAAAATACTTAGGGGCTGCATAGCACGTCAGATAAGGCATCTTGAGTTAGAATCA
> GAGAATTGGCTAAATCTCAAAACGATAAACATTAATGTTCCGTTAATCAGCACTAACTAA
> GGTAGGATCACCAGAAGACATAAGCATCACATCGAGCGACCTTATGGTATACAGGTATCG
> ATAATTCCCAATTTGCCTTGAGAATAAATTAGCAAGTTGCAAACCCGATCTTGGGACCTC
> TGAGTTGTGTTCTATCGAGGATAACTTAACTAGCTCGCTGAACAGATACTTTAAGTTATC
> CTTGTATACAACTACACATGGAAGCCGTTAACCTTAAATTGGAGCCGCTCTAATGACGTA
> ACGCTTCATAAACCGGTAAAACAAATCGTGAAAGGGCGACAGACCAGTATATACTTTTAT
> AGTTAAACTACTATTATAAGGGAACTTTGGTTCGAAGCTGCTTTCCGAGGCCCTTATGAT
> ATAACTCATACGGCTTTATCTAAACCTACACTTACAGTGACTGGAAAAATTGGCGATCGA
> TCTCGCAGGATCGCTGGGCACTTACCTTGGTCAACTTTACTGGTCTACAATTACGACATA
> AAGTTTGGACGGCAATCGGAAAACAATCTACACTTACAACATAAACTAGTATACATTTAC
> TATGGGTCAACAAATCTGTTATCGATTCCACGAACAACGATATAATATGGAAGACTTTAA
> GAGGGTTGGATTTACGACCTTATGGCCATTCACCTCCCAAAGATTCCCATTCGGCTAAAA
> AAGTACACTGAGGTTCTATCTCCTATCTCTAAGTCGAATAGTAAAAGGGTAATCAATAGA
> CATTCTACATTTGGTTCATTGGAGATCGTTATTATCCGTCGGTAACGATAGCACATTCTC
> AAGCATGATTCGTAACACATCGGAGTCACCTATGAAGGGTTTGCCTAGAAAATAAACCTA
> TTTTTCCTTGCGTCGTGTAATTAGTATAGGGCAGATGACTGAAGGATACACCGGATCAGC
> TGTATACTTCTTACTCCTTCCAGGGCAGTCTTTTTAGACCACTTGTTCTAAGCGTGTGGT
> CTGACTAAACGGTTTAGGATATTTCTCATACACTGATCACACTGACGATTCGCTGTGAAC
> GACGAGGGTGAATAGAATAAATTCAATGCTTCTCTGACCCATAGATGAACTGAAAAATAG
> AGAAGGGAATGTATCTTTCGCGGTAGTCGAGCTGGTTCAAACTTAACTAGAGAAATCTGG
> TAATAAGTGTCTTAATTATAATTTAGTAGAGCCTTATTTTAAACAGCTGCATTGACAAAT
> ATAAATGAAACGGTTGATAATTTGTGTTTAATTTTGGAGTAGAATCAATTCGCGTAATAA
> CAGAACGGGCGACTTTAAAAGTACGAAATAACCATTTAATTGGGACTTTTAGCTGGAAAG
> TTGGGTTTCATAGAGCCTCTGTAATTATTATACTGGTTTACAAGCTTGAATACTGCTTGC
> GAATGCGATTAGCTAGGCACCTATATATTGATAGCTTGAAGGTATTACCACGTGGGAGTT
> GCATACGTAGCTCCTATTGCTAAATGCTGGGTTTGTGCAGTACTACGTTCCGAGTTTACG
> AACTCCAGCGGTCCATTGTCATTGGGTGTGTTTGTATAAGCAACTTTGGTTCTATTTGGC
> TACATACGGGGGTCTGGTTCCTCCACGTACAGCTGATGTCTTCTAAGTTTCCAGAGGAAT
> GAAGTGCGATGGCGTAACTAGATTACTGTATATATCCAGAGTTTCCTACGTCGTATATAA
> TACCTCATTGATTCTTGTAATCCCATTACATTCATTCAGGTGATGTCTTTAGTGTTTAAG
> ACTGCCATGTGTCCTGCTGTCCAACGAGACATAAAGTAGCGCTAGCGGATTATTGAAGTA
> CCCATAATATCGAAATTCAGGATAAGTATTATTCTAAGACTGCATATCACTTGAACCTCG
> TGGGTGAGATATCTTATACTTACACTAGCTGAATAAATCTACTGGGGGACGCACTGCCCT
> CCCTGGGCTCACTATCGTATTAAACAACTGTGTCCCTAGCTAATACACATCGACTCTAAG
> AAGTGTGTCTTTTCTTCGCCGAGGAGTCATAATGCTGGATGTTAGACAGGTGATACTCAC
> GGATCAAATGGAGTAATGGTTGACTAGTATCCAAACGTAGGAGATCAAAGCCACTTTTAC
> CTCTAAAGAGAAACAAAACGCGACAGCTTAGTTGACTTTCGAGAACCGAAAAAAAATAAA
> TGAATGAATTTCGACCATCTTTTATAAGATATCGAAAAATTAATGGCATGTTAGTTGTGG
> AATTCGTTTCTGTGTAACGGAAATTAAAAATAAGGTAGCCTAAAATCAACCATGGGTTCA
> CACTGTGCTGTTCATGGTTTATCTACTCGTATAGGGCACAAATAACAAAAACGAACACCA
> CGACGTCAGGATACCTTCCTCGTTTACTGCACAGTCCACTTGATTATAATCATGGAGCGT
> TCGGAGCCTACCATCAACCTTCTATTAATTCCTTGGATGAGGCTGCACAGCGTAATTAAA
> ATTTCGTTGTTACGGACCACAAACTTCTTGTATCGAATATTGTGGACGAGCTCAAATCCA
> TAAGTAGGGAATCCGCTAAGAAAACGATTTTAACTTGGTTACACAGAGCTTGTTAGTTAC
> AATGAGACCTGCACCTTGACTGAATTAAACTACTCCCGATTATTCTGTTCTAGTTGAAGG
> TTACTTATTGGGCCGGTCAGCCGAATAAGTAAGAATCAACCATGATCCTGTTAGTGCCAC
> AACGTGTTTTTAGTAGCCTGAGACTTATCTCTAAGGTTGTACAGTTTACGTGGCTTCAAA
> CAAATTCATACGTTGCTATTTGTAGCCAACACATCGGAAATTTGCACGGTCGTGCAGTCT
> CGTAGAAAACTAATTTTGACTCGCTAACTAAGCTATTACTGTGATCTGCAGTACTGCAAA
> GTTGACTCAATCTTTTGGGACTGTACAGGTTTGGTGTGCCTGTCGAATAGTGTAAGTATT
> GAGTACTATGTAGGTTGTGGAGCCCGTTCCCCCTAAGTAGATATTATCATATGTGACGTG
> TATGATAAGATTTTATCATTGCAGAAGCTGCTGAGTAGTAATAATTGTAACTTACACTTT
> GTGCACTGTCGTTAGACAAGTATGGTCACACCAAGTTTGATAGGTATTAAACTACATAAA
> TCCAAATTTTGTCTGCTGTAGCATTCTGCTCTGGGGCCATATATAATGGCCATATGCCTG
> CTAAAGTTCGAAGGTTCGTTGACACTTCCCCCATTAAGCAAATTAAACCTGGTATATGAT
> GTGATGGCGGTTTCGTGTCCGCCCTGATGTTGTGTACTAGGTAGAAAATCTAAAGTTATG
> GCCGGAAATAAGTTCGGTCTCATCCTTATCCTAACCACTTTCTATACTTCGATGAGGTGG
> GCGCTGGTCAACAGTTACCATTATCATACCCGGAGTCACCATCACCAATATCTGCGCATT
> GTTTTAAGGTTTGATTCGTGCCGGTTTCGCTATTTTAAGATGGTGAAGCACTAGGCATAA
> GTGTGAAACAAGCCCTTAGGATTCTGTGTAACTTTGTTCTTTTATAGCAAAACCAATAGA
> TAAGTTAGGCTTGCTGCGTCACATCTGTTGAACATGAACCACTTAGTTTTCTAAGTACAC
> ATACGTTCTTATAACGTTTGGAAATTTGTCACATATTACCGTTTATGCTGCCGAGCTGTT
> ATAAAGTCAAGTGGGTTGTGCCCGAACTGCTCTCTTAAATCTCGTTAAAATTCCTCGGCG
> TTATGCGTAGTGTGCCATCTGTTACATGAATGGAGGATGAACAAAGAATCACTTTGATAA
> TAGTTGATCGTCTAACTATTTAGGGAATTGACGAATAGCCAAACACGAACGTGTCTGAAA
> TCTAACGCATTGTAATCCTATTGTAATAGGCAAGACGTCTGTTGCCCAATTGTGTACTGC
> TTATTAAGTTCCACTTCCGACCCGATAAGTCCTATTTAAACCAAACTGTAATCTTTCTCT
> GAGATTGTACCACCATATTTCTCCCAGACATGCTTACGTGTGCGCTACGTAAATAAGGAC
> CGGTTACTAGCAAATGCCGCCAACAGTACATCGTCATATCCACATTAAAATAAACGCTCC
> GGCGTACTGTGGATGCAATTCGAATCTCTGTTCATACTTGCTAGCAAATTCTATTGTTCT
> TGGAAATCATGATACAAGTGAATGATAAGGGGCTTGTAAGCCCATCCGGTGCCATTTTTT
> TATTAATTGAGAAATCTGCACCCAATTAGTCAAATTATATTTGCGAGTTAATTTACTTTG
> ATTCAAGTGTCAAGGTGATATTGACAGTTTATATCTTATATCAGTTTTGTTATCTTGTAC
> ATTATGTCACAAAGTGTGCGATTTGAAAACAACGGCTCTCCCACCGAATCGGATATAATG
> AGACTGACATCCTCTTAAACCCAATCAACGGCAAAAAAACGCTATCCCGCTATGGTAGTA
> TGTAAGGAACGGTATAGATTATGATTGTAACCAGCTATAGTAAATGCAACGATTGTGGAT
> GCCACCTAGTAGAGCTATACCAACTTATCGTATATCTATATGAAATCAGCGGCCGTTACC
> CCTAAAGGTATTGACGTTGCGCGCTGTTTTTCATTGAAATACTCTGTAACGCTTTTTCAT
> CTGGGAGAGACCGACAAGTATTACATTATGGCAATACCGAGATATTACGCGAGTACGCTG
> GGAACCTACATAAAATTCGGTCCAATGGATATCGGGTCATAATCATAACATCACTATAGG
> CGCGTTTCTCGGCGTTTGATAAGTACCCTATTGTAAAGCATGTACGTCGTTGAAAATAAT
> GTTAGTCTCTTGATAAAAGATGCACCCTCCGAGCACGCAATGCTTCTTAAGTTTTCAATG
> GATTTGTAACATAACTAATCCCTTCTAACCGTATTACACATTCAGTGCACCAGCATTACA
> CGGTCTTGAGACTCTATTGGTTAGTGCACTTTACTTTGTAGATGAGCGTTTTAGACAGTT
> TAACATATCATTTTTATAAGTATTCGATCCGAATTTGTACCATACGTGCCTGGAAAGCTT
> GGACAACCAGATTTGTTAAGCCAAGATGCATGAATGAGAGAGTGATCTTAATGTACATGG
> AATACTTCGGACCTTCAATATGAGAGGCCGGCTTCACACAGGGCACCAAGCGCCATGATA
> AATGCATGGGCCAGATAATTATATCCAGAGCTATATGAACTTATAGGCGAGATTGACTAA
> ACCTTTTACCCAGAAGAACGCCTGCATTTATTCCAGTGTTTTAGTGTCACACTCACTGGC
> TAAATCTTCGGTTAACAGTAAAGGCTATTGCCTCCCTCCAACATAAATATAGCCAAACGT
> ATTTATATTTCAGTCGTGAATCTTCGAAAAAAAATTCGCAGGGATGGGGGCGGCTTCATT
> TTACAGCGACAGATTAAGGATAAACCAATATGTCAGAATAAACATATCGCCTAATTCATG
> GGTCTTGTACGCTGGCCCTTCGTAGTGTATAAATTTCACTCGTTGTCTACAAAGTTTGTG
> ATTTCCGGGTATTGTAAAGCGTACACGGTTGACAATATTTTTTAAGCAGCCTACTATCCT
> GTTGTTTGTATATATTGACAATATAGGCAGTAGCTTGAAAAGGATTGGTTTAGATACGTT
> ATTAGTAACACAATAAGCTAATGGGCGATCGCGTTGGATGATAGAAAAATATAAGAAGTG
> TCAGACTTCTAATTTGATTATAAATTAAAGAGTTACTGTGTATGCCTGCTGAAGTTACCT
> TATTAAAAGTTAAAAATTAGACCATAACCACTGATGTTGAGCGTCAGTATCCTGCTGTCC
> GCTATTTATGGAAGATAGGTTATCGGGAAATAAAGCTACAGCCTTGCGTGGCTTAACGAT
> GGTCGCATGTTGTTTACTTCTAGTCTTCTTCGGGGAATGACTTGTAGCATACGTTCTATA
> CAATAGAATACCCGGGCTATATCAAAAATAACGTGATTCTGCCATCCCAAACGATAAACA
> TTATGAATCACATTCGAAAATAGCCATTTTAGAATGTCATCAGCTTCAGTATAGTCTCAA
> ACCAGTAATGAAGCTACTTACAGTTCAGAAGAGAGAGTTGCGGAGGTGTGGCGGCATAAG
> GTTTGCATAGGGGCATGAGCAATTGTAAAAGGAGTATGAGAGATTGGATCCCTTATTCAT
> TGTCTGCAAGGTTGTATTTAAATGACCTCACCAACATCAATATTAATAATAATTACGACT
> GTCGACAACAATCCCCTCGGAAAAACCGAGTATTAATAATAGCCGATTCGGCCCATTTTC
> GACGGCAATTAAGAATAGAGTCTGTAGTTGAAGAGCTTCCAATATTCATAGCGGCAGCAA
> ATGTTCGTATGCCACGAGCCTATAGAACAGCTCTTGTTCCTATGGATAGCAAAAATGTGT
> AGGTAATTATCATTACATCGAAATCTTGGCTTAACGTATAATTTTCCATCTAGGGTACTC
> GTCCAGTTTACACAATGCGCCGGCATACAACACCTTGTTTTTGTAGTCGAAAATGATATG
> ATGAACTTCTTATAATTTGCCTCTAGATTACTACGCCTTCCGGTCACCTCCCAGCAGCAT
> AAACTAGTAACAGAACTTAAATTGCAGCGCTTTGAAATTATCCAAGGAAGATATACTTTG
> GAGAAAGATAAAATCTCCTTAGTGACTTATGTCGTGAACAAGTCGGTTATTTTATCAAAA
> TATCAGTTTATCCGATAATTCCCGCCCCTTACTAAGACGGCACTATCTAATAGCCTATAC
> CAGGTGAGCGTTTTAATTGAGCAGCTCAAGGGGTCTTTTAAATATTATACGCGCCGGCAA
> CTTGTTATAAGCTTTGTCTGCCGAAATAGTTATTACTAAGTTCCCCAGGCTCCTGCGTAT
> GAAGGTGAGTGGTGCAAGAAGTTTTTTTCTTGTGTTGGCCAAACCGATAAGAGCCTTATT
> CGGGGATTTTAGAACTGAAGATTTCAGTAAATGTATTGAAATACTTCACTCTCAGATGTG
> TCCTAGGCGAGTGTTAGTAAGATGAGACGTTAATACAGAGAAGTCTAGTAATGGCACAGA
> ATTGTGCAGTGATATTGCAGTCAATTCTGAGAATCAAAGAAAGCTACTAAGTAGAGGAAT
> CGGGTTAGGTGCCTACTGCTTAAAAATATTTTTTGACTTTCAAATGAGCGCATAGGTTCG
> GACATTTACTACAAGTACTAATGCTTGGACGCTTTTGTGTAGTTGCTGAGGAAGAACTGA
> TTTCCCAGGCCTACGTGCTTGGTTTCAACGACCAGACCTTAGATCTATAAGCAATTGCAT
> ACTGTGCTCATGCATTTCGGTCATTCGGAGAACGCGAGCGCGCGACCAAAGGTAGCCTCG
> TTCCCAATAGACCTTAAATGTCAGCACGATCCTGTCTCATGCTGTTTACGACATTTGAAT
> AGTAGGGGAAGTAAGGAGTGCTAGTCCAGCCAAAATGACGCACAAACCTAATTTCTTCCT
> TGCAATGTCTGACATCACGTAGGTCCCTTTGAACTAGTCATAAGTAATTAAGCGGTATTT
> CTGCAGCTCAGCTCACTAGTTTATTCAGTTTTTCGATCTGGCGTGAGGCAACTCCAACAG
> CTATCTTAGGAATCTACACTGTTGGAGTCCTGTACAGGAAATGTACCAGGGCAGTACACC
> GCATAAGATGTGAGAGAGGGGGGTTTCACATTAATATTGGTTAAGTGAGTTGCACGAGAC
> GCACGCCGTCTTTCTTTGACAAGACACCTTGTATTATAGAAGCGCCTCCAACAATTGCTC
> GTTGGCCCCTGGTAATATATTTATCCAGTCTCAAAGGGACGTGACGTTACCGATAAATTA
> AGACGTGACCTCAGGTTTGTCGAAATTAAGTTCGGCAAATGTTCGAGAATGGAATAAAGA
> GGTAGCATCTGCTTTTGAGGGGGAGCTATATGTCCATGTTCAATCCTCATCAATAAGCTG
> TAGAGAGACAGACGTAAGGACTAATATCTTTTCTCACACGGTGTTGTTGTGTCACTAGTA
> CGCTGGCTATAGGAATTGATACAGCGAAGCTCTAGGCAGAGACATGATCGTCCACAGTTA
> GCTAAGACATTATATTTTACAGATTAAGAGAGGTTGGCACATGGTCAGTATACAAAGCGA
> TTGCTAGCGCTATGGCATTAAGGTCCTTACTTTGATAATTACCAGCCATATTAGGTAACA
> GTTAAGATACATACAGCCTCCATCCTTATCTGCCCACGGACGTAATAGTTAAACTTACGC
> GGTGCATTCAGAGGAGTGCTAGCATGAATCCCGATCATTTAGAAACAACTGTCCAGTATG
> GCTGTAGAACTACAGGCAAGTAGTTAACAATCTAGATGGTATAAGCCTAGATTCGCGGGG
> TTCCCTTGCTGAGAACGGCCTTACCCTTAGTCAGGAATGAGCCATTTCTGGGCAATTTAT
> CCCAATCGGATCCTGCATCGAGAGTCACCCGGTAAATGGAATGATAGTTAGATAAGGTTC
> CCCTCGCGTCGCTATGAGATAGATATGGTACGTGGACTCTTTTGGAAGATTTTCGGATAA
> TCAGACATTTGATAGACTTACATGCTACCACTAGCAACTACCGCTTTGATCAATCGTATC
> ATTGAGTAATTTTGCAAAGAGCCATTATCGGCCCAAAAGACATGTTGGCATTTTAAACAG
> TAATGAACTAGTTTCGTCACGACCATATAGAATTATTCGGATCTAGAGAGTCAGCCAAGT
> TGCGCAGGCAATAAATTCAAAGAAAGCTATTGGGTATGCTTCTATTGATTCGGTGTAACC
> GTTTATAATGCGCTCGGTCAAAATCTTTTTCTAAGGGATCCGTGAAATGCAAGTTAATAT
> CATTAATTTTATATACTCAGACATAAATTAGCCAAGAGTATATCGAATATAACAAGAACT
> GAGCATTTAACAACTAGACTATAGTTTACGCTACTTCCACTTTTAGTGTCTTGTGTGACC
> AATACACGTACGTTGAGGCGTGGAAGCTTGATAATATTCCTCTACGAATCTATACTCAGA
> TTAGCACAAGCTAGAACGTAAGCTACATATTAACTCACGTAGACCGCATGCGATGGCAGA
> ACAAGAATCAAGACTGAAGACAGGCTTGATTTTAACTTAACCTTGATCGCATACCACATT
> CCAACGGGATTGAAACAGATTAGAGGCTGCTAATCTTAAATCTCATTTTATCCGTATCTT
> AACAACTGTAATTTATCAGGAGATATCTTGAGTCTGATAATCCACTATGAATCGATTTGG
> TATTGCACTTCATTATAACTTAGGTCTTCAACTTACAGCCCAGACTACATTTATAAATTC
> GTGATCGACAATAAGGCTGCACATACCGTGCAGCGTTTATCGGATAAGGATCTCATGGCT
> CTTTCAATGCGCTTGCATACCGGTTATGATCCTATTATCGCCCCGTTGAATAATCTTTAA
> CGTCTAACACCTTTGTGGCCGAATACATCGAGTCTCGATTTACCCAATTATTTTTGCTGA
> GAATTCCCAGTGATGTACAGGGACCGTCGTTTATCATAAGCAAGAAAGGTAAGAGACGGA
> CATCCTCCGGCTCAATCGTTTGCCCTGAAACTCAAGAAGTCGCAATTTGGTCCAGCGCAA
> TCATATTTAATTCCAAGAACGTACCAGTTCAACTTTGACAAGTAGGGAATTGATCGTCTA
> GTAGCGAATTACATGTCAGCATTCCCCTTCAATATGGTGAATTCAACTATGTTCGAGCAC
> CATGTTCTTTTTTATTATATGATATAGTGTCTTGTCTATATTCGTTAATGAGCGTCTTGC
> TTGAGTGAACTATGATAATTGGTACACGTCACTAGCTGAATACCATTTCAACTATACTGA
> GACAGATCTTTCTGTGATTTATAGGTACTACTTGGAAAACCGCTTACATTCGTTTGTAGA
> AGTTTTCGCTTTCGAAGAACGTTAAATATGAGGAACCTGAAGAGTTCGAAGCTCTAACTG
> ATACTAAGATATAAATCACTAAAACTACCGTATATAGGCAATTATTCTGTTTAGACAATG
> CTTTATGCATAGGTCCGATTAGTTGGATAACAATAATAATATGTGTTTAACACCGGCTCT
> TGCAAACTATCATGAACGCCTCGACGAGCGTGGTATATGTGCTATCACACCCTCTCTGGA
> ACAGGGTTGAACGCGCACTCGGTCCACTGAGCTCTACCGTTGACGTGATAGCACAAACTC
> ACCACGTTTGAAAGAAGCAACCAGCACTAACTGTAAATATGATACCTTGTGGCAGAACTT
> GAAACTATAGGTTCTATCCAATTCGGTTGTGATATACGGTTGAAAAACAACACGGAGTTA
> ACAGTCAGCATCTAAAGTAGCAATAATCATAAACACAGATCTACTTCCGAGTCCCACGAA
> GCACATCTCCGTTTAGAATAAATCAATAGGAACTGCGTCTCGACGACTTCATAAAAATTA
> ACTAATTCACAGACCATCCATACAGATTACAGAATTTTACGTTTTGAGACCGGAACTTGA
> TACCGACAAAAGTGTCCTAACCACTGCTCGGGGAATTATCAACTAGGAGGTACGCATGAA
> ATAGGAGACAGGATCAATTTTGCCTTCATAAAAGTTTCTTTCAAACGCACGAAGTTCAAT
> GAATATACGTCGAACTCGATGCGTGATTGACCTCCTTTGATCATGTCATATAATTAATTA
> GCTAACGTCATTTGTTTTCGGCCCCCAAATTGCTGGAGTTTTATGCCTAGAATTACGGTG
> CTCGCGTCGGATCATCTTGTTAATATCACAGGCACTTGGTTCTAGTATATGATTCATGCC
> TCCGTAGTACATTCGCGATAGCCTCTATCTTGTCGATACGTAAGGAAGGGCGCGAGGTTT
> AAGTTTGCGTAGGTAATTCCAGCCTTACGAAACGGGGCACTGACCTTTTATAAGACGCTA
> GGTGTCTTTTCAGACGTAAGTCTAGGGTGAAGTTGTTCCCCGTTGTGGATGAATTTCGTC
> AATAAGAATTGATCTTATCATCTAAAGGTATGTCCCTTCTAACTTCGGAGATATGGACCC
> TCGCCCGCAGTCCAGACAATTCATAAGCCGCACAAGTTGTCGTCCCTACATATCGTGAGT
> GGGCTCGAGAATGGAGGGGTCTTTTTTGCCGACCCTTGGAGACAGACTTGTAAGAACGAG
> AGTGACATTACTCTGCCGTGCATGGTCAGCTTAAGATCGAAACGCCGGGACAGATAAACC
> AATTGACTTACCAGCACTTGTCAACGACTCCTTGATATATGTCAGTCTTTTTTGATATTT
> GCGAGGCTCCCGGTCGTCAGATCTAGCAGTTCATTCGCAGATAATTGTGTCTCTAACGTT
> ACTTGCAAAATGTGCGATAGAAAAAACTAATTTTCTGCAATGAAACATTAGAGGTACGTC
> CGAAAAAATGCTGTAAATGATATACTTATCAAGTTGACAACCTCTTCCAAAGGTGGGAGA
> GTTTGAAACGAGCCGGTACTTTGAATAGCTAAATGTATGAGGGGCTGCAGAGCAAGTCAG
> TTAAGGATGCTTCACTGACAAGAAGAGAATTGGCTTAATCTATTTACCATAATCTTTAAT
> CGTCAGTTATTATCCTATAAAGAACGGTGGATCAACTGAAGACAGAACCATATCTGCGTC
> CGACCTGATGGTAGACACGTATCCATAATGACCAATTTCCCTTCAGAAGTAATTAGCAAC
> GTCCATACCACATAGTGGGACATATCTGTTCGGTTAGAGACAGCATTAATTTTCTACCTC
> GATCTTATGATTAGGGAAGTTATACTTGGATACAACTACTCTGCGAAGCCGGTAACCTTA
> ATTTGGACACCAGCTTATGACGTAACCATTAATAATAAGCGAAAAAATATCGTGAAAGCC
> CCACAGTAAAGGTTATTCGTTGTGTCGTTAACTACTATTAGAACCGAAAGTGGGTTAGAA
> CCTCAGGTAAGTCCAACGTTGCAGAGAACTCTGACGGCTTTATCGTTTCAGAAAAGGAAA
> GTGACTGCAATTATTGGCGATAGTTCTCCAAGGAGAGCTGGGAAATTAAATTGGTAAACT
> TGAATCGTCTACAATGACGTCTGATTCTGGGGACCCCAATCCGAAATCATTAGACACGTA
> ATACAGTAACTAGTATACAGGTACTATCGGTCATCAAAGCTCTTTTAGATTCAAACAAAA
> ACGAGATTTTTTCGATGACTGTTTCTGCGTTGCTTTTTAGACATGATCCACAGTCTCCTA
> ACAATGATTCCCATTCGGCTAATATAGTTCTCTGACGTGCTTTATCCTTTATCTTTGGAC
> TAGACTATAACCCTAAGCATTTCACTGTCTACTTTTGCGTAATTCCACTTCCTGATTATC
> CCTAGGTAACGTTACAAAATGATATACCATGTGGCGTATCACATAGGACTAACCTATGTT
> GGGTTTGCCTAGTATTTAAAAATATTTTTAAGGGAGGACTGTATTGACGATAGGCCAGAT
> GTCTCAACGTTACAACGGATCTCATCGTTACTTCTGTCTCATGCAACCGCTCTATTTTTT
> GACAACTGGTTCTAACCGGGTGCTCTGACTAATAGGTTTAGGTGATTTCTCAGAATCTGT
> TCACACTGAAGTTTCGCTGTGAAACTCCACCGTCTTGACATGAAATGCAATCCTTCTAGG
> AACATTACAGGTAATGATAAATTGAGTTGGGTATCTATAGTTCCACCTAGTCGAGATGGT
> TAAAACTTAACTTGTGATATCTCCGTTTAAGGGTCTTAATTAGTATGTAGGACTGAATTA
> TTTTTAAAAGCGCATTGGAAAAATATAAATCAAAAGCGGCTTAAGTGCGGTGTAATTTGC
> CAGTTGTTTATTTTCGAGTATTAACACTACGGCAGACTTTAATACTTAGATATAACAATG
> TTTTGGGGAAGGTGAGCGGGTTACTTCCCGTTCATAGTCACTATCTTATTATTATACGGC
> TGTACAACCTTGAATACTCATTGCGAAGGCCAGTACAGAGGAACCTATTGATGGATTCAG
> GGTAGGGATGTAATACTCCGACTTGCATACCTAGATCCTTTGCCTAATTCCTCCCTTGGT
> GAACTAATACCGGACCAGTTTTAGTAATACACCCGTACAGGGTATGTGGCTGTCTGGCTA
> GAACCAACTTTGCTTCTAGTTCGCTTCAGAAGCCGCTATGGTTCAGAAAAGGACAGCTCT
> TGGATTATAACTGGCAACAGCATTGAAGGGAGTTGGCCTTACTAGAGTTATCTTTAGATC
> CAGTCTTTCCTTCGTAGTATTTATTAAATCATGGAGTCTTCTAAGCCATTTACATGAAGT
> CAGGTGAGGGCTTTACGGTTTTACACTCAATTCTCTCCTGATCTCCTACCAGACATTAAG
> TACCCCTACAGCTTTTTTCAAGTACCAATATTTTCGAAATTAAGCATAAGGTGTTTGCTT
> ACACGGCATATCTAGTGAAAAGCGTGGGGGAGAGATATTATAATGACACGAGCTGAAGAT
> TGAGTATGCGCCACGCACTCACATCCCGCCGCGATATATCCTTTTTAACAAAGGTCTCCC
> TAGCTAATACACAGCGACTCTTACAAGGCTGGATTTTAGGACCCGAGCAGGCAGAATCAT
> GCTGCTGAGTAACGGCTTAATCACCGTGATTTTGGAGTAAGGCTTGAAGACTTTACTAAA
> GTAGGACAGAAAAGAAACTGTTTCCTATATAGACATACAAAACCCCTAACCTTAGTTCAC
> GTTAGTCAACCGAAAAAATATATATGAAGGTATTGACACAATCTTTTATTTGATATCGAT
> ATTTTATGGGATTCTTAGTTGTGCAAGGCGTTTCGGTGGAACCCATAGTAAAAATTACGT
> TGACTATATTCAAAATTGGCTTAAATCTCGCCTGGTAATGCGTGATAGTCGCCTAGACGG
> CACATAGAAAATATACCAACACCTCGACCTCAGCATTCCTGCCTCGTTGACTGATAACTA
> CTATTGATTATAATAAGGGTGCGTGAGGTCCCTACCTGCTACCGTATATGTATGCAGTGC
> ATGAGCCTGCACAGCGTAATTTAAAGGGAGTTGGTACCGACCTCAAAAGGATTGGAGACA
> TTAGTCGCCACGACCGCAAAGCCATAAGTAGGCAATCAGATAACAAATAGATGTTATATT
> GGTTACACAGACATTCTTAGTGAAATGCACTCATGCTCCGTGACGCATTTAAACTAATAC
> CGAGTTTTCTCTTCTAGTTGATCCTTACGTTGGGGCCCGCTCAGCAGAAGAAGTTACATT
> CAAACAGCTTACTCTTTGTGCCTCAACGTGTGGGTTGGTGCATGAGAATTTGCTCGATGG
> TTCGACTGTTTAACTGGCTTATATCATATTCATACGTGCCTATGTGTAGCCATAACATCG
> CTTATTTGCTCCCTCGTGATGTCTCGTAGATAACTAATTGTGACTAGAGAAATAAGCGTG
> TACGCTCATCGCCACTAAGCAAATCTTGACTCAATATGGTGCGACTGTACACGTTGCGTG
> TGCCTGTCGATTAGTGTAAGTATTGAGTACGAGGGTGGTTGTCGAGAAAGTTCCAAATAT
> CTTCAGATGATCATATGGGTCGTGTTTGATTAGTTTTTATATTTGAAGTACCTGCGGAGT
> ACTTATAATTGTTACTGACTCTTGGTGCACGGGCGTTACTATACTAGCCGCAAACAAAGT
> GTGATACGGATTAAACGTCTTATAGCCAAATTGTGGATCATGTTGCATTCGCATAGGGCG
> ACATATTGAATCCAATTATCAATCATAAAGTGCGATGCTTCGGTCAAAATTAACCATGTA
> ACCAAATTTAAACTCGTATTTCTGGGCATGCACGTGGAGTCGCACAACGCTTGGGCTCTA
> CGTGGGACTAAATCGAAAGTTTGCGACGGATATATCTTAGGGATAAGCCGGTTCAGAAAC
> ACGTGATATACTTCCATGTGCTCGGACCTGCTCAAAAGTTACAAGTTTCTGAACACGTCG
> ATACTGCACCATGATAGCAGCTTTCTGTTAAGGGGGGTTTCGGGCACGTTTACCTATTTT
> AAGTTGGTCTAGCACTTCGAATTACTGTCATTCATGACCGTACCATTCTGTCTAAATTGC
> GTATTTGTTTCAATTTACTATAGTGAAGTTACGCGTCATGACTATCATCTGTTGAACAGC
> AACAACTTACTTTTCTTTGTACACATAAGGGCTGTTAACGTTTCCAATTTTGTCTCATAG
> GTCAGGTTAGGATCCCCAGATCTTATATAGTCAAGTGCGTTGGGCCACTAATCATCTAGT
> AAATCTACTGAAAATTACTCCCAGGTTGGAGGTGGCTGAATTATGTTAAATCTATCCACG
> TTGAAATATGTATAAATTTCAGTTTAGGTGATCCTCTTAAGATTTTCGGATTTGTAGTAT
> ACCCTAACACGAACGTGTCTCTATTCTTAAGATTGCTAATACGATTCTATTTGCCAAGAA
> GTCGGTTGAACAATGGTGTACGGCGTAGTTACGTCCTCTTAAGTCAACATATGGCCTATT
> GTATCCAAACTCTAAGAGTGCTCTCACTGGGTAACAAAATATTTCGCCCACTCTTGCTTA
> CGGCTGACATAACTTAATATCCAACCGTTAATAGCATATGACGCCAACAGTACTTAGTAT
> TTGCCAAATTAAAATATACCCTCCCGCGTTATGTGGAGGCAATTCGAAGAGCTGTTAATA
> ATTGCTAGCAAATGCTATTGTTCTTGCATATCATCTGACAAGGCAATCTTAACGGGATTG
> GAACACAAGAAGGTGCAATGGTGTTATGTATTCAGATTTATGCAAACAAGTAGGCAATTT
> ATATGGGAGACGTTATGGTAGTTGATTCAACGGGATTGGTGTTTGGGTAAGGGGATTTAT
> TATATCAGTTTTCGTATATTGTTAAGTATGTCACAATGTGTGCGAGGTCTATACAACCCC
> TCTACCAACGTAGCCCTGATAATCACACTCACAGACTATTTAACACAATAATCGGCATAA
> AATCGCTTGCCACCTATGCTAGGATCGTACGATCGGTATTGATTATGAGGGTTACATCAT
> ATAGTATAGCATAAGATTGTCGATCAAACCTAGTACAGCTTTAAAAAATGATCCTATATC
> TATATGTAATATGCGCACGGTACCAAGTATGGTAGTGAACGGGAGAGCGCGTTTTAATTC
> AAATTCTATGTAAAGCGGTGTCATATGGGACACACCGAAAAGTATGACATTTTGGCATTT
> CCCTCATAGTAAGCCTCTAAGCGGGCTTCCTAAATAAAATGAGCTAATATCCATAGAGCG
> GCTGAAGCATATCATCAATTGAGGAGCCTGTATAGCACTTTGAGAACTAACCTATTGGAA
> TGAATGTACGTACTGGAAAATTAGGGTTGTAGAGTCAGTAAACATCATACCTCCGTGCAA
> GCAAGCCTTATTAAGTGTTCTTTCGATTTGGTACATAAATTTTACCTTCGAACACTATTT
> CACAGGAACTCAAACACCATTAATACCTAGTGACTCTCGAGGCGTTTGGGCTAGTTACTT
> TGGACTTCAGCGTTTGTGAAAGTTTAACATATAATTTTTATAAGTATGCGATCCCAAGTT
> GTTACTTAACTCCCTCCAATGCGTCCACAACAACTTTTGTTTAGACAACATCAAGGAATG
> AGTGTGTGATCTGAATCTACATGGATGAATTCGGTCATTAAAGATGACACGCAGGATTCT
> CACAGGCCTCCAACCGCCATCTTAAATGCAGCCCAAAGTTAAGGATAGCATCTGATTTTG
> GTAAGGATTGCCCACATGCACTAAAACTTGTACCAAGAACAACCCATCCTTTGTTTCCAC
> GGTTTGAGTCTCACACTCACGGCCTTAATAGTACCTGTTCTGTATAGGCTTGTGCCTCAA
> TAAAACATAAATAGACCCAAAAGGAGTGAGATTGCTCTCGTCAATATTAGAAAATAATTG
> CGCACGCATGGGGCAGGCGTCATTTGAATGCGTAAGATTAACCTGAAAACAAGATGTCAG
> AATAAACAGATAGAATTATTCATCCGTATTCGAAGATGCCCCTTCCTTCTGTATTAAGTT
> ATCTCCGTCGATACAATGTTTCTCTTTGCCGCGTTTGGTAATCCGGAAACCGTGGACTAT
> ATTTTTGATGCTGCATACTAGACGCGTGTGGCGAGAGATTGACTATTTTCGAAGGTGCGT
> CAAATGCATGCCTGTAGAGACGTTAGGAGTAACTAATTAACCTATTCGGCCATACCCTTC
> GATGATACAAAAAGATAAGATGGCTCAGAATTCTAATTGGTGGAGTATGTATTGTCTTAC
> GGGGTATGAAGGCTCATGTTAACTTATTAATAGGTAATAAGTAGTCCTGAAAAACTCATC
> GTGACCCTAAGTTGCATCAGGTCACCTTTTGATGCTTCATTGGTTTGCCGGAATTAAACC
> TTAACACGTGCCTGGCTGATAGATCGGAGCTTGTTCGTGTCGTCTAGTATTATGCCGGGA
> ATGAAGGGTTCCATTCGTGATATAAAATTGAATACAACCCATTGTTCAAAAATAACGTCA
> TTATCCCTTCACTAACCTTTAACTTGAGCAATAAAATTAGAAAATACCAATTTTACTAGG
> TCAGCAGCTTAACTATAGGCTCTAACCTCTAATGAAGATACTTACAGTGATCAAGTGAGT
> CTTGCGGAGGTCTCGCGGCATATGCTGTCCATAGCGCCAGCAGAAATTGTAAAAGCTCGA
> TGAGAGATTGGATAACTGATGATTTCTATGCTACGGGGGATGTTAATGTCCGAAACATCT
> TAAATTTGATTTATTTTGTCCACTGGCCTCTACAATACCCTAGGAAAAAAAGAGTAGTAA
> TAATTGAAGTTTAGGAACAGTTGCGTCGCCATTTAACTTTAGAGGCTCTAGTTCAAGTCC
> GTCAAATATGCATTGAGGCAGAAATTCTGCGGATCAAAACAGACGTTAGAACACCTCTGG
> GTCATAGCGATACCAAAAATCTCTTGGTAATTATCTTTACTTCCTTATATTCCCTGAACC
> TATAATTTTCCAGAGACCGTACTCGTACAGTGGACTCAATCCCCACGCATAAATCACCTT
> CTTTTGCTAGTCCAAATTGTGATCTTCAACGTCTTATTATTGGCCGATACATGAATTCGC
> CTTCAGGTATACTCCAAGCTGAATATTAGAGTAACACATCGTTTAGTGCACCCCGTTCAA
> TTTATACAAGCTTGTTATTCTTGGCTCTAACTGAATATCGAATGACTGAATTAGGTCGGC
> AACAAGTAGCGTATTTTAGCTTAATATCACGTTTTAACATAATTCCAGCCAATTACTTTC
> ACCCCACTATCTAATAGCCGATAACTGCTCAGCGTTTTAATTGTCAACCTCAAGCGGGAT
> TTTAATTTTGATACGCGACCGATTATTCTGATTAGATTTCGCTGACCTAATACGGAGTAA
> GAACTGAACAAGGATACGGCGGATGAACGTGAGTCGGGCTAGTTGTTTGTTGCTTCTCTT
> GCCCTATACGAGAAGAGCATGATTCGCGGTGTTTTCATCTGATGATTGAAGGAAATGTAT
> GCAATTAATTAAAGCTCAGAGCTGTACTAGGACAGGGGGAGTTTGATGTGACCTGTATAC
> AGAGAACTATACTAAGCCCTCACTATTCGGAACGGATATTGCAGTAAATTCTGACATTCA
> TACAAAGATAAGATCTAGAGCAAGCGGGTGAGCTGCCTTCTGATTAAAATTATGTTTTCA
> CGGTCAAATGTCAGCATTGCTGACCAAATGTAATTCTAGGACTTATGCGGGGTACCTTGT
> CGCGAGGTCCTGAGCAAGAAAGCAGTTCCCTGGCATTCGTGCTTGGTGTAATAGTCCACT
> ACTTTCTTAGATAAGCATTTGATGAATCGGCTCTTGCATTTCCCTCATTCCGAGAACGCG
> TCCCACAGACAAAAGCTAGACTAGTGACATATACAACTTAAATGTCTCCAAGATAAGGTA
> GATGGCGGTTTTAGAAATTTGTTTAGTAGCCGTACTTAGCAGTCCTTCTCATCCCAAAAT
> CACCATAAAACATATTTGCTTAATTCCAATCTCTCTCATAACGTAGCGAACTTGGAACTA
> CTCATAAGTAATTAAGCGCGAGTTATGCAGATCTGCGCACTACGTTTTTCACGTTTTACT
> TCGCGCGGCAGCCATCTAATTAACCTATATTAGGAATCGAATCTCTTCGAGTCAGCTAAA
> GGATAGCTAAATGCGCAGTACAACCAATTAGATGTGACTCACGGGGCTTTCAATTGATTA
> TGGCTTAACGGTCGGGCAAGTCTCCCACGCACTCTTTATGTCACAACAAAAATTCTATGT
> TAGAAGCCACTAAAACATGTGCGCGGTGGAAACTGCGAAGTGTGTTATCAAGTCTCTAAC
> CCAAGGGTCCGTACCGTGAAATTATGACCGCAAAGCTGCGGTCTAGAAATGAAGTTAGCA
> AATTCTTACACATTGGAATAAAGAGGTAGCAGCGCCTTGTGTGGGCGTGAGTGATCTCCA
> GCTTATATCCGCATCAATTACCTGGTGTCACACACACGGAAGCAAGAATATAGTTTCTCA
> CTCGGTGTTCGTGTCTATCGAGTTACATGCCTATACGAAGTGATACAGACAAGCTCGTGG
> AAGAGACTGCTTCCGCAACACTTAGAGTAGTCATTATTTTTGTCAGATTAAGTGAGGTTG
> CAACTGGGGCAGTATTCAATGAGTGTGCTTGAGCTTTCCCTGTATCGTCCTTACTTTGAT
> ATTGAACAGCAATTTTAGGGAACAGTGAAGATACTTAATGCCTCCATCCGTTGCTGAACA
> AGCAAGTAAGACGTAAACTGAAGCCGTGATGGATGAGGAGTGAGAGCATCTATCCAGAGA
> AGTTAGAAAATACTGGCCACTATGCCTGTAGAACTACAGCATAGTAGTTAAAAAGCGAGT
> TGGTATAACACTAGATGCGCGCCCTTCCATGGAGGAGTACGCCCGGACCCTGAGGCACGT
> ATGAGAATTTGCTGGGCTATTGTTACAATGAGGTTCATGCATCGACACTCTCAACGTAAA
> GGGATGCTTTCGTAGATAACCTGCACATCGCCTCCCGATGAGAGAGATAGCGTACCGGGA
> AGCGTTTGGTTCATTGGCCGATATTCACTAATGTGTTACACTTTAATGAGTACTCGAGCT
> ACTTCAGAGTTGTTCAAGCGTTTCTTTCAGTTATTTTGCAAACACACAGTAGACCCCAAA
> AAGACTGCTGCGATTGTTTTAAACTTTTCAACGAGTTGAGGCAACACAAGATTCTATTAT
> GCGCTTCGTGACACTCAGAAATCTGCACATGGCAATTTAGGAAAAGATACATTGTCCCTA
> TGCTTCGATTGTTTCCGGCTAAAACTGTTGATTGAGCTCGGGCAATATCTGTTTCTAAGG
> CATAAGTGAAATCCATCTGAATAGCATGAATTTTAGTTTCGCACACATAATTGTCCAAAC
> TGTATATAGATGATATCTTGAAATCAGCATTTAACAACTAGTCTATAGTTTAAGCTTCGG
> CCACTTTGACTGTAGGGTCGGAACTAGTCTCCTACCTTGAGCAGTGGTTCCTTGAGTATA
> GTCAGCTACGAAGCTAGAATCAGATTTCCACTACCGTGTAAGTATGAGAAATTGTATATC
> ACCTAGACCCCATGCGAGGCCAGAACAACATTCTACAATCTTCACTCCATTCAGTTTAAC
> TGATACTGGATCCAATAACAAATGAATTAGCGTTTGTATCAGTTTTGAGGATCCTAATCT
> TTAAGCTCATTGGTGACGTATCGTAAAAACTGTTATTTATCTGGAGAGTTCTTGAGTATG
> ATAATCCACTATGTTTAGTTTTGGTATTCCAAGTCATTATTACTTACGTCTGCTTCGTAA
> AGACAAGACTACATTTATATATTACTCTTCCACAATAAGGCTGCTCAGTACGGCAACCGT
> TGATAGGATAACGATAGAATGCATATTTCTAGGCGAGGCAAGACAGCTGATGATACTAGT
> AGAGCACCGTGGATTAAGCTGGTAACTCTTAAACATGTCTCGAAGTTTACATAGACTATC
> CTGTTAACCAAGGTGTTTTCCGGTGAATTCCCTCTCATCGAAAGCGACACGACTTTATCA
> GTACCTACTATCCGAACACACCCACAGAAGACGGCTCAAGAGGTTCCCATGAAACTATTG
> AACTACCAATGTGCTCCTGCGAAAGCATTTTTTTGTACATGAAACTACAAGGTCAAAGTT
> GTCTACTTGGGAAGTGATACGATTGTAGAGAATGTAATGGCTCCAGTCCAATTAATTATC
> CTGTAGTCAACTATGTTCGACCACCAGGGGCGTTTTTATTAGTTGATATAGTGGCTTGTC
> TATTTTAGTTAATCACAGTCTTGATTCAGTGTTCGATCATAAGTGGTACAAGTCAATTGC
> GCAATTCAATGTCTAATAGAATGACAAACTTCTTTATCTGATTTTGTGCGAAGTAGTCGA
> AAACCGATTAAATGCGTTGCTACAAGTTGTCCCTTTCGTACTAACTTTAATAGCACGAAC
> CTGTTGACGGAGAAGCTCTAAATGATACTAAGATAGAAAGCAATTATACTAACGTAGATA
> GGAAAGTAGTCTGTGTAGAAAATGATGGAGCAAGAGGGCAGATGAGGTCGAGATCTAGAT
> GATGAGGGCTTTATCAACGCCTCTTGCTAAATATCAGGAACGCCGCCACGACAGTGGGAG
> TTCTGCGTTCTCAACATCGATGCAAATCCGGTGTACCCGCACGCGGTCAACTCTCCTAGA
> CAGTTGACGTCAGACCTCATACTATCAACGTGGGATACATCCTACCTGCAATAACTGGAA
> AGATCTTACCTTGTGGCACAACTTGATAATTTTGCTTAGATCCTATGCGCTTCTCATTGA
> CGGGTCAAATAAAAATCGCTGTTTACACTAAGAATCGAATCTTGCTATAATCAGAAAAAC
> ACAGAGAAGTACGACTCACACGAACAACAGAGCCGGGTAGTTTATATCAATAGGAAAGGC
> CTATCGTAGTCTTATTTAAAATGAACTTTGGAAAACACCTTCAAGACTGAGTAATCAATT
> GTTCGTGGTCTCAACGCTAAGTGTTACAGACTAAAGTGTCCGAACATCTCCTCGGGGATT
> GATCAAAGTGGACCGTCCAATGAATTAGCTCACTGGAGATATTGGGACGGCAGATAACGT
> GCTTTCATTCCATAGAACTTCAAGCAATATAACTCCAACGCGATGAGTCATTCTCATCCT
> TGGTTATTGTATTATAAGTATTTAGATATCGTAATTTCTTTGACGCCAACAAAGTGATCG
> AGTTGGAGGACTACAATTACGGTGATCGCGGACCATCAGAGTCTGAAGATCTAAGGCACG
> TGCGTCTAGGATATCATTAATCACTACCTAGTACAGTCCCCTTAGCCTCTAGATGGTCGA
> TTACGTACGAAGGGCGCGAGCGTGATGTTTGAGTAGGTAATTAAACCCTTAACTAAAGCC
> GCACTCAAATTTTATATGTCCCTACCTGTCGTTTCACACCTAACTCTAGCCTCAAGGTGG
> TACCCGTTCTCGTTGAAGGTCGTCTATAAGTATTCAGATTAGCATCTAATGCGATCTAAC
> TTATATATTAGCACATAGGGACACGCGACCGAACTCCTGAAAAGTCTGATCCCGAACAAG
> TTCGCGTCAATACATAGCGTGAGTGGGCTCGAGAAGGGAGGGGGCGTTTTTGACGAAACT
> TGGAGTCACTAGTGTATGTAAGAGACTGACATTACTCGCACGTCCAGCGTCAGCTTAAGA
> TCGAAAAGCCGGGTATGTTAAACATATTCACTTAACTGAACTTGGAAAAGTATCATTCAT
> TTATGTCACGAGTTTTTCATTGTTGCCACGCTCCACCGAGTATCTTCTAGCAGTTCAGGA
> CCTGAGTATTGTCTCTCGAACCTTTCTTCAAAAATGTGAGAGACATAAAACGATTTGTCT
> CCTAGGATAAATTAGACGTACGTCAGAAAAATTGAGCGAATGGATTTTCTGATCATCTTC
> TCTTAATATTCCAAAGGTGCGAGTGGGTGTAACCACACGCGAATTTGAATAGCGAAATGT
> ATGTCGCCATGCAGAGAAAGTAAGTTTACCATGATGCACGGTCTAGAACTGAATGCCATT
> ATGATATTTAACAGATTCTTTAATCGTAACGGATTATCATATAAAGTTCCGTCGTTATAA
> TCTTCTAAGTTCATTATATGCGTCACAAAGGTGCCGTGAAACCGTGCCATATTGAACATT
> TGCAAGTCAGAAGTAATGAGATTCGTCATTAAAACAGAGTCGGAAATATCTCTTCGCTTA
> GAGACAGCATTAATTTTATTCCTACAGCTTATCATTAGGGTAGTTATACTTCGTGACATA
> TACTCTGCCTAGCCGGTTACCTTATTGGCGACACCAGCTTTTCAACGATACATTAATATT
> AACCGTATTAATTTACTCTAACCCACAAACTAATCGTTATTAGGGGTGTCGGTATAGAAG
> ATGTGAACCCAAAGGGCGGGAGAACATCAGGGAACTCCAAAGTTGCAGAGATAGATGACG
> CCTGTATAGTTTAAGTATAGGTATGTCTAGCCTATTAGTCCCCATACTTATCCAACCAGA
> CAGCCGATAGGAAAGTCCGAATAGTGTATCCGCTAAATTGTACTATGATTCTGGCCACCC
> CAAGCCCATTTCATTAGTCTAGTAATAAAGTTAAGACTTGACAGGGTATTTCCGTCATAT
> AAGAGCTTTGAGAGTAAAACAAAATCCAGTGTTTTTCGTTGAAGGTTTCTCCCTTCCTGT
> TTACTAAGGATCCAAAGTATAATAAAAATCAGGCCAAGTACGAGAATTTACTTATATCTC
> GTGAGTTATAATTGATAGTTGGACTAGACGATAACCCGTAGAATTTCACTGGAGAATGTG
> GCGTATTTCCTCTTACTGATTTTCACTAGGTTAACTGTCAAATTGATATTCAAGCTGGAC
> TATATAATACCTCGAAAATAGGTTCCCTGTCAATACTTTTGTTTAAGTGGTGTAAGGCAG
> GACTCGATTGACGATAGGCAACATCTCGCAACCTGAAAAAGCAGATCATCGTGTCTTATG
> TATAATGAATCCCATCTATTGTTTGTAATATGCGGATTACACGCTGCGAGCAATTTTAGC
> TTTAGGTGAGTTCTAAGTATCGGTGATATATCAACTGTACAGGTCAAACTCCACCCTCTT
> GACATGAAATGAAAGCCGTATAGCTAAATGACTGGTAAGCATTATTTCACTTGGCTTTCT
> ATAGTTACACCGACTCCACATCCGGATTTATTATCTTCTGTTATATCCGTTTAACGCGAG
> TATGGTGTATGTACGACTCAAGGATGTTTTTAACCGCATTGGTATTTGTGAAATCTAAAG
> CGGCTTATGTGCGGGGGTTTTTGCCACGTCTTTATTGTCCACTTTGAACACTTACGCACA
> ATTTTATACTTACATAGATAAATGGTTTGGGGTAGGTGTGAGCCTTACTTCCCGTTAAGA
> CTCACGATCGTATGATTAGAAGCCGGTAATACCGTCTAGACGCAGTCCCTAGGCCTGTAC
> AGACCATCATAGTGTGGGATTCAGGCTTCCGATGTAATACTCCCACGTCAATAACTTGAG
> CAGTGGCCTTTTTCATCCCTTGCTGAACGTATTACGGAACAGTTTTAGTAATACTCCCGT
> AATGGGGATGTCCCTCTCGGGCTTGAACAAAATGTGCGTAGTGGGCCATTAAGAAGCCCC
> TATGGTTAAGAAAACGAAACATCTTCGAGTAGTTCGGGCATCTGCTTTCTTCGGACTTCC
> ACTTTATACAGTTATCGTTTGTTAAACTCGTGAATTCCTACGTTTTTTTTAAGAAGGGTG
> TATTCGTAGAAATTTTATGGAAGTAACGTGTGCGATTGACGGTTTTACAAGCAATGCTCG
> ACGCAGCTAATTACACAAAGTAACTACACATTCACCTTGTTTCATCGTCAAAGTTTTTAC
> ATATTAACCATTTGGTGGTGGATTTCAAGGAATAGCTAGTCATAAGACGCCCGCACAGTG
> ATTATTAGGTCAAGTCATCATGTTTGAGTAGGCCCCTCCCAATCACATAAAGCCGAGATA
> TTTACTTTGTATAAAAGGTCTAAATACAGTATACACAGACAAGATTACAAGGCGCGATGG
> TAGGACACCTCCTCGATGATTCATGCTGCGGAGTATCGGCTGTATAACCCTGATTTTCCT
> GTAAGGCTTCTAGACTTTAATATACTACGACAGAAAACAAAAGGTGTAATAGATAGTCTT
> TAATAACCACTAACATTTCGTCAAGTTACTCATCACATATTTTTTATATGATGGTAGGGA
> CTCAATATTTTTTTTCTTTTACATTTTTTTTGCCATTCTTTCTTGTCCAAGGACGTGCGG
> TCGAAACCATAGGAATAATTACCGTCAATATATTAAAAATGGCCGTAAATAGCGCCGGGT
> AAGGCGGGATAGTAGCCGAGACCGATCTTAGTAAATATAACTTAAACTCCTACGATCCAT
> TAATGAATCCGTGTAGCATATCGACTATGGTGGATAATAAGCGTCACGGACGTCCATAAA
> TGATAAAGTATATGTATGCAGGGCAGCTCCAGCAAATCAGTTAGTTTAAGGGAGGGGGTT
> ACCTAATAAAAAGGATGGGTGACTTTAGTCGCCAACTCAGCATAGCCATTTCTTCGCAAT
> AACAGAACAAATACTGGTGATATGGGGTAAAAACTCATTCTTAGTGTATTGCACTCAGCA
> TCAGGGAAGCATGGTAAATTATACCCAGTTGTAGCTTCGACGTCATCCTTACGGTGGCGC
> ACCCTATGCAGAAGATCGTTCTTGCAAAATGCTGACGCTGTGTCAATCAAAGGGGGGGGT
> CGTGAATCACTATGTGAGAGATCCGTCGAATCGTGTACGCCAGTATATAATATTATTAAC
> TGCATTTGGCTTCCATTATAATCCCTTAGGTGCTACCTACGGATGTATCGTTCATTTATT
> ATGGGCTCTAGAGAAATTACAGTGGTAGCTCTGAGCCTCTTAGCAATTCGTCAAGATTTA
> GGGTCCCAATCGACTCCTTGCGGCGCCCGGTACTTTACTCTTAGTTGTCTCGAAGAGGGT
> GCTTCGCCTCAAAGTTACAAAGATCTTCAGTTGATATGATCGGTAGTCTTTGTGTTCTGT
> TTATATTTCAACTACAGGAGCACGTCGTTTAAGTGGTAAGGTATATGGCTCCAAGCGACT
> GACTATTCTAGCCGCAAAAATACGGTCTTTCGGAGTTAACGTATGTTTGAAATTTTGTCG
> ATCAGGTTCCAGTAGCATAGGCCCAAAGATTGAATCCAATTTTCAATCATTTACGGACAT
> CCTTACGGCTAAATTAAAAATGGAACAAAATTTAAAATCCTATTGCTGCGCATGCACCTG
> GACTCGCACAACGCTGCGGCTCTACGTCCGTCTTATGCGATTCTTTGCCAACCTTATTTC
> TTACCGATAAGCAGGTGAAGAAACTAGTGATTTAAGTACTTGTCCGCGCACAGCCGATAA
> TGGGTCAAGGTTATGAAAACCTCGATAATGATCAATGATAGCACATGTCTGGTTACCGGG
> CTTTAGGCAACCGTGACATATGGTTTCTTGCTCTTCAACTTCGAAGTTCGCTCATTATTC
> AAAGTTCCAGGAGCTCTATATGGCGTATGTGTGTCATTTTAATATACTGAAGTTACCAGG
> CATCACTATAATAGCTTCTACAGCATAAAAGTTCTTTTATTTGGAATAAGTAGGGCTGTT
> AACCGGTCCAATGGGGTATCATAGGTAAGGTTAGCATCAACTCAGCTTAGTTTGTATTCT
> GCCGTCGCAAACTTAGCATATAGGATATCGACTGATAAGTAATCCCACGGTGGAGGTGGC
> GCAATGATCTTTATGCTTGCCACCTGGATATATCTTTAAATGTCAGTTTAGGTCATACTA
> TTAAGATTGTCCCATTTCTAGTAGTCCCTTAAAACAAACTCTATCTATTAGTAAGATTGC
> TTTGAAGAGGCTATTTGCCTACAAGGAGGTTCAAATATGCTCGAAGCAGTTGTTTCGGAC
> TATTAACTAAACTTATGGAAGATGGTATCCATTCGCTAAGAGTGCTATCTCTGGCTTACT
> AAAGAGTTAGACAACTATTGATGTCCGCTCACATAACGTAATATCCAAACGTGTAGACAA
> TAGCAACACTAAACGTATTACTATTTGAAAAATGAATATATTCCAGAACCACGTAGCGCC
> TGGAATTGCCAAGAGCTCTGATGAAGTGAGACAATTGGCTATTCTTATTGCATTGATTCT
> GAAAACGCTAGCTTATCCCCAGTGGAACAAATGAAGGGGAAAGGGTGGGAGGTAGTCACA
> TTGATCATAACAAGTTCGATATTTAGATGGCAGACGTTAGGGTAGGGCAGTAATCGGGAT
> TGGGCTTTGGCTAACGGGAGTTATGTTATAACTTTTCGTTGAGTCGTAAGGATCTCACTA
> TCGCTCCGTGGGCTTTACATACCAGATAAAAAAGTAGACCTGATATGCTCTAGCACTGAA
> TATTTTTAAAAATAATCGGATTTTAATCCAGTGCAACAGATCCGAGGTGCGTTCCATCCC
> TTTTCATTAGCTGGCTTTCATCATATTGTATTGCATTACTTTCTCGTGCAAAAATTGTAC
> TCAGTTTAATAATGAGACGTGTGAGTTTTCTTATATCCCCAAGGTAACAAGTTTCCTTGT
> GTACGGGACACCGCGGTGGAATGCATTGTATATCGATAGCGGTGTAAGATGCCTCACAAC
> GAAAAGGATGACTGTTTCCAATTTCACTCAGAGTAAGACTCGAAGAGCCCTTAATAAATT
> ATATGACCGAATATCCTGAGACCCGATGTTGAATTTATTAAATTGACCACCCTGGATACC
> ACTTTCTGAACTAAAAGATGCGTTTCATTCTTAGGACTGCTTTATTAGGGTTGTAGAGGC
> AGTAAACAGCATAAATAACTCCTACAAAGCATTAGGTTCTGTGATTTCCATGTCGTTAAT
> TAATTTTAAATTAGTTAACTATTTCAAAGGAACTCAAAAACCTTGTATACCTAGTCACTA
> TCGAGGCGTTTCGCATAGGGTATTGCGACTGCTCACTTTGTCAATCGGTAAAATTTAAGG
> GTTTTTACTATGACTGAACAAGGTCTTAATTAACTCAATCCAATCCGGCCTATTAAACTT
> TTGGTTAGAATTCTTCATGCAAGGTCTCTCGGTGAGGTAGCGAAATCCATGTATTAGCTC
> ATGATTGAGCTCTCCAACGATTATAAAACCCATACATCCGAAATCTTATATCAAGCCCAA
> ACTTTAGGATAGAATCTCATTTTGCTTAGGATTGCCCACTGGCAATTAAACTGGTACCAT
> CTACATACAATCCTTTGTTTAAACGCGTGGTCGCTAAAAATATAGCCCTTAATAGGACCG
> GTTATCTATTGGATTGTCACTAAATAAAACATAATTAGACCAAATACGTGGGTGAGTGAT
> CGACGCAATATTACATTTTATTTGAGAACCCATGGCCCACGAGTATTGTGTATCACTAAC
> ATTAACCTGTATACTAGAGGTCACATTTTTATGATACAAGTATTCATCCCGATTCGAAGA
> TGCACATTACGTCTGTTTTTTGGGATATACGTCGATAATATCTTTCTCTGTGAACCCTTT
> GCTAATCAGGAATCCGGGCTATATTTTTTGGATCATCAATTAGTGAAGCGTCGGGCGTGA
> GATGGTATAGTTTCCAACGTCAGTCTTTTCCATGCCTGGTCAGTCCTGTGGACGAAATAT
> TGAACAGTTTCCCCCTGACACTTCCAGGAGTCTATTTGATATCATCGCTAACAATTCTAT
> GTGGTGGTGTATGTATTCTCTTTAGCGCTAGCAAGCCTCATCGTAAAGTATGATTTGGGA
> TTTAGTACTAATGTAAAACTCATCGGCTCACTATGGTGAAGCAGGTAACATTGTGAGCCT
> TCATTCCTTTGACCCTTTTAATCAGTAACACGTCCCTCCAGGATACTGCGGACCTGCGTC
> GTGTAGGATACTAGTAGGACCCCTATGAAGGCTTCAATTACTGATATTAAATTCTAGAAA
> ACCCATTGTGAAAAAATTTCGTCAGTATCAATTAAATAACCTGTTAATGGAGCATGATAA
> TGACATAATTCAAATTTTACTTGCTATGATGATTAACTAGTCGCGATAAAATCGTATCAT
> CATAATGAAACTGATCATCTCACTCGTCACCACCTCGCGAGCAAGTTCCTGGCAAGAGCG
> CCAGCACAAATGCTATAAGCTCGAGGAGTCAGGCCATAACGGAGGATTTCGATGATACGG
> GGGTTGTTATTCTAAGATAAATCTTATTGTGGATGTTTTTTGTACACTCGACTATAAATT
> AAAATAGCTATATAACTCGTGGATGAATTCAACTTGACCAACTGTGGACTAGCATTTTAA
> CTTTAGTCGATCTTCGTCTTCTCAGTAAATTTTGAAGTGACCCTCAATTTCGGACGAGCA
> ATACTCAAGTTTCAAAACAGCGGCGGAAGAGCGTGTCATAATATCGCTTCCTTATGAGCT
> TTTCTTACTTAGATGCCAGGAAACTATTATTTGAAAGAGTCCCGAATACGAATCTGGACT
> ATTGCACAACCATTAAATAAAAGTCGGGTGCTTGGCCAATTGCTGATCTGCTAAGTATTA
> TTTGTGGACGAGTCATGTAGTCCACGGCACCTATAATCAATCATGATTATTAGACTAAAA
> CTTAGGTTAGTCAACACAGTGCTTTGGATAAAACCTTCTGAGTATTGCCTCTATCTGAAT
> AGAGAAGGACGCAATGTGCTAGGCAAAATCTACCGTTTTGTAGATTATTAGATCGGTTTA
> ACATATTTAAAGCAAAGTAAGTTCTACCAAAGATATTTTACAAGTGAAATGCTCACACTG
> TGTATTCTCATCATATTCCGCGATTTTAATGTTGTTAACACAACGATTATTCTGTTTACA
> TTTCGCTCAACTTATACGGAGGAAGTACTGAAAAACCATAAGCCCGTTCAACGTCACTCC
> GCCTTCTTCTTGGGGGATTCGCTGCCAATTTAACTGAACTCAATGTTTCCCCCTGGGTTC
> ATATCATGTGTGAACGATATGGTTGCATTTTAGGATAGATCTCAGCTGTACTTCCACTCG
> CGGACGTTCAGCTGAACTGTATACACAGATCTATACTATGCCCTAACTAGTCGCATCGCT
> TATTCATCTATATGATCACATGCATACAAACAGAAGATCGACTCCAAGAGCCTGTCCTCA
> AGTCTGAGTAAATTTATGGGTGCTAGGTATAATGTCAGAATTGCTGACCAAATGTAAGTA
> TTGGTATTATCAGGGCTACATGGGCGCGACGTCCGCACCTTCATAGCAGTGCAATCGCAT
> TAGGCATGCCGGTAATAGTAATCTACTTTCTTAGTTTAGCATGTCATGAATCGCATATGC
> CAGTGACCTATGGACGACAACCACTCACACAGACATTTCCTAGAAGACTGAAATAGACTA
> ATGTAAGCTCTCAAACTTAAGCGAGATGCAGCTTTTACAAATGGCTTGAGTACCCCTTCT
> TTCCACGCAGTCTAATCAAATAATCAACATATATAATTTTTGAGTAATTCAATGCGCTCT
> ATGAAACGACCGAAATTGCAAATACGATGTAGGTATTTTCACCGTGTTAGCCACATATGC
> GAACGACGTTTGTAACGGTGTACTGCGCCACGCAGCATTATAATTATCCTATAGTACCAT
> TAGAATCTCTTCGTGTAAGCTAATCCATAGCGAAATCCCAACTAAAAACAATTTCAGGTC
> ACTCACCCGGCGGTATATGGATTATGCCTTTACGCTCGGGCAACTCTCCATACAACGAGG
> GATGTCTAAACAATAATTCTATGTGAGAACACAATAAATAATGGGAGAGGGCGAAAATCC
> GATGTGTGGTAGAAAGGATATTTCCCAACGCTACGTTCCGTGAATTGTTCTCCGCAAAGA
> TCCGGTCTACTTTTGAACTGACCAATTTCTGACACATTCCTTTTTAGACCGAGAAGAGCA
> TTGGGTCCCCCTCAGTGTTCGCCAGCGTATTGACGATTAATTTTCATCGTCTCTCTAACA
> ACGTACCTAGTATTTAGGTTATATATACCTCTTCGTCTCGATCGTCGTACATCCAGTTTC
> GAAGGCATAAACACATGATCGTGGATCTCAATGCTGACGAAACACTTACAGTACTAATGA
> GTGGTGTAACATGAACTGACCGGGCAAATGGGGATCTTTTCTATCACTGTCATTCAGATT
> TCCATGTTTCCTCATTAATTTCATATTGTACACCAATTGTACCGATATCTGAACTTTATG
> AATCCATAATTAAGTTGATCAAAAAGCAAGTAAGTCGGTTTCTGTAGACCTCATGGATCA
> CGTGGCAGTCATTCTTTACAGTGAAGGGACTTAATTATGGACACTTTCCATGTACATATT
> ATCCATTCTTGGGATAAAGAGTCTGCCGATAACAAGTCATGACACCCCGTACATGCAGCA
> CTAAGCAAGGTAAAGGACGAACCTAGCACAATGTGATCGGATATTGTGAAATTGACCTTA
> ATGAAGCGACTCGATCAACCTATAGGCTTGCTTTCGTACATTACCGGAACAGCCACGACA
> GTTCACAGAGATTGCCTAACGCCAAGCGGGTGCTTCAGTGGACCAGATGCACTAATGTCT
> TACTAGTTAATCAGTAATAGACATTATTCACAGTTCTTCTAGACTTTCTGTCACGTTTTT
> TCATTTCTCAATGTAGACCAAATAAAGAATGCTGCGATGGTTTTAAACTTTGCAACGACT
> TGACGAAACTAAAGTGTCTATTTGGACCTGAGTCACACTAACAATTCTGCACATCCATAT
> TTTGGAAATCATTCATTGTCCCGAGCAGTAGAGGGTTTCCGGCTAAAACGGGTGTTTCAC
> ATACCGCTTTATATGTGTAGTAGCCATAACTCTATGCCATCTGAAGTGAATGATTTTTAG
> TTTAGAACAATTAATTGTCCAAACTGTAGTTACTTGTGTTATTCATATCACAATTTATAT
> TATACTATATTCGTTAACATTAGGAAACGGGGTCTCGAGGCTCGCAAATAGTATACGAAC
> GGCTCCAGTCGTTCATTCAGTTGTGTAAGATACCATGCTAGAAGCACATTTCAAATACCG
> TCTAACTATCAGAATTTGTATAGAACCGTGACACAATGACTGCCATGTAAAACTTTATAC
> TATCTTCAATCCATGCTGGTGAAATGTTAAGGGAGACATTAAATATTGAATTACCCTGTC
> TATAACTGGTCACCAGCAGATGATTTTTGAGCTTTGGTGAAGGTTAGTATAATCGCGTAT
> TTAGATCCTGAGTTAGTCACTATCAGAATAAAAGAGCTTTACTTTTCCTATTCCTAGGCT
> TGTGTACTTTCCGAGGATTAGGAAACACAACAAGACATGTATTTATTACTCTGACAAATT
> AACCAGCCTAAGTAACGCAACAGTTGTTACCATTACGTGAGAATCCATATTGCTTGCACA
> GGCATGAAAGCTGATCAGACTAGTAGACAACAGTGGTTTATGATGGTAACTATTTAACAT
> GGCTCCAACTTTTCTGACTCTAGCCTGGTAAAAAAGGTGTTGGCAGCTGTATGAAATCGC
> AGCGTATGCCACACGACGGTTTATGTACCTACTATCCGTACACAACCTAAGAAGAAGGCT
> AATGACGGTCAAATGAATATATTCTACTACAATTGGCCTACTCACATAGATGTTTTTTGT
> AAATCATACTACATCGGAAAAGTGGTATTCTTCCGATGGGTGACGATTGTACACAAGGTA
> TTCGATCCTGGACAATGATTTAGCCTCTTGTAAAAGATGTTAGTCAACAAGGGGAGTGTG
> TTTTTGTGCATTGACGGGATGGTAGATTTTACGTATTCACACGCGTGATGCACTCTTCGA
> TCTTATGGCCGACAACGATATTGAGCATGTAATGGTATAATTGTAGCACTAACTTCTGTA
> TCTCATGGTGTCCGTAGTAGTCGTAAAAACAGGTAAGGACTGGCTACTAGTTGTACATTT
> ACTACTAACTTTATGAGCACCAACCGCTTCTCGGACAAGCGAGTAAGCTGTAGAAGAGAG
> AAAGCAAGTATACTAAACTTGATACGATTGGTGTATCGGTAGTATATGATGGAGCAAGAC
> GGAACTTGTCGTCCTGTTATAGTTGATGAGGGCGGTATAAAAGCATATTGATAAATTGAA
> GGAAACAAGACTACACACTCCGAGTTCTCAGTTCTAAAAAGAGAGCCAAATCCGGTGTAC
> CACAACGACGGAAAATCTCAGAGAAACTTCTACTCTGACATAATAAGATAATACTGGCAT
> ACATCCTTAATCATATTAAGCGTTAGTTCTTACCGGGTCCAACTACGTCATTATTGTCCG
> TAGATAATTTGCCCTGCGCAGTGAACGGGCATATAAATATACCTGGGTTATCGATGAATA
> GAATCTTCATAGTTGAAGTATATATCAGAGAAGTACGTCGCAAAACAACATAAGAGAACG
> GGTCTTTTTTTATTGTCCAAAGCACGATACTACTATTATTTAAAATGATATTTGGATAAC
> TCCTTAAAGAATCTGTAATCAAGTGTTCCGGGGCTCAACGCTAAGTCTTTAACAATAATC
> GCTCAGAAAATCGCATACCGCATTGATAATAGTGCTCCGTACATTCAATGACCTCAATGG
> TGATTTGGGGACGGCTGATTACGTGAGTTATTTACATACAACGTAAAGCTTGAGAACTAC
> TAAGACTTCACGCAGTCTAATAATTGCTTATGCTATTATAAGGATTTACATTTACTATGT
> GCTGGGACGCCAAAATAGTCATCCACTTGGAGCAATACAATTACCCGCATAGACGACCAG
> ATGAGTCGGTAGAGATATGCAAAGTCCGTATAGGATTTCATTATGCACGAACTTGTTAAG
> TCCACTGACAATATTGATGCGACTTTACGTACGAACCCCCACACCGTGATGGTGCACTTC
> CTATGTAATCCAGTAACTAAACCCCCTAGCTAATGTTTTATCTACATTCCTCTAGTTTAT
> CTACTATCTCGAGCCTCAACGGCGTACCCCGTCTCGTTCAAGGTCCTATTTTACTTTGCT
> GATTAGATTAGTTTGCGTTCTAACTTATATAGTAGCACATAGCCACAAGACAAACAACTA
> ATCAAAAGGCTGTTCACCAACTTCTTCGACGAAAGAAAGTGACTCTCTGGCCTACTCATG
> CGAGCCGGAGTTTGGCACCAAAATGCCTCTCACTAGGCTTTCTAACTCTCGCTAAGTTAG
> AGCACCTCAAGCGGAACCTTATCTGACTAAACAAGCCTATCTGTATAATAGGCAATTTAC
> TCAAATTGGATAACTATAATTCATTTTTCGCTCGAGGTTTTCATTGGTGACACCATACAC
> CGACTATCTGCTACAACTTATGGACATCAGTTTTGTCGATAGATACTTTAGTCAATAATG
> TGACAGACATAAATAGTTTTGGCTCATAGCATTAATTTCTCCTAAGTAAGATTATTTCAG
> CGAATGCATTGTCGGATAATCGTCTATTAATATTACTAACGGCCCACTCGGGCTTACCAC
> AACCGAAGTGGTATACCGATATCTAGCTCCCCAGCATCACATACGAACTTTACCATCATG
> AAAGCTCTTGATCTCAATGCCATTATGAGATTTAAAAGTTTATGGTTGCGTAACGGTTGA
> TAATAGAAACTTCCCTCCTGATAATCTTCTATCTTAATGATATGACTCACTAAGGTGCCG
> TCTATACGTGACAGATTGAAATTGGGAAAGTCTCTTCTTTGGACATTAGTCATTTAAAAT
> GAGGCCCTAAGAGCTCGTAGCGGAGACAATCATTTAATGTTATTAAGACAGATTATCATT
> AGGGTTCGGTGAAGGCCTGTATTAGAATATCCCTACAACGGTTAATGTTTGGCCTAAACA
> CATTTGCAACGTTAAATTAATATTAACCCTTTTATTTGACTCTTTCACACTATCTAATCC
> TGAGTACGGCTCTACGTATAGTAGTTGTCATCCCAAACGCCCGGACTAAAGAAGCGAACT
> ACAAACTTCCTCACATAGATGTACCATGGTGACTTTAACTATACCTATCTCTAGCATTTT
> TGTCCACATACTGATAAATCCTCACAGCCCATAGGTAAGTCCGATTAGGCTAGACGAGAA
> TTTCTACTATGATTCGGCCCTAACATTGAACTTTTAATTAGTATAGTAATTATCTTTAGT
> CGTGAATGCGTAGTGACCGAATATTACAGATGTGACAGGAAAACTTATTACAGTGTTGTG
> CCTTCAAGGGTTATCACTTCCTGGGTACTAAGCAGCAAATCGATAATAAATTTCTGGAAA
> TGGACCAGATTTTTCGTATAGCTACTCAGTTATAAGTGAGAGTTCCAATACTCGTTAAAC
> CGTTCAATTTAAATCGAGTATGGGCCCTATGGCATATGAAGCTGGTGAAAGACCTTTACT
> GTCAAATTGATATTAATGCTCGACTTTATAATACCTAGAAAATAGCTTCCCGGGCAATAC
> TTTTGTTTAAGTGGTGGAAGGCACCAAGCGTTTCACCTTACCAATCATCTAGATAACTGT
> AAAACCAGATAAGCCTGTATTAGCTAGAATCAATCCCATCTAGGGGTTCTAATATCCGGA
> TTTCACGCTCAGAGCTAGTTTACCTGTTCCTCTGGGATAACTATAGCTGATATAGCTACT
> GTACAGCTCATAATACAAACGATTCAATTGAATGCAATGCAGGAGACCTAAATGTATGCT
> TAGCTTTTTTTCACTTCCCTTTAGAGAGTTACACAGTCTACTCATCCGGATTTAGGTTAT
> TCTCTTAGAGCCGTTGTTCCCGAGGTTGGTCTTGCGACCTCTCAAGGTGGGGTTTATCAC
> AATTCCTATTTGTGTTTGCTTAACCCGATTTTCGCACCGCGTTGGTGCATCGTCTTGATT
> GGACACGTTGTTAAATTACCAACTAGTTTTTTAGTACATAGTTAAAGGGTTGCCCCTACG
> TCTCAGCCTTTAGGCAACGGATGTCTAAAGAGAGTTTGTGTTGAACCCGCGAATTCAGGC
> TAGAAGAAGGCACTTGCAATCTTAAGTCCATAAGAGTGTGCCTTTAACGCTTCCGTGGTA
> ATAATACCTAGTCATGTAAGTCAGAAGTGCCATTTTGAATCACTGCCTCATAGTATTACG
> GAACACGTGTACTTATAATCAACGAATCCCGATCTCCCTCGAGCGAGTCTTCAATATGGC
> AGGAGTCGGACATTATCAACAACCGAGCCTGAACAAAACGTAACAGATGCCAGGAGTTCG
> CCAATCTCCTTGCTTCCCACTGCCAAGTTATACACTTATCGTGTCTTAATCTAGTGAAGT
> ACTACGTGTGTTTTAAGATGCCTGGAGTAGTAGAAATGTTATGCATCTATCCGCTGCGAT
> GGTACCGGTTTATAGAAATGATCGAAGCAGAGAATTAAACTATGTTTCTTCAAAGTCACC
> TTGTGGAATCGTAAATGTTGTTACTTTGTATCAAGTTCGTCGTGCAGTTCTAGCATGAGA
> TACTCTTAACACGCCCGCTCTCTGAGTTGTAGCTATAGTCATCATGTTTGACTAGCCCCA
> TACATAGCAAAGAAACACCACATAGTGAAGTGGTATAATAGCTCGAAAGACAGTAGTAAA
> TGACTAGATTTCAACGAGCGAGGGGACCAAAACTCATCGATGTTTCAGCATCAGGTCTAT
> ACCATGTAGAAACCTCATTTGCCTCTATGCAGGCTACTCGTTAATTTACGTCCTATCATA
> TCAATAGGTGTAATAGTTTCTCTTTATTATAAAATAAAATGTCGTAAACGTACTATTAAC
> ATTTTTTTTATTGCATGCTTGGCAATAAAGAGGTGTTTTCTGTGACATTTTGGTTCCCAT
> GAGTTCGGCTCATTCGACGTGAGCGCCTTAAAATTCGTTTTTTTACCGTCAAGTTTTGAA
> TAATGCCAGTATATAGAGCAGCGTATGCCCGCTGACTAGACGTCAACCATATTTCTTATT
> ATTAATTATAATACTACGATCCTTTAAGGAAGACGTCTAGCATATAGAATATGCTGGTGT
> TTAACCCTCACGCACCTAAATTAATGATTAACGAGAGCTTGCAACGCAAGCTCAAGCATA
> TCACGTAGGTTATCCCACGGCCTTACCTAATATTTACGAGGCCTGACTTGTGTAGAATAC
> TAACAATTCAATGTTCGTCCATTGAACAGATAATTTACTGCTGTTATGCCGGAATATCTA
> ATTAGGACGGTATTCATCTAAGCATAAGGCTACATTGGTTTAGTAGAAACTCGTGTAGCG
> GAGTCGGCTTAAGGTACGTCGCCAAACAGATCAACTACTTCGTTATTGATTAATCCTGAA
> GAGGTCTCAATAATACGCGGCCGTCGTCAATCTCTAGGTCAGACTTCCGGAGAATCGGGT
> AAGCCAGGATTTAATTTGATGAACGGAAGTGCGCTTCAATTATAAGACCTTTGGTCATAA
> AGACGCATCGATACTTCTTTTATTTGGGGCTATACACTTAGTACAGTCGTACAGCTGACA
> ATAGTAGAAATTAGGCAAGATTGAGCCGCCCAATCGAATCCGTGCCGCGCAAGCGACTTG
> ACGCGTTCTTGTCTCGAAGTCCCTCCGGCGACTCAAACTGAAAAAGTTAGTCTGTGCTGA
> TGAGCGCTACGCTTTCTGTTCTGTTTAGATTGCATCTAAAGCACCACGTAGTTTATGGCG
> TTAGGTATATGGCTCAAACCCACGGACTATTAGTCACCAAATAATTCGCGCTTTCCCTGG
> TATACTATGTTTCAAATTTTCGCCATAAGCTTCAAGGACAAGAGCCACAATGTGTGTAGA
> AAATTTGCAAGCAGTTTCGCACTTCATGACCGCTATAGTAAAAATCGTAAAAATGGTTTA
> AGCCTTTTGCTGCCCTGCAACCGCGACTCGAAAAAAGATGCCCATCGTACTCCGTATTTT
> GACATTCGGTCACAACCTTTTTTCGGACCGATATGAAGCTGAAGTAAATACTCAGTGTAG
> GACTGCTCAGACCACAGCCGATTATCGGTAAACGTGATCTAAAACTAGATAATCATAAAT
> CTGACAACATGTATCGTTTCCCCGCTTGACGCAAACGGGAAAGTTGGGTTCTGCCTATTC
> ATAGTACAAGTTAGCGCATTATTCAAAGTTCAAGGAGCGAGATATGGAGTATGTCTGTAA
> TTTTAATAGACTCATCTGTACACGAATCACGATATGAGCGGCTAATGCTTAAAAGGTCGT
> GTAGTTCGTATAAGTACGGAGCTTATACGGGAAAATGGGCGATATTACCTAACGTGTGCA
> GCAAATCAGAGTAGTTTCGATTCTCACGGCCCAAAATTAGAAGATACGATAGAGACGCTT
> TTGGAATACCACGGTGCACCTCGAGCAATGAGCTTTATGCTTGCAACCTGCATATATCTT
> TAAAGGGATCTTTTCCGCTGACTAGTTACTTTGTCCCATGGCTACTAGTCAATTTATACT
> AACGCGAGCTATGAGTTACATGCAGTTGAACTGGAGTTGTCCATTCTACGACCGGCAAAT
> TGCCGCGTAGCACGTGTTTACGAATAGGAACTAAAATGTTCGAAGAGGGTTTAATTTAGA
> GTACACTGAGAGATATCGCGTAATAATGTGGTACAAAAATATGCATGTACCCGCAAAGTA
> AGTTTTTTCATAACCTGTAGTCAATAGCAACAATTATCGTATTACGATTTCAATATGGTA
> TTGATTAAAGAAACACGTAGCGCCTGCATTGGACTTGAGAGCGGATGAAGTCAGACAATT
> GCATAGTCGGATTCCTTTGATTATCTAAACGATAGATGTTACCCAGGCCTTAAAATGAAC
> CGCAATGCGGGGGAGGTTGGCTCATTGAGCATAAATTCGTCCATATGTTGATCCCACTAC
> GTTGCGTAGGGCTGTATTAGCCATTCCGCTTTCGCTAACGCGTGTGATGTGTGATCTTGT
> ACGTGAGTCGTAACGATCTAAATTTCGCGCACTGGGATTTTAATAACAGAGAAAAAACTA
> CACATCATTTGATATAGAAATCAAGATTTTTAAAAATATTACCATTTTTTTACAGTCAAA
> CAGTTCAGACCTGCCTTACTTACCGTGTCAGGTGCTGGCGTTAATAAGTTTCTATTCAAT
> TACTGTCGACTGAAATAATTCGTATCAGTGTAATAATCTGACGTGTGAGTGTTCTTTGAT
> CACAAACCGTAAAACTTTCCGTCGCTAACGCACACACCCGGGGAAGGATTTGTAGATCGT
> TACAGGGGTATGAGCCCTATCTAACTATTCGTGCTATGGTTCCATTTTAAATCAGACTAA
> CAATAGAACAGCCATTAAGAATGTTTAGGACCGAATAGCATGACACCCCATCTTGAATTT
> ATGATATTCTCCACAATGGATACAAAGGTCTCTTCTAAAAGTGGCCTTTCATTCGTACGA
> CGCCTTTAGTTCCGGTCGAGACGAAGTTAACTGCATAAATAACTCATACATTCCAGGAGG
> TTCGCGGATTTCCTTGTCCTTATGTAAGTTTAAATTACTTAACGTTGTAAATGGAACGAA
> TAATCATTGTATACAGACGCTATAGAGTGGACGTTCGCATAGGGTATTGCGTATGATCAC
> GTTCTCTATCGGGTAAATTGATGGGGGTGTTCGATGACTGAAATTGGGCGTAATGTAAGA
> AATCATTTCAGGAATATTAATATGGGCGGTACAATTATGCATGCTAGCTCTCTCGCTGAG
> GTTGAGTATGCCTTCTAGGACCTAATGATTGTGCTATACAACCAGTATATAACCAATAAT
> TCACAAATATTTTTGCATCCAAAATCTGTTGCAGTCAATATCATTTTCCTTACCATTCAA
> CTATGCATAGTTAAATGGTTAAATCTTCATACAAGAATGGCTGGAATCCCGGGGTCGAGA
> TATATATACCAAGTTAGAGGAACGCTTATCGATTCCATTGTCAAGAAATAATAATGTTTG
> TCTAAATTTACGTCGCTCTGTGATAGACGATAGATGACTTTTTATTGCACATCCCAGCCC
> CAACCACGATTGTGTATCACTAACTGTTTAATGTTTAATTCAGCGATCTTGTTTATGTGA
> CAAGTATTATGACCGATTACAACAGCCAAAGGACGTCTCTTGTTTGGGATATACCTAGAG
> TATATCTGTAGCTGGCAACCCGTTCCTTTTAACGAATACCGGCTATTTTGTTTGCTTCAT
> CAATTAGTCAACACGCGGGCCTGACTGGCTATAGTTTACATCCTCAGTATTTTCATGCAA
> GCGTCACTACGGTGGTCGTTATATTGATAAGTTGACCAATGAAAATGACAGCTGTCTATT
> TCAGTTCTTCCCGATCAAGGAGTTGTCCTGCTCTTTGGTTTCTCGGTACCCCGTGCAACC
> AGCTTCGTTAAGTTTGTTTTCCGTTTTTCGACTAATCTAAAAATATGACGCTAAAGATCG
> TCAAGAAGCTAAAAGTGGCAGCCTTCTTTCCGGTGAACCTTTGTTTCAGTAAAAACGCAA
> GCCAGGTTACTGCCCACATGCGTAGGCTACGATTCGAGTAGGAACCCTTTCTAGCCGTCA
> TTTACTCAGATTAATGTCTTGAAAAAAAATTCTGAATTTATTTACGAAGTATAAATTAAA
> TAAAATGTTTATGCTCCTTGATAAGGACTTATTTCAATGTTTTATTCCGATCATCATGAT
> CTAGTCCAGATATAATCGTTGCTTCATAAGGTATCTGATATTCTCACTCGGCACCTCCTA
> GACACCAAGTTCAGCGAATGACACAATGATCAATGGCGATTTCATAGTGCACTCTGGCCT
> TAAAGCTGGATTTAGAGCATTACCCCCTGGGTTTTCTAACATAATTATGATTGTGCTTGT
> TGTTGGTACTATCGACTATAAATTAAAATACCTTTATAACTCGTGGTTGAAGTCAACTGG
> ACCAAATGGGCACTACAATTGTTAATTGTCTCCATAGTCGGATTCTAACTAATTGTGCAT
> GTCACCATCAATTGCGGACCTGCAATAATCAACTGTCTTAAAAGAGGCCGAAGTGACTGT
> CATATTATAGAGTCCTTTGGTGATTTTATTAATTAGATGCCAGGTTAATAGTTGGTGAAA
> GACTAACGAATACGAATCGGCTATATTGAAAAACCATTTATTAAAAGGAGGGGGATTCGA
> ATTTTGCTGTTATGCTTAGTATTTGTTGGGCAAGAGTATTGTAGTACAAGGAACCGATAA
> GAAATCATCATTATTACACGTAAAATTACGTTTCGCATAACACTGATTTGGAGAATACAT
> TCTGAGTAGGCCATATTTCTGAATAGACAAGCTCGCTATGTGCTACCATTATTCTACCCG
> TTTGTTCATTATGAGATCCGGTTAAATTATGGAAACAAAAGGTAGTTATAAAAAAGAGAT
> TTGACAACTGAAATCAGATCACTGGGTTGGCTAATCAGATTCACCCAGGGGTTTGTGGTT
> AACACAACCATTAGGAGGTGTTCATTTACATCAAATTTTTACCACGTACTTAGGAAAATC
> CAGAAGCACCTTCAAACTCTCTACCCATTCTTCGTGGGGCATGAGATGCAAATTTAACTG
> AACTCAAGCTTGACACCTCGGGTATTAGCTTCTGGGATCGATTTCGTGGCTTTTTAGGAT
> AGAGATCACCGCTAATTCCACTCGCGCTCGTTCAGCTCTAAGCTTGTATCACATCGATTA
> TTTGACATAAATAGGCGCATAGCTGTTTCATCTATTGGAGCTATTGAATTATATCAGTAC
> ATAGTCTCAATCACCCGCTCATCAAGTATCAGGTTTTTTATGGGTGATAGCGATATGCTA
> ACAAGTCATCAAAAATTGTAAGTATTCCTATTTGCAGCCCTACAGGCGACCGTCCTAAGC
> TCATTCTTACAAGTGAAATCCAAGTACGCATGCCGCTAATACTAATCTAAGGTATTACTG
> TACAATGGCATCTAGACCATATGCATGTGACATATGGACCTCTAACACTAACAAACTAAT
> TTCAGTCAAGACTGAAATTGAATAATGTTTGCTATAAAACTGAAGCGACATCCACCGGTT
> ACTAAGGGCTTGTCTACACCTTAGTTCCTCGCAGTAGAATCAATTTTTAAAAATATTTAA
> GTTTTCAGGAATGAAATGCGAGCTATGAAACGTCCCAAATTCCTTAGAAGATGTACGTTT
> GTTCACACTCGTAGCATCAGATCACAAAGAAGTTTGGATAGGTGGAATGAGCCACGATCC
> ATTATAATTATAAGATAGTTCCATGAGTATAGAGGCCTCGAACCTTATCCTTTGAGTAAT
> CACATCGTATAAAATGTTCAGCGCACTCTCCCCCCGGGATATGGTTTTGCCAGGTTACCT
> ACGCAAACTCTAAATACAAAGAGGGAGCTATATAAAATAATGAGATCTGTCATCAAAAGA
> ATTAATCGCACACCGCCAAAATCACTTCTCTCGGTGAATCGAGATTTACCTACCCTAAGG
> TAACTCTTTTGTTCTAAGCAAACATCACGTATACTTTGCTTCTGACAATTTGAGGAATAA
> TGCCTTTTTACTCCGACAACAGAAGGGGCTCCCACTCACTCTTAGAAAGAGGATTGAACA
> TGAATTTTCAGCCTCTATATATATACCTTCATAGTATTGACGGGAGATATACCGCGGCGT
> CTAGATACTCGTAAAGCCAGTGTACTTCGCAGAATCAATTCATACTCCATCTCTATGATG
> ACGAATATAGGTCAGTTCTAATGTGTGGTCTAACTTGTACTCACCGGCAATATCCCCATC
> GTGTATTTCACTCTCATTCACATTTCCATCGTTACGAAGGTAGGGCTTTTGGTAAACAAA
> GTGGACCGATATCGGATCTTTATGTATCAAGAATGAACGTCAGCAAATACATACGATGTA
> GGTTTAGGTACACCGCATGGATCTCCTCGCAGTCATGATTGAAACTCATCGGACTTTATT
> AGCCAATATTGCCAGCGTCTTATTATCCATTCTTCGGATAATCACTCTGCCGTGTTAAAG
> TCAGCACACCAAGGAAAGCCACCACTTACAAAGGTAAAGCACCATACTAGCTCAATGGGA
> GCCCATTGGCTGAAATTCACCTTAAGCATGACTCTAGATAAACCGATTGCCTTCATTTAG
> GTCAGTTAAGGAAAAGACAAGAAACTGCACTCTCATTCACGAACCCCAAGACGGGCCTTC
> AGTCCAACAGTTGAACTATGGTCTGAATAGGTATGCACTAATACACATTAGTAACACGGC
> TTATAGACGTGATGGAACGTTGGGGCATTTATCAATCGACACCAAATATTCAATGCGCAC
> ATGCTGTTAATAGTTGCATAGTCTTGACCAAACTAAACTGTATAGTTGCACATGACTCAC
> AAGAACAATTAGGCACATCCATATTTTCGATTTCTTTCAGTCTCACGAGCAGGAGAGGCT
> TGAACCAGTTAACGCGTCTTGCACATACCGATTTAGAGCGGTAGTACCAATAACGCTTTG
> CAATCGCTAGTGATGGTTGTGGACTGTAGATATATGATTTGTAAATTATCTTGTGACTTG
> TGTTATTCTTAGCTCATTGTATATTAGTCTAGTGTCGTTAACATTACGAATAGGGCTCTC
> GACGCGACCTAATAGTATAAGAAAGGCTCCACGCCTTAAGGCTGTTGTGGAAGAGAACAT
> CAGTCTAGATCAGGTCATATAAACTCTTACTATCACTATTTCGATAGATAAGTCTAAAAT
> GCACTCCAATCTAATTCTTGATTATAGCTTATATAAAGGCTCGGGTTAGCTTAAGCCTGA
> CATGTAATATGGAATTACACTGTCTATAACTGGTCACCAGCAGTTGAGGTTTGAGATTTC
> GTGAACGTGACTTTAATAGCGTAGTGTGATCCTCTCTTAGGCTCGATCAGAATAATAGAG
> CTTTACTGTTCCGTGGAATACGATTGTGTTATGTACGAGCATTACGTAACAAATCAAGTA
> TTGTAGTTATTACTATGAATATTTTACCAGCATATGTAACGAAAAACGGGTGACCTGTTA
> CTGACATGCAAGAGGGATTGCACACGAATCTAACATCTGCAGAATTCTAGACAAAACGCC
> TTGATCAGCCTAAAGATTTAAAAGCGCTCCAACTTGTATGACTAGAGAATGGTAAAAATG
> CTCGGGGAACCTCTTGGAAATAGCTGACTATCACTAACGAAGGGTGATGTTAATAATATA
> AGTTCAATAAATAACAACAACCATATTCACCGGAAAATCATTAGATTCTTAGACAATTCG
> CAGAATCACATTCATGTGGGTTCTAATTCATAAGTAATCGGATTAGTGCTATTATTCCCA
> TGGCTGACGAGTCGTCACTTGCTATGCCATAATGGAAAAGGATTGAGAAGCTTCGAATAG
> TTCTGACTCAAAATCCGCACGGGGTTTTTCTGCAGTGACGCCATGCGAGATTGTACGGAT
> GCTAACGAGGCATGATCGCTTACAGATGATGGCCGTAAACGATAGTCACCATGTAATGGT
> ATTAGTGTAGCTCTATATGAGGGATAGCATGGTGTCCCTACTACGCCTTATAACAGGTAT
> GCACGGCCGTATTCTGCGAAAGGTACTTATAACGTTTTGTCCTACAAAAGCTTCTCGGAC
> TTCAGAGTTAGCTGTAGTACTGTGATACATAGTTTTATAAACGTGAGTCCATTCGTCTAG
> CGGTTCTATTTCATCCTCAATGACCGAACTTCTCGTACTCTTATTCTTGTTCTCCGAGGG
> ATATAACCAGAGTCATAAAGTGAAGCATACAACACTACACACTCCCTGTTCTCACTGATA
> AAAAGACAGCATTATAACGGCTAACACATACACCGAAAATATCAGACTAACTGCTACTCT
> CTAATAATTAGATAATACTCCCTTAATTCATTAATCATATTTAGCGTTTCTGATGAAAGG
> CGCCATATTAGTCATTAGTGTCCGTAGTGAATTGCACCGGAGCAGTCAACCGGAATATAA
> ATATACATCGGTTATAGATCATGAGATTATTCATTGTTGATCTATATATATGAGAACGAA
> CTAGAAAAACATCATATCACAACGGGTCTTTTTTGATTGTCCATACCACGATACTACTAT
> GATTTAATTGGATATTTGCATATCTAATGAAAGTATCTGGTATAAAGTCGTACGCCGCTC
> TAACATTAGGCTGTAACAATTTTCGCTAACAAAATAGAAGACCCCTTGGAGAATAGTCCT
> ACGTACATGCAATGTCCTCTATCCTCATTGGCGCAAGCATCATTAAGTGAGGGATTTACA
> TACTTAGGAAAGCTTGTGAAATAATTAGACTTCACGCTGGATAAGAAGGCCTGATGCTAT
> TTGTTCGTTGTACAGTTACGATGTGATGGCACCAAAAATTTCTCAGACTCGTGCAGCAAG
> ACTTTTTACCGCAGACACCACCAGATGACGCGGTAGAGATATCCATACGCCGGATTCCAG
> TGAAGTATGAAAGAAATTCTTATCTACACTGACAAGAGTGATCCGACTTTAAGTTCCTTC
> CCACACTCACGCTTCGTGCACGTCCTTTGGAATAAAGTAACTTTACAACATAGATAAGGT
> GTGTTCTAAATTCAGCGACTTTATATACGTTATAGACAAGCTTCGGCCGAAAACGGAGAC
> TTCATCGGACTATTTTACTTGGATGATGACATTAGTTTCACTGAGAAAGTAGTTAGGACA
> TCAGACCCAAAACACAAACATCTAATCTAATGGATGTTAAACAAATTCGGACACGAAAGA
> AAGTCACGCTCGCCCAGACTCATCCCACCCCCACGTTGGCAACAAAAGGCCTCTATCTAC
> GCGTTCTAACTCTAGCTATGGTAGACCAACGCAAGCCGATCATTTTCTGACTTTACAACC
> CTATCTGTTTAATAGGATAGGTAATCAAAGTCGATAACTAGAAGGAATTGTTCGATCCAG
> GTGGGATGTCGGCACTACAGAAAAAGACGATATGAGTCATCTTATCCACATCACTTGTCG
> CGAGAGTTAAGTTAGTCAATTAGCTCACACTATTTATTACTTGTGGAGAATACCTTTATG
> TTCTACTTACTAACATTATTGCAGCCTTTGCTGTGTAGCTTAATAGTATATTAATATTAA
> TTACCGCACTCTCCCGCTTTACTAAACACAAGTGCTAGTCACTTTTCTTGCTACAAAGCA
> TCTCATACGATCGGTTAAAGCAGGATAGCTATTCATATCTTGCCAAGTTTCAGTTTTTAA
> TCTTTATGGTTGACGAAAGCTGGATAATAGTTTCTTAACGACTGATTATATTCTATCTTA
> ATGTTAGCACGAAATAACCTGAAGTCTATAAGTGAATGTTGCAAATTGGGAAACGATCTT
> CGTTGCTCATTACGAATTTAAAATGTCGACCTATGAGATAGGACAGGACTCTATCATGTT
> AGGGTAGTAAGAATCATTATCTGTACCCTTCGGTGTAGGCCTGTATTAGTAGATCAATTC
> AACCGTTAAGGTTGCCACTAAAATCAGTTGCTAACTTAAAGGATGTTGTAAACTTTTTTT
> TGACGATTTCAAAATATCGTTTACTGTGTACGCCTCTACCTTTACTAGTGGTCTTAAATT
> ACCCCCCGACTTAAGAACCCTAAGAATAACGTCATCTCTTACATCTACAAGCGTGACTGT
> AACTATTCCTATCGATACAATTGGTCGAAAATGTAGGAGAAATCCTCACAGCCCTTTGCT
> ATCGACGATTAGGCTAGACCAGTATTGCTAATATCTTTAGCCCCTAAAATTCAACTTTTA
> TGGACTATACGTATTATCGTTACTAGTCTATCCGTAGTGACCGATTATTTCACAGGTGTC
> TGGAATTATTATTACTCTGGTGTGACTTCTAGCGTTAGCAAGGAATCGGTAATAACCTGA
> ATATCGATAAGATATTTATGCAAATCGACCACTTTTGTCGTATAGATACGCACTGTGAAG
> TGAGACTGCCAATTCTAGTTTTAAACTTCATGGGATATCGACTAGCGCCACGTTGGAATA
> TGAAGCTGGTGAAAGACCGTTACTCTAATTTGCAGATTAATGATCCAAGTTATATGTAAT
> AGTTAAGTCCTTACAGGGAAAGTCTTTTCTTTTTGTCGGCGATCCATCCAAGCCTGGCTA
> CTGTCCAATATGCGACATTAATGTATAACATGATAAGACGCTAGGAGCTAGAAGCAATAA
> CATAGTGGCGGTCTATTAGCACCAGTTAAACCGCAGAGCTAGTTTACAGGGTCCTCTCGG
> AGATCTATACCGCATATAGATAATGGAAACCGATTAATAATAACGATTCTATTCTTTGCA
> TTCAACGAGACCTAAAGCTATCCGTTCATGTTTGTCTCGTCCATTGAGTGTCGGAAAAAG
> TAGAATAAGCCCCTTTTAGGTTAGGATCTTTGAGAACTGGTTACCGACGTTCCTCTTGCG
> TACTAGAAACGTGCGGGTTTTAACAATGCCTATTTCTCTTTGATTTACACCATGTTCGCA
> CCCCCTTGGGCAATCCTATTGTTTCGAATCGTTCTTATATTAACAACTAGGGTTTTAGTA
> ATTTCTTATTGCCTTGCCCCTACCGCTCACCCTTTAGGAAACGGATCTCTATACTGAGTT
> GCTGGTCTACAAGCGTATTAACGATTGTACATGGAAATTCCAATCGTATCTCAATAAGTC
> TCTCCCTGTAACCCTTCCCTGCTTTGAAGAAATAGGAATGTAAGTCACAACTGCAAGTTT
> GAAGAAAGGCCGCTTAGTAGTAACCAAATCGGGTACGTAGAATAAACGTATCCCCTGCGC
> AAGAGAGCCAGTCTTAATTAGCGCACGAGTCGCACAGGATCTACAAAAGAGCCGGATCAA
> TAACTATAAGATGCCACGAGTTACCCAATATCATTGATTACCTAGGAAAAGTTAGTCTCG
> TTGAGTGTCTGAATAGACGGAAGGAAGTCGTGTGTTGTAACATGCCTCGAGGACTTCAAT
> TGGTATCCTTCGATACGCTCCCAGGGTACCGGGTTATACAATTCAGACAACATGAGAATT
> AATATATCTTTAGTAAAAGTAAAAGGGTGGATTAGTAATTGTGGTGAATTTGGATAATGT
> TCCTCCTGCAGTTATACCATGTGATACGATTTACACGAAACATCTCTGAGGTGTACCTAT
> ACTAAGCTTCTTTCTCTTGCAAAATACATAGAAAAGAAACAACACATTGTGAAGTGCGTT
> ATTACCGAGAAAGTCACTTGTATATCAATAGAGGTATTCCACACAGCGGACCAAAAATCA
> TACATCTTGATGCAGCACCTCGTTACCATCTAGATAACTCTGTTGCCTCGTTCCAGGATA
> CTAGTGAATTTTAGTCCTATCTTTTCATTACCGCTAAGTGTTTCTATTTATTTTAAAATT
> TAAGGTCGGATACGGTCGATTAACTTTTTTTTGTTTGCTTCCTTGCCTATAATGAGGGGT
> GTGCTGTGAATGTGTGGTGCACATGAGGTAGGCGCATTCCACCGCACCGACTTAAATTTC
> GTTTTTGTTAACGATAGTTTTGATTATTCCAACGTTATAGACAACCCGATCCACCCTGAC
> TACAACTCTACCATATGTCTTATTTTTAATTATAATAATAACATAATGGAAGCAAGAACG
> CTACCAGTTAGTATAGCCTCCTGTTGTTCCCGCAACCAACTAAAGTAAGCATTAACGAGT
> GCTTGCATCCCATGCTAAACCATATCACGTTCGTTTTCCCACGCCCGTAAATAAGATTTA
> CCAGCCCTCAATGGTCGACAATACTAACATTTCAATGTTAGTCCATTGATCACTTATTTT
> ACTCCGCTTAGGCCCGTATATATATGGAGGTCGCTTTTCATAGATCCAGAACCCTACATT
> CCTTTAGTAGTAACTCGTCGACAGGAGTACGCTTAAGGTACCGCCACAAAAAGATCATCT
> TCTTACTTATTCATTTATCATGTAGAGGGCGAAATATTACCCCCCCCGCCTCATGATCTT
> GCGCACACTTAACGACTATCCGCTAACAAACGTGTTATTTGGATGTAAGCAAGTGCCAGT
> CAATGATATGACAGGTCCGCATAAAGAACCATCGAGACGTCTTTTAGTTGGCGATAGACA
> CTTAGTTAACTCGTACAGATGACAATAGTTCATTTGACGCTACATTGACCCGAAATAGCC
> TATAAGGCACGACAAAGCGACTTGTAGAGTTCGTCGATCCTACTCCCTCAGGACAATAAA
> ACGGAATTACTTAGGATCTGCTGATGTGACCTACGCGGGCTCGTCTGGGGTGAGGGCTTC
> TTAAGCACATCGTACTTGTTCGCCGTACCTAGAGCCAGAATACACACGGTAGTTTAGTCA
> ACATATAATTACCGATGTACCTGGTTTACGATGTGTCAATTTGGCGACAGATGCGGAATC
> GACAAGACCAACAATCTGTCTTGAAATTGTGAATGATGTTTAGCACTTAAGGACCCATAT
> TGGATAAAGCCTTAATTTGGTTTTAGAAGTGTCAGCACATGCATACGCCACGACATAAAA
> CATGCCCAGAGTACGACCTAGTTTCACTTTAGGTCACAAAATTTGTTAGGAACCTGTTCA
> ACCTGATCTTAATACGCAGTGTACGAATGCTCAGACATAACCAGATTTTCGGTAATCGGG
> ATCTTAAACGACTTTAGCATAATTCTGTCAACATCGAGCGGTTACCCCATGGACCCAAAC
> GGGTAAGTGCCGTTAGGCAGAGTAATAGTACATGTTACCGATTTATTCAAACGTAATGCA
> CCGAGTTTGGCACGAGCGCTCGAATGTTTATTGTCTCTTCGGTAAACCAAGCTAGTTATG
> ACAGGCTTATCATTAATACGTAGGGGAGGTCCTATATCTACCCAGCTGTTACCCGAATTT
> CCGCGAGATGTCCTATCCGGTCATGAAAATAACAGGTGTGTCGATTAGCACGGCCAAAAA
> TTTGATGAGTCCTTTGACAAGCTTTTCGAAGAAAAACGTCCACCTCCAGATATGAGCGGT
> TTCAGTGAATAATCCTTATTGATTGATAGCGATCGTGTCCGCTGAAGAGGTTCTGGGTAC
> CTTGGAGTCTTCTAAAGTTATACTTACGAGAGATTTGACTTTCATGCAGTTCAACTGCAG
> TTGTCAATTCTTCCACCGGATAATTGCCGCCTACAACGTCGTTACCAATAGGAACTATTA
> TGTTCCAAGTGCCGTTAATTTACAGTTCTCGCAGAGATATCCAGTTATATTGTCGGACAA
> ATATAGGCAGCTAACAGCAAAGTAAGTTTGTTAATTAACGCTTGTAATGTGCAAAAATTA
> TACTATGAAGTTGTCAATTTGGTTTTGTTTAAAGAAAAACCGAGACACTCCATTGCAATT
> CTCAGCGGATGTACGCAGTAATTTCCAGTGGAGGAGGCATTTGATGATCTATTACATTCA
> GGTTACCATCGCCTTAAAATCAACCGCAATCCCGCCCTCCGTGGATATGGCAGCATTTAT
> TCGTCCATTGGGTGTGCCAACTACGTTCCCTACCCCTCGATTACCCTTTCCCCTGTCCCT
> TTACCCTCTGAGGTGTGATAGGGGACGTCAGGCGGTTCCTGCGATATTGACAGAACTCCC
> AGTGTATTAAAACAGAAATAACTTCAAATCTGTTCATATACATATCAAGTGGTTTAAATT
> GATTACCATGTTTTTAAAGTCAAAAAGTGCACTCCTCACTTAATGAACGTGTCTGGTCCT
> CCCGTTAAGAAGTGTCGTTTCAATTTATGGAGACTGAATTAAGTCGTATAACTGTAATTT
> GCTCAACTCTCACTGTGCTTTGATCAAAAACCGTAATTCTTTAAGTCGCTTACCCTCACA
> CACCGCGATGGATTTGGAGTGCGTTACACCGCGATCTGCAATATATAACTATTCCTGCTA
> TGGGGCAATTGGAAAGATCTCGTTCAATACTACACAAAGTAAGTTTGTTTTGCAAACTAT
> TGAATGTCAAAACATCTTCATGTTATGATAGTCTCCACAAGCCAGAAAAAGGGCTCTTAG
> TAAACTGCACTTTATTGAGTACGTAGCCTTTTGTTCCCGTCGACTCGATCTTTTATCATG
> TAAGAAATAATAAATTCAAGGTCCTTAGCGCATGGAATGCGCCTTATGTTAGTTGAAAGG
> ACTTAAAGTGGTATATCCTTAGATTAATAATGGTAGAAAGACGATATAGACTCCACGGTC
> CCAGTCGCTAGGCACTAGCATAACGGGCGCTATACGGTTATGTGTTCCCGGTGTTCGTGC
> AATCAAATTCCGCGTTATGTAAGAAAGAATTGAACCAATATTAATAGGGGCCGGTCTATT
> ATGATTCATTCCTCGAGCCCTCACCTTGAGTATGCCTTCTAGGACAGAAGCATTCTGATA
> TAAAAACAGGAGATATAAAATAATTAACAATGAGGTTTGAATCAAAATTATGTTCCTGTC
> AATAGCAGTGTCATTTCCTGGCAAATATCCATAGTTTAAGCCGTAAATCTTATTAAAAGA
> AGGGCTGGAATACAGGCCTCCAGATATAGATACAAAGTTTGTCCAAACCTTAGCGTGTCC
> AGTCGAAAGAATGAATTATGTTTGTCTAAATTTTCCTCCCTCTCGCAGACAAGATTGAGG
> TCTTTTGTTTGCACATACATGCCCCATACACGATGGGCTATCAAGATATGGTTAAGCTTT
> AATTCTGCGATCTTGTTTATCTGAATAGTTGGATGAACGTGGACTACAGCAAAAGGAACG
> AGCGTGGTTCGCAGAGAACGACAGTATTTCGGGAGATCGCAAAAAGTGCAGTTTAACCTA
> TAACCCATATTGTGGGGCCTGAAGAATGTAGTCTACACGCCCCACTCTCTGCCTATTCTG
> TAATTCCTAACGATTTTCATGCAAGCCTCTCTAAGCTCCTACTTATATTGTTAACTTGAA
> AAATGAAAAGGACTCCTGTATTTTTCTGTTCTTACAGATATTGGAGTTCGCCTCCTCTTG
> CGTTTCTAGGTACCCAGTCCTACCAGATTACGTAACGTGCTTGTCCCTTTTTCGTATAAG
> CTTAATAGATGACCCTAAAGATCGGCAACATCCGATAAGTCGCTCCATTATGTCAGGTCA
> AAATTTGTTTAAGTATAAACGCAAGACAGCTTTATCACCACATCACGACGCTACCAGTAG
> TCGAGCAACCATTGCTACCCGTAATGGAAGCAGTGTTTTGTCTTGTATAAAAAGGCTGAT
> TTTTGTTACGATGGAGAAATGAAATTTAAGCGTTAGCCTCATTGATATGGAATTTTGTAA
> ATGGGGTATTCAGATCATCAGGATAGTCTCCACAGTTAAGAGTTGATTAAGTAGCTATAG
> CTTATTCTATCTAGGAAAATCAGAGACACAATCTTCAGCGAATCTCACAATCATAATTGC
> CGTTTTCATACTGCTCTCTCCAATGAAACCTCCTTGGACTGCAGTACCCCCTGCGGTTGC
> TAACTTAATGAGGATTCTCCTTCTTGTTGCTAATAGCCAATATTATTGAAAAGTCATTTT
> TATATCCTCCTTCTTGTATTATGCACAAAATCGGCACTACAATGGGTTATTGTCTACAGA
> GTACGATTATAACGATTTGTGCATCGCACCATCATTTGACCACCTCAAATAATCAACGGT
> CTTATAAGACCACCAACTCACTCTAATTTTTGAGAGGAAGTTGCTGAGGGTATGAATGTC
> AGCAAACCTTAAGTGTTGGGGAATCACTAACCTAGACCAATCGCCTATATTGAAAAAAAA
> TGTATGATAAGGACCCGCAGTCCAATTTGCCGCTGAGCATTACGAGGTGTTCGCCAACAC
> TATGCTAGTAAAAGGATCCGATAAGAATTCATCATGTTTTCTAGTTATATGACCTTTCGA
> ATAAAACGCATTGCCTGAATTCAGTATGTGTAGGCAATATTTATCTTTTCACTTCCTACA
> TTGGTCAGACCATTATTCGACACGTGGCGTCATTTTGTCATACCGGGTAATGTTGGAAAC
> AAAACGTACTGATAAAATACTGAGTTGTAAACTCTAATCAGATAACGCGCTTGGATATTA
> AGATTCACACAGGGGTTTCGGCTGTAAAAAAACTTGTGGAGCTGTTCTGGGACAGATAAG
> TTGTACCTCGTACTTAGCTAATTAATGAACCAACTGATTACGATAGAACAATTCTGAGGC
> CGCCAGGACAGCCAAATTTTAATCTTATAAAGCTGGAAACAGCCGGTATTAGCTTCTCGC
> ATACTTTGCCTGCATTGGTACCTTACAGATATCAGCGTAGTCATATACACCTCGGTCTCA
> GCTAAGCTTGTATCTCTTAGAGTAGTTCAAAGATAGTGGACAATACCTGTGGAATCGATT
> GCAGATATGGATTTATTTAACTACTGAGTCTCATTCACAAGCTAAGCAAGGAGCACGTTT
> TGGTGCCGGCATACCGATTTGCTATCATGTCAGCAAATTTGCGTTGTATTCCTAGTTGCA
> CCCATTAAGGCCACACTCCGAACCTAATTATTACATCGCAAAGACATGTACGAAGGACCC
> GATGTCGAATAGAAGGGAGGACTGTTCATTGGAAGCTAGACCAGAGGAATCGCAAAGATG
> CAACTCTTACAATAAAAATCTAATTTCAGTCAACACGCAATTTCTATAAGGTTTCCGATA
> ATAATGAACCGTCTTCCACAGGGGAATTTGCCATGCTCGTAAAAGTAGTTAATCCAAGTA
> GAAGAAATTTTGATAATGTTTTAAGTTGGCACGAAGGAATTCAGAGAGATCTTACCTAAC
> AAAGGCATTAGTAGATGTTCCTTGGTTCACACTCGGTCAATCAGAGCACATACTACGGGC
> GATACCGGGAATGACACAACATCAATGAGATTGTTAAGTGAGGTAATTGACTTTAGAGGA
> CTCGATCAGTATACTGTCACTATGAACATCGTATTAATTGTTATCCGATATATACACCAC
> CGATTTGCTTGTGCAAGGTTACAGACCCATTCGATAAATACAAACACGGAGCGATATTAT
> TTAAGGAGTGCTGTCTTCAAAAGAATTATTCCCACACCGACATAAGAACTTCGCTCCGTC
> ATTCCAGATTTAAATAACATAACGTAACGCTTTGCTGATAACATAACATAACCGAGAATT
> TGCTTAGGAAATTTGGAGCAATATTGCATTGTTTCTCAGTCATCACAAGGCCCGCCAAAG
> AACTCTGAGAATCAGGATTCAACATGATTGGTAAGACTCTATATATATAACTTAATTCTT
> GTGTCCGGAGATAGAAAGAGGACGAGAGATACTACGAAAGAAAGTGTACTTCGATGTATC
> AATTCAGACGCCTTCTCTATCATCAACATTATAGGTCTCGTATATGCTCGGCGCGATCTG
> CTTCTCTCCGCCAATAGCCCCATAGTGTATTTCAAGCGCAGTAACAGTGAAATCGTTACG
> AAGGTAGGGATGTTGCTTATAATTGTCGTAACTTATCGCTTATGTATCTTTCAAGAATGA
> ACGGCAGCATATACATACGTTCTACCTTTAGCTACAAAGCATCCATATACTCCCTCTCAT
> GATTGAAACTCTTCCCTATTTTGTAGCCAATAGTGAAAGCGTATTAGTATAAATTCGTCG
> GTTTTTCACTCGCAACTGTTATACTCTGCAAACAAACGAAAGCCTCATAGTACAAACCTA
> AAGCTACATACTTCATCATTGGCAGACCAGTGGCGGTATTTCTACGGAAGCATCACTATA
> GATATAAAGTTTCCCTTCATGTACGTCTGTTAACCATATCACAAGAAACTGCTATCTCTG
> TCACGTAACAATTCACGCGCCTTATCGCCAAATGTTCATATATGCGCGGTATACGTATGA
> ACGAATACTAATTAGTATAACGGAGGATTCACGGGAGGGATACTTGGGGCATTTATAAAT
> CGTCTAAAAATTTTCTATCAGCACTTGCGGGTTATAGTGGATTACTAGGCAACATAATAT
> TCTGTATTGGTCCAAATGACGCTATAGATAAATTAGCAAAATACATTGTTTCCATTTATG
> TAAGTCGAAACTCCAGGACTCCCGGGAACCAGTTAAACCGTCTGGAAAAGACACATTGTG
> AGCGGGACTTCAATGATAGCTTTCAATGAGCTTCTCATGCTTGGGGTCTGTACATATATG
> TTGGCGAAATTATCGTCTGTATTCTGTTATGCTTTGATCATGGGTTATTAGTATAGTGTC
> CGGTTAAGTACCAATACCGCTAGAGACCCGACCTAAGTCGATAACTAACGATCATCGACG
> TAAGGATCGTCTCGATCAGTACTTCAGTCTAGATCTGGGAATAGTAACTCGTTAGTGAAC
> TATGTCGTGTCATAACTCTAAAATGCAATCAAATCTTATTATTGAGTATTGATTATATAA
> AGCATCCGCTTAGCTTTACCCTCAAATGTTATATGCAATTTAAAGCGCTTGATATCGTCT
> ACTCAAGTTCAGGTTTCACATGGCCGCAACGTGACGTTATTAGAGGTGGGTCATCATCTC
> TGAGGCTAGTGATGTTGAATACTCATTGAATGGGAAGTGGAATACCATGCTCGTAGGTAA
> CAGCATGACCTATAAAATATACTATGGGTGTGTGGTAGATCAATATTGTTCAAGCATATC
> GTAACAATAACGGCTGAAATGTTACTGACATGAAAGAGGGAGTCCAAACCATTCTAACAG
> CTGATCAAGTCGTCTAAAAACGCCTGGTTCAGCCTTAAGAGTTATAAGCCAGACAAATTG
> TATCAATAGAGAATCCGTAAATTCCTCGGCCAACCTCTTGCAAAGACATCACTATCAATA
> TACTACCGTGATCTTAATTAGTGAACTTATATAAATATCTACAACCAGATTCAACGGAAA
> AGCTTTAGTGGATTAGAAATTGCCAAGAATCACATTCATGTGGGTTCGAATGCTTTAGTA
> ATACCATTTCGCCGAGTAGTCACTTCGCTGAACTGTCGTAAATTGCTATGACATAATCGA
> AAAGGATTGTCAAGAGTCGATTACTGCGGACTAATAATCCCCACGGGGGTGGTCTCATGT
> CTCCCCAGGCGAGTGGGGACGGTTGATAAACACGCTGCATCGCGGACTGATGTTCCCAGT
> ATTACATAGTCACATTGGATTGCGAGTAGTCTACCTATTTATGAGCGAGAGATGCCTCTA
> ACTACTTCGACTTTTAAAACCTTTCCACGCCAGTATTCGGCGAAAGGGAAGTATTAAGGG
> TTGTCATAATTAAGCTGATACCACTTCAGACTTTGCTCTACTTCTGTCTTTCATTGGTTT
> AGTAAAGTCTGTCCATTCGTCGAGACCGTCTTTTGCAGCCTCATTCTACCAACTGCTCCG
> ACTCTTAGTCTGCTTCTCCCAGCGTTATAACAAGAGGCATTTTGTCATCCTTAAAACAAT
> AATAAAGAACTCGGAGCACTGATATAATGACTGAATTAGAACCGCTTAAAAATACAACGA
> ATAGATAAGACTATCGGATAAGATCTAATATGTAGTGATTAAGCCCTTTATTAATTAATA
> ATAGTTACCCTTTCTGATGTAACGCGACATATTACGATTTAGTGGCACGTCTGAATTGCA
> AAGCAGATCTCTACCCGATTTTTATTATAAATCCCGTATACATCTTGACTTGAGTAATTG
> TTCATCTTTTTATATCTCTTCGTACTACAAATAATTAATATCTCAACCCGTATTGTGTGA
> TTCTAATTACCAACAGAATACGAGGAGGTTTTTGCTTAGGGCCATATATAATGAATCTAT
> CTCGTTTATTCGCGGAACCCGAGATAACATTACGATGTAACTATTTTAGAGAACTTAATA
> CAAGAAACATTGCTGATTACTCATAACTAAATGCTTGGTAATATATCCTCAGTGCCCCTA
> CCATCTTTTACGCAGGGATGTAATTACTTAGGATTCATTGTGTAAGAATTACAATGAACG
> ATGGATATGAAGGCATGTTGCGAGGTGTTCCTTGGTATGTGAAGTTCGCAGGGCAACAAA
> AATTTCGCAGAATAGGCCTCAAAGTATTGGTAAAGAAGACAACTAATCATCACGAGCTTC
> TGATATCAATACGAACGAGTCCTGTGATGGATGAAAGAAAGTCGTATCGAAAATGTCAAG
> AGTCTGCCCAATGTAACTTACTTCAAAAAATAACGCTTCCGCCAAGTACGTTCGAATAAA
> CGTAATTTTAAAAATACATAAGGGGTGTTAGAAAGTAAGCGACGGGATATAAGTTAGACT
> CAAGATTCCGCCGTAAAACGAGACTGATTCCGAAGATTGTTCGTGGATCTGGTCATGACT
> TTCACTGAGTAAGGAGTTTCGACATATGTCAATAAACACAAAAATAGAAGCTATTCGATC
> TGAAAAATATTAGGACAAGAAACTATCTCACGCTAGCCCAGAATATTCACTCACCCACGG
> GCGATACTAAAGCACTATATAGTCGCGTGATTACTATACATATGGTACACATAAGAATCA
> CGATCAGGTTCTCAATTTTCAACAATATATGTTTATTTGCATAGGTAATATTAGGCCTTT
> AAGAGAAGGATGGGTGAGATACTCCGGGGATGGCGGCAATAAAGAAAAACACGATATGAG
> TAATAGGATCCTAATATCTTGGCGAGAGACTTAAGGTACGAATTTTGCGCAATCTATTTT
> TTACTTGGCCAGAATTCATGTATGGTATAAGTACGAACTTTTTTGATCACTTTCATGGCT
> ACCTGATTAGGATAGTTTGAGGAATTTCCCAAATATACCGATTTAATATACACTAGGGCT
> TGTCACTTTGAGTCAGAAAAAGAATATAATTACTTAGGGTAATGCTGCATACATATTCTT
> ATATTGCAAAGGTTCTCTGGGTAATCTTGAGCCTTCACGATACCTGGTGAAGTGTTTAGT
> AACGAATCATTAGATTAGATCTGATTCTGTGCAAGAAATATCCTCAACTATTTAACTCAA
> TGTGGCTAATTGCCATTCGATATTCGTTGCTAAGGACGAATGTTTTATCTCGAAATTTGT
> CAGACGACACGTCTATATAATGGTTGCGGAGGAAGAATCAGGTGATGGTCCCTTACCTCT
> ACCACTCTATTACTAGAGCAATTAAAACGTTAAGCTTGCCAATATAATAAGGTCATAACT
> TTATGGTTGTTGTTAACTTGTTTGGCTAGATTTAAATATATAGTTTAAGGTCGAACCCGC
> GACCGTTACTACTGCTCTTAAATTTCCCAACCTATTATCATCCCTTAGAATTACGGCATC
> TCTTTCTGCTAAAAGCCTCAAGGGATATTGTCCTTGAGATACAAGTGGTCGAAAATGTAG
> CAGAATTAATATAACAAATTTCCTTTCGAACTTTACCATTCAACACTATGGCGAAGTGCT
> GGACCCAATAAAATTCAAATTGGATGGTCTATTCGTTGTTTAGTTTCTACGCTATCCCGT
> GTCAAACATGTTTTCACAGCGCTATCGTTTTATTTTTAATCTCGGCGCAATGATACCCGG
> AGAAAGGAAGCCCGTAGATCATGAATATCGAGTAGTTTTTGATCCAAATCCAAAACTTGG
> GTACGAGACATAAGCTCGGTGATCGCTCACGGACTAGTCTACTGTTAAACTTAATGGGAT
> AGACACTAGCCCAAAGTTCCAATAGCTACATGCGCAAAGTAAGGTTAGCGATTTTGCTGT
> GTAATCAGACAAGTGATATGTAATACTTATGTCAGGAAACCCAATGTAGGGGCTGGTTCG
> CCGCCTTCCATACTACACTGGCTACTGTAAAATATGAGACATTAAGCTATTAAATCAGAT
> GACGCTAGGAGCGACATGCATGAAAAGAGTGCCGGGATATTAGCACCTGGTAAACAGAAC
> ACATAGTTGTAAGGGTAAGCTCCGAGTTCGTGACAGCATATTGATTAGCGAAACAGATTT
> AGAATAAACAGGATATGCTTTCCATTCAACCTGTCATTATGCTATCAGTTCATGTTTGGA
> TAGGAAAGTGACTCTCGGAATAACTAGAATATGAACCTTTTACGTTAGGAGATGTCTCAA
> CGGGTTAAACACCTTCCTCGTCAGTAATAGATTCCTCCGGGTTTTAAAATGGAATTTTTC
> TCTTTCATTTTAACCAGGTGAGCACACCCTGCCGCAATACGAGGGTGGCCAATACTGCTT
> ATAGTAAAATATACGGTTGTACGTATGTCTTTTTCCCGGCAAAAGTCCGCTAACAAGGTA
> GCAAACCCATCTAGATACTCACGTGCTGGTCTACAACAGTAGTAACGAGTCTACATCCAA
> ATTCAAATCGTATCTAATTATCTCGCGCCATGGATACAGTAACTGCGTTGTAGAAATACG
> AATCTAACTATCATCGCCAAGTGGCAAGAAAGCCAGATTACTTGTAACCTAATAGGGGTA
> GTTGTAGAAAACTATACACTGAGAAAGACACCCACTATTATTTTGCCAACCACTCCCAAT
> GGTTCTTAAAAAGTCAAGCATATTTTACTATAAGAGGAATCCTCTTACCCATTAGAATGG
> ATTACATAGCAAAACGTAGTATCGGTGACGCTATGTATAGACGCATGGAAGTACGCGGTG
> GTTTCATCCAGCCTGGACTTCAATGCGTTTCCTTCGATAAGAGCACAGCCTACACGGGTA
> TACATTGCAGACAACATCACAAGTTATATATCGTTAGTAAATCGATAAGGCGCCATTACT
> AATTCTGGGGAATTTGGTTAATCTTACGCCGCCTCGTATACAATGTCAGTCGATTTTCTA
> CAAACATATAGCTCGTCTTCAGATACTAAGATGCTGGCTCGTCAAAAAGAAATACATATC
> TAACAAAAATGTCTCTACGGCGTGTTTTCAGACAATCTAACGTCTATATCTATTCAGGTA
> TTACACACTGCCGTCATATAATAATACTTCTTGATCAAGCACCTAGTTAAAAGCGTCTTA
> AAGCTGGGCAATAGTTCAACCAGTATACGGTTGTGTACTAATATATTTTATTTACCGCGA
> AGTCTGTATATGTTTGTTAATAGTTATGCTACGATAAGGTAGATGAAATTTGGTGTGTGT
> GATTCAGTCCATATATTCAGGGGTGGGATGTGAATGTGGCCTGCAATGGACGTAGCAGAA
> TTCCTACGCACACACTTAAATGTACTTTTTGGTAACGATACTGTGCATTTTGCAAACGTT
> TGTCACAACACGTTCAACCATCTCGTCAACTCTAAATTAGGTAGTTTGTGTAAGTTTAAG
> AAGAACTTAATGGAAGCATGAACGAGACATGTTACTAGTGCATCCTGTTGTTCAAGAAAC
> CTAAGAAAGTAAGCAGTAAACTGTCCGTGCATCCAATCATAAACATTAGAAACTTCCGTT
> TAAATACCAAGTAAATAAGTTTTTCCTCCAATCTATGCTCGACAATAAGAAAATTTAAAT
> GTTAGTAAATTCTTATCTTATTTGTATCCGCTGTGCAACGTATATAGATGGACCTACCTT
> TGCATAGATCAAGATCCATACATGCCTTTACGTCTAAATCGGCGACACCACTACCATGAA
> CGTACCGACAAATAAACATAATATTCTTACGGATGCATTTATAAGCTACACCGAGATAGA
> TTAACACCACCGACGAATGATATTCCGCTCACTGAACCACTAGACCCTTACAATCCTGTG
> ATGTGCAGCTAACCATGTGCCAGGAAAGGTTATGAAAGGTCCGAAGAAACAACATGAGAG
> AAGTATGTGTGTTGCCCAGAGTATCTTTGTTAACGCCGTCAGATCAAAAGACGTCATTTG
> ACCATACTGTGTCCACAAATAGACTATAACGCAACACAAACACTAGGCTACACGTAGTCG
> AGACTTCTAACGAAGCACAAGATTTAGCTATTTCTGAGGATCGGCTCTGCTCACAGTACA
> GGGATCGTAGCGGGTCTGGCATTAGTATCAAAATACTACGTGTTCCACGTACCTTGAGCC
> AGAATAAACAAGCTAGTGGACTCAACATTTTTTTACACATGGAACTCGTTTACGAGCTGT
> AAATTTGGCGAATGATCAGGAATCGACATCTCAAAATTTCTGGCTTCAATTGGGGATTGA
> TCTTTACCTATGAAGGAACCATTTTCGTTAATGACTTAATTTCCGTTTTGAAGTGGCAGC
> AAATCAATAACCCTAGACATATTACAGCAACAGAGTAAGAACTAGTTTCACTGTAGGGCA
> ATAAAGGTGGGACGTAACTGTTCAACAGCATCTTTATTAGCTGTCTACCTATCAGAACAA
> ATAACAACTGTTTACCGATTACGGTGATTATAAGACTGTTGATTAATGATCTAATATGCG
> AGACGGTAACACAGGCTACAATAACCCTAAGTGCCCTGAGCAAGAGTATTAGGAATTCGT
> ACACATGGATGATATCGGAATCCTCACACTTTGCCACGTGCGAGCGATGGGGTAGTGTAG
> CTTAGCTAAAACATGATAGTGATGACAGCATTATCATTTTTACCTACGCGACGGACTATT
> TCGTACCAGAGGTTAACCGAATTGCCCAGAGATGTCAGATACGGTCATCAAAATATCACG
> TCTGGACTTGAGAAACCAAAATTAGGTCATCAGTCCTTTCACTAGCTGTTCGTAGAAATA
> CCGCATACGACACATTGCTGAGGTTGCAGGCAATAAGCATGTGTGAGTGTTTCCCATAGG
> GTACCATCAAGACGTTCTGGCGAAATGGGAGTAGTCTAAAGGTATTATTAACAGAGAGTG
> CACGTTATGCCACTTCTACTCCACTGGGAAATTATTACTAACCATTTGTGAAGACTTCAT
> AGTCGGGAACTAGACGTTAGATTAGGTGACTACTGCCGTGAATTGACAGTTCTCGCACAC
> ATAGACACTTATTTTCTCGGTCTATTAGAGCATGCTAACAGATATGTTACGTTGTGAATT
> TAAGCTTCTATTGTCATAATATTATACTTGGTACTGGGCTATTTCCTTGTCTGGAAACAA
> AAAACGTCACAAGCAATTCCAATTCTCAGACCTTCTTCGAACTAATGTCAAGTGGAGGAG
> GAATGGCTGGAGCTTTTACATTCAGCTGAAAATCGAATTATATTCTTAACAATTCCCCCC
> CTCCGTCCATATGGCTGAATTTATTACTACTTTGGGTCTGCAATATAACGTCCCGTCCCA
> TCGATTACAATGGAACAGGGCCAGTTACCCTCGCTGCGGTGATAGGGGACGTCTCGACGT
> TCCTGAGATAGTGACACAAATCCCAGGGTATGAAAACTGTTATTTAGTCTAAGATGTGCA
> TATACATATCTACTGGGGGATTTTGTTGAAAATGGTTTGAAACGAATTAACTGAACTAAT
> CAAGTAATGAAAGTCGATGCTCATCCAGGGATGATCTGTAGTGTCATGTTATCGACAAGC
> ATTTTAGGAGTATAACGCGTTGTTGATCTACTCTCTCTCGGAGGTCTGAAAATTACCTAA
> TTAGGGAAGGACATTACCATATAAAAACCCCTTGCATTGCGTGTGACTTTAACCCCGATC
> TCAAATATATAAATTTTACTCCTAGCCGGAATTGGGATAGATCTCGTTAAAGACTTATCA
> AAGGAACTTTGGTTTGCTAACTTGTGAATCTCTAAAAAGAGGCTTGTGATGATTGGCTAA
> TAAAGCCTGTAATAGCGATCTTAGTTAACTCCAATTGATGGAGTAACTACCAGGGTGGTA
> ACCGAGTCTCCATCGTTTATCATGTATGAAAGAAGTATTTCATGGTCCGTACCCCAGGGA
> ATGCGAAGTATCTTTGGGGTAAGGACTGATACTGCGATTTCCTTAGATTTATAATGCTTG
> TAACTCCATAGTGACTCCAACGGACAAGTCCCTTGGCACTAGCATATACGGCGATTTACC
> GTTTTGGCTTCCCCGTCTTAGTGCAAGCAAATTCCGAGGTAGCTTACATTGAATTGAACC
> AATATGTTTAGCGCACCGTATATTAGCATGCATTCATAGAGACAGCACCGTCACTATGAA
> TGCTTGCAAAGATGCTTGCTCAGATAAATAATCGTGATATAAAAGAATTAAAAATGAGGT
> GTGAATAAAATTTAGGGTCATCTCATGAGATGGGGCAGTTCCTGGAAAATATCAATACGT
> TTAGCCGTAATTATTATTAAATCAAGGGCGCCAATACACGCCTACACATATTGATAAAAA
> GGTTCTCCTAACAGGAGACTGTAATGGCGATACTTTGTTTTATGTTTGTCTAAATTTTAC
> TACATATCGCTGACTACATTCTGGTATTTGGTTGCCTAATAAATCAAAAATAAACCATGC
> GCGTGAAAGTTATCGTTAAGCTTTTATTATCAGATATGCGTGTTCTGTATTCGTGGATCA
> AACTGGACTTATGAATAACGAACGAGAGTCGTGCCCTGAGAACGACTCTATTGAGGGACA
> GCCAATAAACGGAAGTTGAAACTTGAAACCATTGTGGCGGGCCTGAAGAATGGTCTATAC
> AAGACCCACGCTATGCAGAGTCGGGAATTACGATCGATTTGAATGAAACCCTATAGAACC
> GCCTACTTAGTGGCTTAACTGCAAAAAGCTATAGGAATCATCTATTTGTCTCTGATGACA
> CATATTCCACTTCGCAGCCTAGTGCCTGGAGACCTAAAAACTCATTAAAGATGACGTTTC
> GTGCTGGGACCTGGTTCGTAGTAGAGTTTTAGATCACCATAAACTTACGCATCATCAGTT
> AACGCCATCAAGGATGGAACCGCTAAAGTGCTTGAACGTTATACGAAACAATCCTGTAGC
> AAATAAGCACGACCCGACCAGTACTCGTCCAAAAATTGATTCCACGAATGGTAGATCTGT
> TTTCGATTCTTTTAAATGGAGCTTTTTTGTTAAGATCGTGAAAGGATAGTTAAGCGTTAG
> CATCATTCTTTTGCTATGTTGTATTTGGGGTAGTCAGATCTGAAGGTTAGTCGAAACAGT
> TAAGACGTCATTATGTAGCTATAGCTGATGAGATAGACCAAAATAAGACAATAAATCTGA
> ACACAATCTAAAAATCATATTTCCACTGTTAAGACTCATAGATCCAATGTTACCTCCTGG
> GACTCAAGTAAAAACGCCCGTTGAGAACTTTTTGAGCTTGCGCATGCGTGGGCCGAATAG
> ACAAGAGTATGGTTAAGTAATTTTGTTAGACTCCTTCTTGGATTAGGCTAATTAGCGCCA
> AGAAAAGGCGTTAGGCTATAAAGAGTACGAGTAGAACGATTGGGCAATCGATAAATATTT
> GCACCAAATCATTGTAGATACGCGATTTTATCACCACCTTCTCAATCTAATTTGTGACAC
> GAAGTTCCTCAGGGGAGGAAGGTCTGCAAACCTTTAGTGTTCGGCTATCTATAAACTAGT
> ACTTTACCATAGATTCATATTAAATGTTTGATAACCACCCCCAGTACAATTTGCAGCTGA
> GCATTTCGAGGTGGTCCCATACTCTATGCGTCGAAAACCATAACTGTACATTTAAGATGG
> TGGTCTAGTTATAGGTACGGTCGAATATAACGCAGGGCCTGTATTAAGGAGCTCGTCGCA
> AGAGTGAGCTTGTCACTTCCTACATTGCGCAGAACATTATTAGTAACGGGGCGTAAGGTT
> CTCTTACCGGGTTATGTGGGATTAATTTCCTACGGATTAATTTCTCAGTGCTAAAAGCTT
> AGAACATAAAGCCCTTCCAGATTAACATTAAAACTCGCCTTGCGGCTGTTAAATTAATGG
> TCCAGCTCGTATGGGAAAGATAAGTTGTACCTACTTCTTAGCTTTTTAATGTACAAAATG
> ATTAAGATAGAAAAAGTAGGAGGCCCCAAGCACAGCAATAGTGTAATCTTATAATCAGGG
> AAAAAGCCCCGATGACATGATCGCTTACTGTGACTCCATTGGGTCCTTTCTCAGATAAGA
> GTAGTAATAGACACATACGGATCAGATAACAGTCTATATATGACTGTAGTTCAAAGTTAG
> TCGACATGACATGTGGAAGAGTGTCCAGATATGCATGTATTTATCTTCTGACTATAATTA
> TAAACCTAAGAATCGAGATCGTTTTGGTGCCCGCATACACTTTTCAGATATTCGAAGCTA
> ATTTGCGTTCGAGGACTAGGTGAACAAAGTAACCCCAAACTAAGAACATAAGTATTTCAT
> CGCATAGAAATCGTACATGCAACCGTTGTAGAAGAGTACGGAGGTAGGTTAATGCGATGC
> TTGAAATGTGCAATCGCAAAGATCCTAATATTAAAAGAAATATATATTTTAACTATACTA
> GCTTTGTCTAGTAGCTTTCAGAGATTTATGTTCACTCTGAATCACCGGTATTTCCCAGGC
> TAGTAAAAGGACGTAATACAACGACATGATATGTTGATAATGTGTGATGTGGGCACCTTG
> GAATGCACACAGAGCTTTACTAAATTTGGCATTTGTACAGCGTACTTGCTGATAACGCGG
> TCAATATCAGAAATTACTACGGGCCATACCGCGTAGCACAATACATAAATGTGTTGGTGA
> AGTGTCGTAATGGTCTTGACAGCAATACTTAAGTTTAATGTCACTTTGAAATTACTTTTA
> ATTGGTATCACATAGATAAAAAACCCATTGCCTGGTCCAACCGTAAAGACCAATTAGAGA
> AATAATTACACCCTGAGATATTATTTTTGCACTGCGCTATTAAATTGTTTGTTGCCAAAA
> ACCAATTTTGAACTTAGCGCCCTCTTTACACAGTGAAATTACAGAACCTAAAGCTTTGCT
> GATAACATTTAAGAAACGAGTATTTGATTAGCTAATTTGCAGCTATATGCAATTGTTTAT
> AACTATTAACATCGCCAGAAAAAGATAGCTGACAATCACGTGTCAACTTCTTGGGTAACA
> CGAGAGAGATATTACGTAATTCTTGGGTCCGCTCTTAGAAACACCACGAGACTGAAGACG
> TATGAATCTGTAATTCCATGTATATATTATGACGAATTAGATAGCAGCAACTTTATACCT
> ATCGTAGATGCTCGCCGCGATATGCTTAGATAACCAATTAGCAACAGACGGGATTGATAG
> AGAAGGATATGGGAATGCCTGAAGATCCTACCGATGTGGCTTATAATTGGCGTAACTTTT
> AGCTTATGTTGCTTGAAAGTTTCTAAGGATCATTTTTAATTAGTTCTACCTGGAGCGTAA
> AAGATGCCTGATAATACATCTATTCAGGCAATATATTCCCTATGTTGGACACAATAGTGA
> AACAGTATTAGTTGAATGTAGTACCTGTTTAAATAGCAACTGTTATTCTATCATATAAAA
> CGTATCCATCATAGTAAAAACCGTAACCTAATTAAGTCATATTGCCCAGAAATGTGCCGC
> TATTGCTAAGGATCAATCAATATACAGATTAAGTTTCAATGCAGGGACGTATGGTAACCA
> TATCAAAACTAACTCATATCTATGGAAACTAAAAATTCAACCCAAGGATCGCCTAATCTG
> CATAGTTCCGAGCTATACCGTTCATCGTTGTATAAGGACGATATCCGAGGATTCAAGGCA
> GCCATACGTCCGGAAGTTATATATACTCTAAATTTTTTATTGCACAAATGCAGCGGTTTA
> GGGCATTACTAGGCTACTTTAGTTTATCGAGTCGTCCAAAGCACGATATAGATATTTGAC
> CATATGAAAGTGGGGCCTTTTATGTATCGCGAAACTCAACCACTCCAGGCAAAAACTTTT
> ACCCGCTGCATATGTAACATGGTGAGCCCGACGTAAATGTTACAGTTCAATGAGCTTCTC
> ATCCTTCGCGTCGGGACTTATTGCTTGGCGAATTTAGAGTCTCTATGCTCGGAGGATTTC
> ATAATGCGTGAGTTCTAGACTCGACGGTTAAGGACCTTTACCCCTAGACTACACACATTA
> GTCGAGTACTTACCAGAATACAAGGAACGATCGGCTCCATCTCTAATTCACTCTTCATAT
> CCGATTTGTAAAGAGTTAGTGATATTGGGAGTGTCATAACTATATATTGAAAGCAAATAT
> TATTATGCTGTATTCAGGATAGAATCCAGCCGCTTACCTGTTCCATCAATTGTTTGTTCC
> TTGGTAAAGCGAGTGTTAGCCGATAATCAACTTCACCGTTCTCAGGGCCGCTAACGGTAG
> TTTTTACACGTGGGTCAGAAGATAGGTCCATACTGATCTTGTTTACTCAGGGTAGGGGAA
> CTGCAATTCCAGGCTCGTAGCGAACTCCAGGACCTTTATATTATACTATGCGTGTGTGGT
> AGAGCTATTTTGTTAAACAAGTTCGTAACATTATACCCGCTAATGTTAATCTCTTCAATG
> TGGCAGTCATATCCATTCTATAAGCTGATCTAGTCGTCTATTAAAGCATGCTTCACACGT
> TACAGGGTTATGCCAGAATTAGGGTATCTATAGTCAAGCCGTTTATTCCGCCGCCATAAG
> ATTCCTAAGACATCACTTTAAATATACTACCCGCAGCGTAAGTAGTGAACTTATATAAAG
> ATATTCTAAAAGTTTATAACCAATTGATTTAGTGGAGTACTAATTGCCAAGAAGATATGT
> CTGCGCGCGGCGTTTGATTTACTATGACCTTTTCGCAGTGTAGGAAATTCCATCTACTCG
> ACTATATTCCGTTCACAGAATCCAATTCCTTGCTCAACAGTCCTTTTCTGAGGAAGAATA
> TTCACAACGCCCGTGGTCGCATGGCTACACTGCACACTGGCGTACGTGGATATACACCAT
> GCATAGAGGAATCATGTTCCAACTATTACTGTGGATAATTCGATGCCGAGTTCTCTTCAT
> ATTTAGGAGCCTGACATGCCGCGAACTTAGTCGAATTTTATATCCGTTCCAACCCACTAG
> TAGGCCAATCCGTAGTAGTTAGGGTTCTCATAATTAACAGGAGACCTATTAACTCTTTCA
> TCTTCTTATCTCTTTCATTCGTGTAGTTTACTCTGTAATGTACGCGTGACCGTAGTTTGA
> TGACTCATTCTAACATAGGATACGAATCTGAGTCGGCTGATCACACCGTGTTTTAAACTG
> GATGTTTGGCATCATTTAAACAATAATATAGAAATCGGAGAACGCAGTTTTTCTCTCAAT
> TTGAAACCAGTAAAAATACAAACTTTTGAGATCTCTATAGGATAAGAGATAAGTTGTACT
> GTTTAAGCAATGTATGAAGTAAGATTTGGTTCACGTTCGCAGGTAACCAGAAATATTACG
> ATGGTGGCGAACGTCTCTAGTCAAAACCACATCGCTTAACCATGTGTTTGTGAAAGACCG
> GAGACTTATTCACTTGAGGATGTCTGCATCTTTTGATATCTCTTCCTAAGACATTTAATT
> ATTATCTAATACCCTAGGGTGTGATTCTAATTTAAAACTGAAGTAGTGGTGGGTTTTGCT
> TTGGGCCTTTTAGAAGCTTTCTTGATCCTTGATTCGACGAACAACAGATTAAAGTTCCAG
> GGTTATAGTTGACAGAACTTATGACATCAAAAATGCCTGATTTCGAAGAACGAATGCATT
> GCTAAGATTGAATATGTCCCCATACAATCTGTTACGCTCGCTGGGAATGTATTACCTTTC
> AGGCTCTTAGAAGTACAATGATACATCCAGATCTAGCAAGCTGCAGTGGTCTTCCTGCGT
> ATGTGAAGTGCGCAGCCATAAAATTATTTCGATGAATACGCCTCATAGTATTGGTAAACA
> TCAAAAATAATCTTCTCGACCTTCTCTGTGAATTACCAACCTGTACTCTCATGGTTCATA
> CTAAGTAGGATCGAATAGCTAAACTCTCTGCACAAGGGTACGTAATTAAAAAAATAACCC
> TGACGCATACTAAGTGCCTTTAAACGTTAGTTTAAAAAGTCATTTCCGCTCTGAGTAAGT
> AAGAGTCGGGATATTACTTAGACTAAACATTACCAACTAAAACGAGAAGGATTACCAAGA
> GTGTTAGTCCATCTGCTCATGACGGGAAAGCACTTAGGTCTGTCGTAATATCTCAATATA
> ATATATATTAGATGATTTTCCAGCTGATAATTATTACGACAACATTCTTTCTCAACATAC
> AAAAGTATATTCAATAAAACTCCGGCCATAATTTTCCAATAGATAGTACACTGAGTTATA
> GACATTTCGGACAAATAACAATCAACATAAGGTGAGCAATTTTATAAAAGTGAGCTTTTT
> GTCCATAGGTTAGATTAGGACTTTTAGTGTTCCATGGCTGACATAATCCGGGGATGGCCC
> AAATAAACAATAACTACTGAGCAGTATTAGGTTCCTAAGATCGGCGAGACAGTCTTAACG
> GTCGATTGTTCAGATATCTATGTTTTTCTGCGCCAGAAGTAATGGTTGGTATAAGTTAGA
> TATTTTTGGATCACTTGCATCGCGACCTGTTGACGAGAGGTTGTGGTATTTAACAAATAG
> AACCAGTTAATATAAAATTCGCAGTGTAACTTTGAGTCAGAAAATCATTATATTTACTTA
> GCGTAATGATCCATACAGAGTATTAGATTCCAATCGTGCTCTGGGTTATCGGGTGCCGTC
> AACTTACCTGCTGATGTCTTTAGGAAAGAAGCTGTTGAGGAGTTAGGATGCTGTGATAGA
> TAGTTAAGCAACGATTGAACGCTATCTGCATTTTGCCCATTACAGAGGAGTTCCTATGGA
> ACATGGTTTTAGCTACAAATTTCTCAGACCAAACCTATATAGAATCGTTCCGGTCGATCT
> ATCAGGTGATCGTAAAGTACCTCTTCCAAGCTTTGTCTTGTGAAAGTATTAACGTTTCCT
> GGACAATATTATATCGGCATTAAGGTATCCTTCTGGTTAAAGTGGTTGGCTACAGTGAAA
> TATTTAGTTGAAGCTCGTACAAGAGAACGTGTCTTCGCCGATTAAATTTACAAAACTAGT
> ATCATAACTTAGAATTTACGAATATATGTATGAGTAATCACGCTAGGGTTAGTGTAAGTG
> ACAGTAAAGTGGTACAATATGTAGCTCTATTAATATATCAAATGTCATTTCCAACTGGTC
> CAGTCAACTCTTGGCAGTAGTGATGGACAAAATTAATTGCTAAGGGGTTGCTAGTGTACT
> TGTTGAGGGTCGACGCTTTAACGTCGCAAACTTGTGGTATCACCGCTATCCTTTTATGTG
> GTATAGCGGCGCAAGGATTCACGGAGAAACCAAGCCCGTAGTTAATCAATTGACTGTTCT
> TTTGGAGCCTTTGCCTAATATTGGGGACGTGTCAGAACATAGCTCTTCGCTCTAGGAATA
> GTAGACGGTTAAACGGATTGCGATTGACTATTGACCAAACTGCCAAGAGCTACAGCCGCT
> TACTAACGTTAGCGATTTGCATCTGGATTCAGAATACTGTGTTCTAAGACTTTTCTCAGG
> AAACCCATTCTAGGGGAGGGTTCGCCCACTTAAATAATACACGGCATAATCTAAATTATC
> AGTCATTAAGCGTTTTAATCTGATCAAGAGTCCTCAGTCTTCATTGAAATGACTCCCCCG
> AGTTGTCAACATCGTATAAACAACTCATTCGGGTAACCCGAAGAGACCTCTTAGTGTCAG
> CTGTGTCATTAGCCTATAACATTTAGTATAAACAGGATATGATTTCATTGAATACTCTAA
> GTTTGCTAGAAGGTAATGGTGCGATAGGAAAGGCACTCTACCTATAACGACTAGATCAAA
> ATGGGTCCTGTCGAGAGGTCTCAAAGGCGTAAACTCCTGACGAGTCACTAAGAGATTCCG
> CACCGGGTTATAATGCAAGTGGGCGCTTTCAGTTTAAAATGCTGACAAAACACGGCCCAA
> ATACGAGGCTGGACTATACGGCGTTTAGGTAAATATTCCCGTGTACGTATGTATGTTTCA
> AGGCAAAAGTAACAGATAAAGGTACCAAAACCTTATAGATTATCACGGGCTCCGCTTAAA
> CACTTGTATACAGTCTTAATCCATAGTAATAGACTTTATAATGTTCTCGAGCAATCGATA
> AAGGAAAGCAGTTGTACAAATACCATTCGTACGATATTCGCAATCGGGCATCAAACCAAC
> ATTACGTCGTAAATTATACCCGTAGTTCTTGATAACTTGAAAATGACAAACACACAAACG
> AGGATTTTCCCAAACTCGACAAATCGTTATTAAAAACTCAACCTTATTTTAAGTTATCAG
> CAATCCTCGGACAATTGAGAAGGCAGGAAATAGCAATACGGTCTATACGTCACGCGAGCT
> TGAGAACCTTCGTACTACGCGCGGCGTTATTCAAGACTCCAAGTATTTGCCGTGCATGAC
> TTAACAGAAATCCCGAAACCCGTATTCATTGATCACTTAATCACTTGGTATAGTGCGTTA
> CGATATCGATAAGCCGCCATGACGTTTTCGGCGCTATGTCCTTAATCGGAAGAAGCATCG
> GATTAATTCTCTGTACATGTTATACAAAAAGATAGCTCCGCGTAAGTTTAGATCATGAGG
> GATAGTCAAAAAGTATTTCATTTCTTTAAAATATGTCGCTACGCCGTGTTTTAACACTTT
> CTATCGTCTTTTTATATTCTCGGATTAAAAAATCACCTAATATTAGAAGAATGAGGCATC
> AAGAAAATAGTGAAAAGAGTCTTTAAGATGGGCAAGACTTAAACCAGTATACGCTTGTGT
> ACTAAGAGATTTTATTTTCACAGTTCTCTGGAGAGGGTTGTTTATAGTTATCCGACCATT
> ACCTAGATGTTATGGGGGGGCTGTCATGAAGGCCATAGTTTCTCCCCGCGGAGCGCTATG
> GGGCCGGAAATGCACCGACCACAATTAATACCCTAACAATTTAATGTACGTGTTCGTAAC
> GATTCTGTGCTTTTTGAAAACCTTTGTCAAATAAACTTCAAACATCTAGTATAATATTAA
> TGTGGGAGTTGGTGGTAGGTTTTGTAGTAATGAAGCGTTCATTCTAACAGTAATGTGACT
> TGTCAAGCAGCGGCTTAAAGATACATAAGATTCGTTGATGTTTACTCTCAGTCATTAAAA
> TCAGAATCATTTGATACGTCCGGTGAAATACCAACGTAAGTTGTTGTTAATCCAAGATAG
> GCTACAAAAGTAGATATTGTATTGCGGACGAAATTCTTATCTTATTGGTAGCACATGTCC
> AACCTTGTTAGATCCACCTACAGTGGAATAGTTAATGTTACATTAAGGCCGTTTCGTCTT
> TATACGACTAACCTCGAACAGGAACCTTACGAAAAATTAACTGATTATTAGGAAGGAGGC
> TTTTTGAAGCTTCACCGAGATTGTTGTACAAAAACGAAGATTCATAGTCAGATCTATGAA
> CCAATTGACCAGTACAATACTGTGTTGTCCTGCTTACAATCGCACACGATTGGTGTTCTA
> AGGTCACATGTAACTACATGACTCTACGATGGGTCGTCCACAGTCTATATTTCGTATAGA
> CGTAACAGCTAATGACGTAATTGGTCCATTCTGGCTAAACAAATTCACTTGAACCAAACA
> CATTCACTAGGCTACACGGACGCCAGAATTATAAAGAACCAAAAGATTTACCTTTTTCTG
> ACGATAGCATCTGCTCAAAGTACACGCAGAGGAGCCCCTCTGCCATTAGTTTCATAATAC
> GACGGCTTCCACGTTCAGTGTCCAACATTTAAATACCTAGTGGACTAAAATTTTTTGGAA
> ACAGCGAAAGCCGTTTAGTGCGGGATTTGGCCACAATCATCACGATTACTAATCTAAAAA
> TTTCTCGATTCTATTGCGCATTCATCGGTACATATGAACCTAAAAGTGTCCTTTTTGACT
> TATTTTCCGTGTTCAACTCGCAGAAAATCAATAACAATACAATTATTTAAGCAAAACACT
> TAGAAAGAGGTGCTATGGACCGAAATTAAGGTCGGACCTAAATCTTATTAAGCTTATTTT
> GTACATCGCTTCCTAGCAGAACAAATATCAACTGGTGACCGTTTACGCTGATTTTAAGAA
> TGTTGATGTTTGAGCTAATATGCCACACCGTAAAAAAGCCTAAATTAACCCTATCTCCCC
> GGAGCAACAGGATTTCGAATTCGGACACATGGTGGATTTACGAATCATAACACTGTCCAA
> ACTCCCAGCGATGGGGTTGTCTAGATGACCGAATACATCATACTGTTCTCACCAGTTTAA
> TGTTTTACGACCCCTCGGAAGTGTTCGTAAATCAGCTTTAACCAATTGACCACTGTTCTA
> AGTTAACCTAATCATTAGATCACCTCGGGACTGGACAAACCAAATTTAGGTCATCTCTAC
> TGTCTCTACAGGTGACTTCTAATAACGAATAAGAAACATTGCTCACCGTGAAGGCAATAA
> GCATGTGTGAGGCTTTCACATAGGCTAACATCTAGTCGTTAGCCCGAAATGCCAGTAGTC
> GATTGGTTTTATTTACACTCAGTGCTAGGTATGCAACGGATTATCCACTGCGAATGTATT
> ACTAACCATTTGTCAACAATTAATACGACGGAAATTGTCCTTAGTTTAGCGGAATTCTCC
> AGTGTTTGGTAACTTATACATCTCAGAGAAACGTTGTTGCTACCTATTTTAGTGCATCCG
> TAAACATATCTTACGTTCGGAATTTAACCGTCGATTGTCATTATTGTTTACGTGCTACTG
> CGATTGTGCCGTGTCTGGTATCTTAATAAGTCACAAGAATTGCATATGATATCACCTGCT
> TACATCTATTGGAATCTCCACCTCCAATGGCTGCAGATTTTAAAGTCAGCTGAAAATACA
> ATTATTTGATTAACATTTAAACACCTCAGTCCATATGGATCATGTTTTGACGAATGTGCC
> GCTCAAATATAACGTAAAGTACAATACTGGAAAATGGAAAAGCGAAAGTTAAAATCGCTC
> CGCTCTTACCCCAACGCTCCACGTTACTCACTTTGGGACACATAGAACAGGGGTTGTAAT
> CTCTTTTTTAGTATAAGATCTGCAGAGTAATTGATTCTCCGGGTTTTTCTGGTAATGGGG
> TTGTATCGATTTATCGCAAATAAGCAAGGAATGTAACGCGATCCGCAGAAACGGTTGATC
> TCGACTGGAATGGTAGCCACAAGCATTTTTCGACTAGATCGCGTTGTTCATCTACGAGAT
> CGCGCAGGTCTGATAATTAACTTTTTAGGGAACGACAGTAAAATATATAAACCCCTTCCA
> TGGCGTCTCACTGTATAACACTGCTCAAAGATAGTTAGTGGACTCAGTGCCGCAATTGCG
> TTAGATATACTTATAGACTTATAAAAGGTTCTTTCGGGTCATAAATTGTCAAGCTATAAA
> ATGAGGATTCGGTGCTGTCGATAATATACACTCTAATACCCAGAGTACTTTTCGCCAAGG
> GATGCACGTACTACAAGGGTCGTAAACGACTATACATAGTTTAGAATGTTTCTTAGATGT
> ATGTAATCCTCCGGACACATGGCAATCCCAAGGTGCGTTCGGCTTTCCTAGGTTACGCCG
> TTTTAATTACATGTTGATGCCGTGTAACTACATAGTCTATAAAACCGAAATGTACCGTCC
> CAATAGAAGATACCCAGATTGACCCGTTTCGCTGCCCCCGCGTACTCATAGCTTATTAAC
> ACGTTGCGTACATTCATGTGATAAAAGTGGTTTAGCCCACCGTATTGGAGCATGAATTAA
> GAGAGAAAGATAAGTCACGTGCAATGAGTCCTAAGTTCATGGATCAGAGAATTAATCCTG
> TTTTAAATGTTGGATATTTCAGCGGGCATTAAAATTTAGCGTAATCGATTGAGATCGCGA
> AGGTAATCGAATAGAGCAAGTCGTTTTCAACTTTTGAGTATGTATTCATGCCAGCCTTTA
> AACCAAGACACTTTGTGTGTAAATCGGTCTAATAAAAGGTGACTGGAATCGACATTCTTT
> CTTGTTTCGGGCTAGATTGGGTAAGAAAGATACATGACTACAGTCTCCTAGGGGGTGGCA
> TATGAAATCAAAAATAATACTGCCCAGTGATAGTTATCCTGATGAGGGTTGGATCACTTA
> GGCGGGTGAGCTATTCGTCCTGCAAACTCCAATTATCAATTTCCTACGACACGCGGGACC
> TGTCTAACAATCTTGTGACCCACAGCCATTAAACGCAACTGGATAATTGTAACAAGTGTC
> GCCCCCAGGATGATTCGTCGATTAAACACAAAAGATATCAAGTGTCGCGAATTAAGATAC
> AGGGGAATCAAACAAGATAGTACCGAATACGTTGTGGCTTTTCGGCAAATAGCTATACCA
> ATCATCGAGTGGGATCGGATGAAACTGATTCCTCTGACAAGAAGAGGGACGGGAGACCGT
> AAAACGCATTAATCATGACCGTTCCTCCGGGGAACTGGGTACTAGTTGAGTTTTTGATCT
> AAAGATACTGACGATTCATAACTTATCGCCATAAAGGATCGAACCGATAAAGGGCGGGAT
> CGTTATTACATACAATCATGTAGCAAATATGAACCAACAGTACTCGACTCCTCATAAAAG
> GCAGTAAACGATTCGTACATCTCGTTTCGAGGCTTTTAAATCGAGCTTTTGTCGGTACAT
> CCTCATTGCTTTGTTTAGCGGTTGCATAAGGCTGTTCCTAGGTGCGATTTCCCCGAGGAA
> CTGATGATCCTGACTAGAATCTGTGTTGACGTCATGATCTTCATTTACATGATGAGATAG
> ACCATAATAACACAATAATTAGGAACACATGCTAAATTGAATATTGCAACTGGTAAGAAT
> CATAGATCAAATCTTTCATAATGCCAATCATGGAAAAAAGCACGTGCAGTTATGTTGGTG
> CTGGCGAATGCGGCGGCAGTATTCAATAGTGTTTGCTTTTCTAAGGGTGTTAGAAGACTG
> CTTCGATTAGCATAATTTGACCATAGTAATGGCCTTAGGCTAGAATCACGAACAGGAGAT
> ACTTTGCGCATTCGATAATGATTGGCAAATAATCATTGTAGATTAGCGATTTTATCTCAA
> ACTTATAAAGAGATGTTGTCACACGAACGTCCTCTGCCGTGCTAGGTCTCAAATCAGTTA
> CTCGTCCCCTTTATAGAAACTTCTAATTGACAAGTGTGGCATATTAATGCGTTGTTTTCC
> AACCCAACGACTATTGGCAGATGAGAAGGTACTCCTCGGACAATTATAGAGCAGTCGTAT
> TCCTTAACTGTTCTTTGATGATGCTGGTATACTTTTAGGTACGGGACATGATATACAAGG
> GCATCTTTTAAGGAGCTCGTCCAAAGAGTGAGATTGTATATTAATAAATTCCGAACTAAA
> GGTTGACTAAACGCCACGATGGTGCTCTGAAACGCTTATCTGCCTTTATTTTCCGTCGGA
> GTAATTTCTCTCGGCTATTAGATTTGAACATATACACAGGCCAGATGATCTGGAAAAATC
> CCCTGGCGCAGCTTATATTAATGGTCCACAGCGTATCGCAATCATTAGGTCTAAATACGT
> AGTACATTTTTAATCTTAATAAGCATTAACAGACAAAATGGAGGACCCACAATCCAAACA
> AATTGGGTTAGATTAGATTCAGCCTAAAAGACCCGATGTCAGGAGCCATGAATGTCACGC
> AAGGGCGTCATGTATCTGATAACACTTCGAATAGAAAAAGACGGATCAGATTACAGGCGT
> GATATGACTCTACGGAAATGTTAGTCCAAATGAAAGCTCCATGACTGGCCTCATATGCTT
> GTATTTATATTATGACGAGAATTATAAACAGAACATTCGTCATCCTTGGGCTCAACCAAG
> TAACTGTTCAGATATTCGAACATAATTTCACTTCGTGGAAGTCGTCATAAAAGTATCCAA
> AAAAGAACATCATAAGGATGTAATACCTTTGAATTCGTACATCCAACACTTGTAGTTGAG
> TTCCGAGCTAGCGTATTGCCATGATTCAAATCTGCATTCCCTAACTGCATAAGATTTATA
> GATATATATTTGGGAACTATTATACATTTGTCTAGTTCCGTTAACTGATTTAGCTTAACT
> ATGAATAACCCGTAGTTCCCAGGAGACTAAAAGGACGGAAGAAATCGACTTGATTTGTGC
> ATTATGTGGGTTCGGCCATACTTCCATTGAACTCAGTGCTTTACGAAATTTCCAATTTCT
> ACTGCGTAAGGCCGGATAAAGACCTCATTATCTGATATTTCTAACCGACTTAAACCCTAG
> CTAAATAAATAATGGTCTTGGTGATCTCTCCTAATGCTAGTGTCACCAAGACTTAACTTG
> AATGGAACGTTGAAATTACTTTTTATGCGGATCACATAGATAAAAAAAACTGTGCAGGCG
> CAAACCGTAAAGAAAATTTAGAGTATGTATTACTCCCTCACAGTGTATTGTTCCACTCAG
> CTATTATATTCTTTGTTGACATATAACAATTTTCAAATGAGAGACCTATTGAATCTGGGA
> AATTAAAGTAACGTTAGATGGCAGGAGTAAATTTATGAAAACACTAGGGCATTACCTAAT
> GGGCACCTAGATGCAAGGCGGTATAACTATTATAATCCACAGAAAAAGATAGAGCACTTT
> AACCTGGCTTATGCTTGCGGATCAAGAGAGAGTTAGTAAGTAAGTAGTCGCTACCCTCTG
> TGTAACACCAACACACTGTAGACGTATCAATCGCGAAGGACATCTTTATATGATCTAGAA
> TGAGATTGAAGATAATTTTGACCTATAGTAGTTCATCGCACAGTTATCCGTAGATAACCA
> ATTTGAAAATGACGCGTGGGATAGACATCGATATCGCAATGACGGAACTTCCTTCCCATC
> GGCAGTTTATTTCGACTAAATGTGACATGAGCGTGAGTGATTCTTGCTTACGATCATTTT
> TAAGTACTGAGAACGGGTCAGTATAACATGAATGATAAGAAATAGATGCAGGCTTTAGAT
> TACCTAGGTTGGTCAATTTACGCAATCACTAGGTCGTGAATGGACGACCTGTTTATAGAG
> CAAATCTTATTCGATCATATAAATACTTTCAATAATAGGTAATTAAGTTTCATAATTAAG
> TAAGATTGCCATCAAATGTCCAGCTTTGGATAAGCTTCATGATATAGACTGTTTAACTGT
> AAAGGAAGCGTACGATCGGAACATTTTCTATACTATAGCATATAGATCGAAACTTAAAAT
> TATACACAAGGATCCAATAATCTGCTTAGTTCACAGCTAGTCCGTTCATAGTTGTATATG
> GTCGTTATACCAGCTGTATACGCTGCCATAAGGCCCCATGGGAGATTGACTATAATTTGT
> TGATTGAACAAATGCACCGGTTGACGGCATTTATACCATAATTTAGTTTAGCGAGTCCGA
> ATAAGCTAGATATACTTATTGGACAATATGAATGTCGGGAATTTGATGGATCGACAAACT
> CATCCTATCAAGCCTAAAACGGTTAAACGAGGCATATCTAAATGGGTCTCACCCTCGTAA
> ATCTTACAGTGCATTGACAGTCGATTCATGCCCCTAGCGTATGAGTGCTTGCAGATTGGA
> GACTCGCTAGGAGCGGTGGAGGTCATATGCCCTGTGGTCTAGTCGCGACCCTTATCGTAA
> TTGTCCCAGACACTAAACAAATTTGTAGTGTACTTAACAGAATACAAGGATCCAGAGGAG
> ACTTATCTTATGATCTAGTCTGATCCGATGTGTATAGAGGTACTGATATTGCGACTGTCT
> TTAAGAGTTATGCATAGAAATGAGTTGTAGGCTGTAGTCAGGAGTGAATCCAGAACAGTT
> CAGGTTAAATCTATGCGTTGTGCATTGGTAAAGACAGTGTTAGACGATAATCATCTGCTC
> CGGGATCTGCCAAGATTACGCTAGGGTTGTCACGTCCCGATGAAGAGAGCTCCATACTCA
> TCTTCTTGTATCAGGCTAGCCCAACGCCATGTAATGCAGCGTTCCGAACTCATGGTACTT
> TATTTTATTCTTTCCCTCGGTCCTACAGATATTTGCTTAATCATGTGAGTTAAATTATAC
> CAGCTAATCGTAAGCTATTCAATCTCCCTGGAATATAAATGATTTAACATCATATTCTAC
> TATATTTTACAAGGCTGATCAAGTTACTCGGTTTTCACACAATTAGGCGTGATAGACTCT
> AGACCTTTTTGAAGACCACATAAGAGTCCTTTGACATAAAGTGAAATTTAATACCCGCTG
> AGTATGTAGTGAAAGTATATTAAGTTATTATTAATCTGGATAACCATTTCATGGTCTGGA
> GTACTATTGCAAAACTTGATATGGATGCGCCCGGACTTTGATGTACGTTGAACTGGTACC
> AGTGGACGAAATGACAGCTAATCGACGATATGCAGTGCAATGATGACTTTTCCTGGCTAA
> ACAGGACTTTTATCACCTAGATTTTTAAAATACCCCCGCCGAGCATCGCTACAATCCACT
> CTCGCCTACCTGCATATAATCCATCCAGACAGGTATCAGCTGAAAACTTTTACTGTCGAT
> AATGCGTTGCACTGGTCGAGTAATAGTTTGCTCCCTCACATCCCGAGAAAGTAGTACAAG
> TTTTTATACGTTCATACCAACTAGTACCACTATCCCTAGGAGTTACCGTGCTAATAATTT
> TCAGGAGAAATAGGATCTCGTTCAGCGTCGTATCTATTTATGTCGGGTTCTTTACGATCG
> AATGGACGACTCACACGAGTGGCATCAAGAATTATAAATTAGCAGAACAAGAGGTGGAGG
> ATGAGAAAACACTGTTTTAATCTCCATGTTTCGCTTAATTTATTATAGTATATACAAATA
> GCACATAGCTGTTTTTCTATCAATGTGAAAACAGTTATATTTATAACTTTTCAGATCTAT
> TTACCAGTACAGAGATGTTGGTCTGTTGTACAAAGGTAGGATGGTTGATGTCGTTCAAGG
> TAGCAGCTTTCCACAATTAGTTACATGGTCGCGAAACTAGCTTGGCATAACAACATCGAT
> TAAACATGTGTTTGTGTAAGACAGGTGACTGATGCTATGGACGATGGCGGATTAGTGTGT
> GAGATATTACTTAGAATTTTTATGATGTTATATTAAACGAGGCGGGCTGGCGAATTTAAT
> AATCTAGTAGTCCTGCGTTTGCATGTCGGAATGTTAGTTGCTTTAGTGAGACTTGATTCC
> ACGTACAACAGAGTTAAGTTACAGCGTTATTGTTGACACTTATTTTGTCTTCTAAAAGGC
> ATCTTGTAGAAGAAAGTATGCATTGCGAAGATTGAAGATGGCCAAATTAATGATGGTAAC
> ATCCCTGGGTATGTAGTACCTTTAAGGCTCTTACTAGTTATAGGATACATCCAGTTCTTC
> CAAGCTGCACTGCTCGTAATGCCTATCGGTACTGCCCACCCATAATTTTTTGTACATCAA
> TACCAATAATTCTATGCCTTAACATCTATAATAATATGATACACAGTATCTGTGAATTTA
> CAAACTCGAATCGCATCCTGCATTCTTACGACGTTACTATAGCTATTCTCGATCAAATAG
> CGTAAGTAATTAAATATATAAACATGACCCATACGAAGGGCCTTGATTCCTTAGTGTAAT
> ATGTCAGTTCCCCGCTGAGTATCGAACACTACCCTGAGTACGGACTATAAACAGTAACAA
> CTTTTAACACAAGCATGAACTACTGGCGTAGGCCAGATCCTATGCTCGGGAAAGCACTTT
> CCTCTGTCCTAAGATCTAAATTTTATATTTATGACTTGATTTTACTGAGGATTATTTGGA
> CCAATACTTTCTTTCGATACAGACAAATCTAGATGAAATAAAAATACCCACATTATTTTC
> AAAGAGTTAGTACACGGAGTTAGAGAAAGTTCCGTCTAATTACATTAAACTTATCCTGAG
> ATAGGTTATTAAAGTGAGCGTGTTGTCAATTCCGTTGATTTCCAATGTTAGTCTTCCATC
> GCGCACTGAATACCCCCAGCGACCATATAATCTTTAAATACTGAGCTCGATGACCTGAAT
> ATGATAGGCCACACTCTATGTACCGTACATTGGTCACATATATAGGTTGGTAGGCCAATC
> ATGTAAGGGTTCCGAGAACTTACTTATGGTGGCATAAATGGAAGCGCGTCATCTTGACCA
> GTGGTTCTCCTTGTTAACAAATAGAAACAGGGTAGATTAAATTCCCAGTCTATAGGGCAC
> TCAGAAAATCATGAGATGTAATGACCGTAATCATCATGTAAGTGGATGAGAGTCAAATCC
> GGATATCCGGTTGAGGCTCCAGGCTACTTAAAGCCTCTTCTCGTTAGGTAACAAGCTGTT
> CAGGAGTGAGGTTGCTCTCATACTTAGTTAAGAAAAGAGTGTAAGATTTCTGCATTTGGC
> AATTTACTGAGGACGGCATATGGTACTTGCGTTTTGATACAAAGTTCTCTCACCTAACCT
> AGATTGATGCGTTCCCCTCGTTCTATATCCTCAGCCTAAAGGACCGATTCCAAGAGTGGT
> ATTCTCATAGGATTAACGGTTCCGGCAAAAGTTTTTATCCGCATTAAGGTTTCCTTCTGC
> TTATAGGGGTGCGCTACAGGGATTTTGTGACTTGAACCGACTAAAACACTAACGGTAGTA
> GCAGAGGTTATGTAAAAAAATAGGTTCTTAAATTACTTTTTACCATGAGAGGTATCAGTA
> ATCAAGCTACCCTTAGTGTAAGTGACAGTAATGGCCGACAATATCTACCTCTTTGAAGAT
> ATAAAATGTAAGTTACAAATGGTACAGTATAATAGTGGCAGTACTCATCCTCAAAAGTTT
> TGGATTAGGGCTGCCTAGTGTACGTCGTGACGGTAGACGATTGAAAGTCGATAAATTCTG
> GGATATCCCATATACTTTTTGGTGGTATAGACCACCTAGCATTAAACCTCATACCATCAA
> ACTAGTTAAGCTTTTGACTCTTCTTTGGCAGAATTTGACTAATAGGCGCGACCTCTCAGT
> ACATACCTCTTCCATATACCAATTCGAGTAGCTTTTTAGGATTCCCTGTCAATAGTCACA
> ATACTGCCTTGTCATTAAGCCGCTTTCTAACGGTACAGTTGTGCATCTCGTTGAACAATA
> CGCTGTGCTAAGTATTTTCGAACCAAAAAAATTCGACGCCAGGGTTAGAACAATTAAATA
> ATTCAAGCCATTAGCGAATTGAGCACTATGGTACAGTTTTAAGATCTTCTACAGTCCTCA
> CTCTTCATTGTTATCTCTCAACCCAGTTGTCAAAATCGGTTAAACATATAAGTCGGCTAA
> CCCGAACAGACCTCTTAGTCTAACATGTGTCAGTACACTATAACATGTTCTTGTTAATCC
> AGTGCAGTGCATTGATTAATCTAAGTTTCAGTGAACGTAAGCGGGCCAGACGAAACGCTA
> TATACCTTTTTAGACTAGATCAAAATGGGTCCGGTCCACAGCGATCTTACCCGGAAAATA
> AGGAAGACGAACTAAGTCATTAAGAACCCGGTGATATTCCAAGTGGGAGAGGGATGGTTA
> TAATCCGGACATAAAAAGGCACATTGAACACCCTGCACTATACGCAGGTGTCGTAATTAG
> TACCGGCGTCCTAGCTAGGTTGAAACCCAAAAGTAACAGATAAACCGTCATTTACATGAG
> ACTTTATCTACGCAGCCGAGTAATAACTTGGTTACAGTAGTATTACATAGGAATTGACGT
> TAGAATGTTAGACAGAAAGCCTTAAACGAAAGCACTTCTTCTTAGTACATGAGTTAGATA
> TTACAATTCGGCCTTCTTTCCAACATGTAGTCGTTAATTTGACCCCTACGTCTTGTTTAA
> TTGAAAATCACAATCACTAAATAGAGGTTTGTCACATACTAGAAATATCCTGATTATTAT
> CTCAACATTATTTTAAGTGATCTCCAATACTAGGTAAATTGTGATGCCAGGAAATACCAA
> TTCCGTCGAGACCTCTACAGAGCTTGACTACATTCCTACTAAGACCGCCGTTATGAAAGA
> CTCCTAGGATTTCCCGTGAATGACTGAACAGAAATCAAGTAAACCCGTGTATTTCATCTA
> TTAATATCTTCGTTTAGTGACGGACGTTTTAGTTATCCACCATGGAAGTTTGAGCCCCTA
> GGGCCTGATGCGGAACAACAATACGTGTAATGCGATCTACTGGTTATAAAAAAAGAGAGA
> TCCGAGTAAGTGTAGATCATGAGCCATACTAATATTGTATGTCTTTTATTTATTATATCT
> AGCTTCCCACGGTGGTAACTCTTTCTATAGGAGTGTGATAGTATCCGTGGAATAAATCAA
> CTAATTTTAGATGAATGAGGCTTCATCATAAGACTGTAATCAGTCTGTTACATCCCCAAG
> ACGGAATACAGTAGTCCCTTCGGTACGAAGTGATGTGATTGTAACACTTCTAGCGAGTGC
> GTGGGGTTTTCTTTTCCGAACTGTACCTACTGGTTATGGGGGCGCTCGCATGAACGAAAT
> TGTTGATCCCCGCCCAGCGCTATCGCCCCGCAAATCCTCCGACCACATGGAATAACATAA
> CAAGGTTTTCGAAGGGGGCCTTAACATTAGCGCCTGGTTCAAATACTGTCTATATTAAAC
> TGAATAAAGCTACTATTAGAGTAATGTGCGAGGTGCGCGTTGGTGTTCTAGTTATGATGC
> CTTCATTCTAACAGTAATCTGTATTCTCAAGAAGCGGCTTAAACATAAATAACTTTCGTT
> CATCGTTACTCTCACGCATTAAATTAAGATTAATGTGATACGTACCGGGAAATAAAAACG
> TTAGTTCTGGGTAATAAAAGATTGCCGACTATTGTAGTTATGGGATTGCGGACGAATGGC
> TTATAGGTGGGCTAGAACAGCTCAAAACGTGTGAGTTCCTCCTAAAGTGCATGTCTTAAT
> CTTAAAGTATGCAAGGGTAGTCTTTAGACCACTATCATAGAAAAGCTTACGTAACAAAAT
> TTATATGATTAGTAGGAACGTGCATGGTTGATCATTATAACACATTCTGGTAAAAAAAAC
> AACATTCAGAGTAACATATAGCAAAATAGTCAACAGTTAAATACTCGCTTCGCATGCTTA
> CATTCGCAAACGATTGCTGTGCTATCCGAACATCTTTCTAAATCACTCTACGAGCGGTCG
> GCAAAAGTCTATAGGTCGTATACAAGTATCTGATATTGTAGTATTGGCTACATTATGGCT
> AAACATATTCAAGTGTACCATAAAAATTAAATAGCCTACACGGACGACAGAATTAGAAAC
> AACCAATAGATTTACATTTTTAGCTCCTGAGCAGATGAGAAAACTACACCCAGACGACAC
> CCTCTCCAATGACTTTAATAATAAGTACGCGGAAAACGTAAGTCTCAAACATTTAAATAC
> ATTCTCGTCGATTATGTGTTGGAAAAAGCGTAAGACGGGTACTCAGCGATTGGGCCACAA
> TCTTAACCATTACTATTATAAATATTGAGCCAGGATTTTCCGCTTTCTTAGGGAAATAGC
> ATCCTAAATGTGTCCTTTTTCAAGGTTTTGCCCGGTTCTACGCCATCAAATGAATTTACA
> ATACTATTTTTTATCAAAATCTCGTACAAAGTCGGGATAGGGACCCATATTAAGCGCGCT
> CCTAAATCTGATTAACATTAGTTTGTACATCGCGTAATTGAACATATAATTTAATATGGT
> GAAAGTTTAACCTCAGTTTTACTATCTTCATGTTGCAGCTATTATCACTCAACGGAAAAA
> ACCATAAATTTAACATTTCGCAAAGGACAAACTCGATGTCCTATGACGTAAATGCCTGCA
> TTTACGTTTAATAACTCGGTCAATACTCACACACTTGCCCTTCGCGACATGACCGTATAA
> TTCATTCTCTGCTAACCAGGTGATGGTTGTACGTACCCTCCCAAGTGTTAGTAAATCACC
> TGTAAACTTGGCAAAACTCTGCGAACTTAACCGAATCTTTTGATATACGAGCGACTGGAC
> ATAACAAATTTTCGTATTATCTAAGGGCTATTCAGGGGACTTCTTTTAAACAATAACAAT
> AATTCATCACCGTGATCGATTTTACAAGGTCGCACGCTGTAACTGACCCGAACAGCTTCT
> ACGTAGCCACTAAGCCCACTACGAGTTTCGGTGTAGGTACACTCTCTCCTACGTATCCAT
> CGGATTAGAATAGCCCATTGGAGTAATAACCATTTGGCAACAAGTAATACGACCGTAATT
> CTACTTACTTTTGCGCAATTAGCAACGCTTGGGTATCGGATACATATCTGTCAAAAGTTG
> TTGAGACCTATTTTTCTCAATCAGTAATCATTTCGTTACGGCGCTTGTTTACAGTAGATG
> CTAATTATTGGTGAAGTCCTACTCCCATTGTGCAGTGGAGCGTTTATTTATAACTAAAAA
> GAATGGAATAGGATATCAAATGATTACATATATGGGAATCTCCACCTCCATGCGATGCTC
> AGTTTAATGTATCAGGTAAATACAAGGTTTTGATTAAAATTGAAAAAAAGAACGAATGAG
> CCATCATGTTTGGACGAATGTCCCGATCAAATAGTACCGAAACTAAAAGACTGGTAAATC
> CAAAACCCAAACTGAAAAGACATCAGCGCTGACCCCTACGATACAACTTAATCACTTTGG
> CAAACATAGAAATCGCGTTGTTTTATCTTTGTTACGATTTCATCGGATGTGTATTTGATT
> CTCCCGGTTTTGCTGCTAATGCGGGGCTATACATTTTTAGCATAGAAGATACGTAGCTAA
> CGCCAGCAGAAGAAACCGTTCTTAGCGACGCGATTCGTAGCCACTAGATTTGTTCGACGT
> GATACCGTTGTTCAGATTAGAGATAGAGCACGGATCATATTTAAAGTTTTACGCAACGAA
> AGTTAAATATATATAAAAATGCATGGGACTCTCAAGGTATAAAACTGATAAAAGTGTGTT
> AGTGGAAGAAGTGACCCAATGCCCTTTCTTAGACTTATTCTAGTATAAATCCTTCTTGCG
> GGTCATATATTCGCTTGAGATATAATCAGGATTCGCTGCTGTCCAGAATATTCAATCTAT
> TTCCCAGAGGTCTTTTAGCAAAGGCATGCACGTAATTCAAGGGGCCGAAAACACTATAAT
> TACGGTTGATTCTTTCTTACATGTATGGATTCCTAAGGAAACATCCCTAGCACAACGTGC
> GGTCCCCTTTCCTAGGTTTCGCCCTGTGAATGTCTTGTTGTTGCAGTCTTTCTACAGTCT
> CTAGAATACCCAAATCTAAAGTCCAAAGTCATGATACCCACAGTGAAACGTTGCGATGAA
> ACCGCGGACTCATAGATTTGGAACACCTTCCGTTATTTCTTGGCATAATTGTGGTTGTCC
> CCAAACGATTGGTGCTTGAAGGAAGACACAAAGATAAGGATAGTGCAAGCAGTCCTATCT
> TCATGGAGAAGTGTATTAATCCTCTGTGAATTCTTGGTTATTGCTCCGGGCATGATTTTT
> GACCGGAATCGATTCTCATCCCCAACGTAATCCATTTGTGAATGTAGGTTTCAACGTTTG
> AGGTGGTTTTCTTCCCACAATTGTAAACAAGAATCTGTGTCTGTAATTCCGGCTAATTTA
> ACCTCAATCGAATCCACATTCTTTCTTGGTGCGGGCGAGTTTGGGTAAGAAAGAGACATC
> TATAATGTATCCTAGGGGCTGCAATATGTATTCAAAATTAATACTGCACAGTCATACTTA
> GCCGGTTCAGGGTTGGAGAACTGAGGAGGGTGAGCTATTACGCCTGCTTAATCCTATTAT
> CATTTTCCTTACTCACGCCGGAAATCTCTTACTATCGTGGCACCCTCTCAAATTATACCC
> AACGGCTTAATTGTTAAAAGTCGCGCCCCAAGCATCATTCGTAGATTATACAAAATAGAT
> AGCAAGTCTACCCTATGAACATACTGGGCATGCATTAAAGATAGTAAAGAAGAAGGTCTG
> CAGGTTAGCATAATTGATTTTCCTAGAAGAGTGGGGGAGAGGAGCAATATGTGTACTCGG
> ACAACAAGACGCAAGCCACTCCGTAAAACGAATTAATCTGCAACGTTACGCAGGCGAAAG
> GCGGACTACTTCAGGTTTTCTGATAAAGTTTATGAACATTATTAACTTTTACAAAGAATC
> CTGCCAAACCATTAAGGCCGGGTTACTGTTTACATTCTATAAGGTAGATAATATCAAACT
> ACACTAATCGACTACTAATTAAAGGCAGTAAAACTTGCCTACATATCGTGGACAGGAGTT
> TTTTTCCACATTGGGTCGGTACTGACTCTTTCCTTTCGTTTCACGGTCAAGATGGATGTG
> CATAGGTGCGTTTGCCCCGTCGAACTGATGATCCTGTCGAGAATATCGGTTCTAGGCAGG
> ATCTTCAGTGACATCTGGACATACTAAATAAGAACTATATAATGAGCATCAATTGAGATA
> TTGATGATGGCAACTGGGATCTAGAATAGAGAAAAGCTTTAAGAATCCCTATCATCGTAA
> AAAGAAACGGCACTTATGTTGCTCCTGGACAAGCACGCCCAACTTGTCAATTCTCGTGGC
> TTTTCTAAGGGTGTTAGAAGAAGGATTCCATTACCATAATTTGACAATACTATTGCACGG
> TCCAGAGAATCTCGAACTGGACTTACTTGGCGAATGACATAATGATGGCATAATAAGATT
> TGTTGATTACAGAGGTGTTATAAAAATTAGATAGAGTTGGGGTCTATACAACGGCAGATC
> CCGTCCTTCCGATCATTTAAGGTTCGCGGACCATTTATAGTTAATTCTAATTGAAAAGTC
> TGGATTTTTTATGCGTGCTGTTAATAAACATCGAATTGGGCAACAGCTCATGGTACTCCG
> CCGACAATTATAGTGCAGTACTATTAATTAACTCTTCTTTGATCATGCTCCTATACGTTT
> TGCTAACCGACATGTTTTACATGGCAAGCTTGGATCCACATACTACAATCTCGGTCAGTC
> TATATTAAGTAAGTCAGAACTAATGGTGGACTATACGCCACGATCCTGAGATGTAACCCT
> TTGCGGCCTTTATTTTACGTACCTGTTTTTTATCTCGGAGATTAGAGTTCATCTGATACA
> CAGGCAACTTGTTCTGGATAAATACCAGGCACCAGCGTATATTTATCCTCCTCAGCCGAT
> CCCTATCATTTCGGCGTAAGAAGTAGGTCATTTTGAATCTTAATAAGCAGGTACAGACTA
> AATCGACCACCAAAAATCCTATCAATTTCGCTTAGAGGAGATTCAGCCTATAACAAAACT
> GCTCAGCAGACATGAAGGGCAAGCATGGCCGTAATGTATCTGAGATCACTTCGAATTGAA
> TAAGAACCAGAACAGTTCACGCGTGATAGGTATCGTCGGATTTCTGTCGACTAATGTAAG
> CGCCATGACTGGCATCAGTGCATTCGTGGGATAGTAGCTAGAGATTGATAAACAGATCAT
> TACTCATACGGGGCCGCAAACATGTAACTGGGCACTTATGCCATCATTTGTGCACTTACT
> CGAAGTCCGCATAAAACTTTAAAATATAGAACTTAAGATGGAGGTATTACATTTCAATTC
> CTAAATCAAAAACTTCTACTTGTCTTACCTCCTAGCGTATTGACATCAGTCTAATCTCAA
> TGACATTTCTGAATTAGAGGTATACTTTTTTAGTTGGGATAGATTATACATTTCGAGTGT
> TCAGGGAACTCTTTTAGCTTAAATATCAATAACCCCTAGTTAAAACCAGACTATTACGTC
> CGATGAATTACTATTCTTTGGGGCTTTTTCTGGGTTCGCCCATACTTCCTTTGATATCTC
> TGATGTAAGATATTTCCAAGGTCTTATGAGGAAGGCCGGATATAGACCTAATGATCTCAT
> ATGTAGTACCCACTGTAACACTTCATATATAATGATTGCTCTTCCTGTTCTCTACGAATG
> CTAGTCTATCATAGACTTATCGTGAAGCGATAGTTCATATGAAGTGTTTTGCCGATAAAA
> TTCTGTAAAATAAATGTCAAGCCGCAATCCGGTAACTAAATGTACTCTTTGTATTTATAA
> ATCACTGTGTTTTGTTCATCGCACAGATGATTTTCTTGGTGCAAATATAAATATTTTCAT
> AGGACACAACGATTGAATATCGGTTTGTAAACTTAAGTTACAGGGCAGCAGTTATTTTAT
> CATAACTCTAGGGCAGGACATTTTGGCATCATTGTTCAAAGGCGGGAGAAATATGATATT
> CCAAACAAATACATACAGCTATTGATACTCGATTATGCTTGCCGTTCAACACTGTGTGTG
> TAAGGATGTAGGCGCTAACCTCTGTCTAACACCTACACTATCTAGAACTTTCATTAGCGT
> AGGAAAGCGTGATTGGATCTACAATGAGAGTCATCATTATTGTGTACGATACGACTTCAG
> ACAACACTGAGCAGGACAGAAAAATTGTCAAAATGAAGCCTGGCATACACATCCATATCC
> CTTTCAAGCTACTTCAGTACCAGCGCCAGTTGATTGCCACGAAAGGTGACAGGAGCGTCA
> GTCATTCTTGCTTACCATCATTTGTATGTACGGAGTAAGGGTCAGTATTACATCAATCAG
> AAGAAATAGATGATCGCTTTAGATGAAAGAGGGTCGTAAATTGTCGCATTAACGAGGTCG
> TGATTCGACGAAATGTGGATAGACAAAAGCGGTTTAGATAATATATTTACTTTAAATAAT
> ACGTATTTAAGTTTAAGAATGTACTAAGATTCAAATCAAATCGCCACATTTGCATAACCT
> TAATGATAGTGTATCTTTTACTGGAAAGCATCCCTACGAGCGGTTAATTTTATATTATTT
> AGAATAGAGAGCGATACGTTAAATTATAAACAACCTGACAATTAGAGCATGTCTGAACAC
> CGTGTACCTGAATACTTCTAGATCGTCCTTATAACACCTGGATACCCTCACTTAACGAAC
> CATGGGTGTTTGACTATTTTTTGTGGATTCATCATATCAACCCCTTGTCCCATGGTAGAC
> CATAATGTTGTTGAGACTCGCCGAATATCATACATTGTCTTATTGCTAATTTTCAATGTC
> CCGAATGGGAGCGTTACACTTTATAATAATAGAAACCATTAATCGGTTTAAACAGCAATA
> TCTAAATGGCTCTCAAACTAGGAATGCTTAAAGGGATTGCTCAGTAGATGCAGGACCCGA
> CCCTATGTGTGCTGCCACTTTGGTCACGAGATAGCAGAGCTCCAGGTATGATGCCCTGTG
> GTAGAGTCGCGAACCGTATCCTAATTGTAAAAGTCAATAAACTAAGTTCTACTCTTAGTT
> AAAGATTAAAACCTTCCAGACGAGAATTATCTTAGGATCGAGTATGAGACCTTGTCGTTA
> CACGTACTCATAGTGCCACGCTATGTTAGAGTTTTGCATAGAATTGAGGTGGTGCCTCGT
> GTCTCCTGTCTTTCATGAACAGGTCAGCTTAAAGATTTGCGTTGTGCATTCCTATACACA
> CGCTGACAACAGAATATTAGGATCACGGATATGCCAACATTAAGCTACGGTGGTAAACGC
> CCGATCAAGAGACCTAAAGAATCATATGCTTGTATAACCCTACCCCAAAGCATTGTAATG
> CAGACGTCCGTAATAATCCTAAGTGATTTGATTAGTGCACTCGCGCCTTCTCATTGTGGC
> GGAATAATCTGACTTAATTTTTAAAAGCTAAGCGGTAGATATGAATTCTCCATCGAATAT
> AATTGAGTTATCAGCAGATTCGACGATATTTTACAAGCCGGATAAACGTTCTCCGTGTTC
> AATCTATTACCCGTGATAGTCTATTCAACGTTTGGAAGAACAATTAACAGGAATTTCTAT
> GATAGTGATAGTTTATTAAAGCTGACGTTCTTCGCTTAGGTTTGTTTGTTATTATTAATC
> TGGATAAACTTTTCAGGGTCTCCAGGTATTTGGCAAATCTTCATATGGATGACCCCCCAC
> TTGCAGGTTAGTTGAAATGGTACAACTCGTCCAAAGGAAAGATTATACAAGATAGGAACT
> GCAATCTTGAATTTTCATGCCTATTCACGAATTGTAGCACCTAGTTGTTGAAAATACACA
> CGCCGACAATCGATAAAATCAAATAGCCCCTAACGGCTGTTAATACATCATGACACCTAG
> ATGCTGAAAAAGTGTAATGTCCATATGGACTTGAACTCGTAGAGTAAGTGTGTCCTCACT
> CTCAGCAACACATAGTACTACTAGGTGTTATAAGTGAATACAATCGTGGACCACTTTACC
> TACGTCTTTCCCGGAGATGTAGGTTAACCAGTAATAGGATATAGGTAAGAGTAGGAGAGA
> GGGATGTACGCGTCGTTAAGAGCGAATGGAAGACTCAAACGAGTGGCATCAAGATTGAGA
> AATTAGCAGAACTAGAGCTCGAGCAGCAGAAATAACTCTGTTATTCTCCATCGTTCGATG
> AATGTATTATTGTAGTTACAAAGACCTCATACCTCTTTTTATATAATGGTCTTAACACTT
> TTATGTATAAATTGTCTCTTATAGTTACCAGTACTGAGTTCTTCGTATCTTGTACAAAGC
> TTGCTTCGTTCATGTCGGTAAAGGGAGCTCCTTTAAACAATGTGGTACAGCGTCCACATA
> CTAGATTCGAATATCATATTACAGTAAAATTGGCGTTGTCTATCAAACGTGTATGATGCT
> AGGCTCCATCGAGGATGAGGGTGTGTGATATTAATTAGTATTTTTATGTTGTGATATTAA
> AAGACCCGCGCTGGAGAAGGTAATTATCTACTACTCCTCCCGGGGCAGGTCCCAATGTGT
> GTTCATTGAGTCAGACGTCTGTACACCTAAAAATCTGTTATCGTACACCGTTATTCGGGA
> AACTTAGTTTCTATTATAAAAGCCATCTGGTACAAGTTACTTTGCATGCAGATCTGTCAA
> GATCGCAAAATTAATGAGCGGTACATACCTGCCTTTCTAGGTACTGGATGGAGAGTTCTT
> GGTATAGCATAATGACTCTTCTTCCAACCTCAACTCCGAGGAAGCACGATCGCTACTGAC
> ATCAAATTATTTTTGGGACATCTAGACCAATAATTCGTGGCCGTAAAATCTATAATTTGA
> TGATACTAAGGAGATCTGAATGTACATACTCGAAGCGCTTCCTGATTTATTTCGACGTGA
> CTTTTCATATTATAGATCAAATAGCCTTACGTAGGAAATATAGATACAGCAACAATACGA
> ACGGAATTGTTTACGTTCGGTATTATGTATGTTCACCGCGCACTTTCGTTCACTACCCTG
> TGTTCGGTCTAGATTCTGGAAAAACTTTTAACTCTACCAGGAACTACTCGCGGACGCATG
> ATCCGATGCTAGGCATAGCTCTTTCCTCGCTACTATGTTAGAAAGTTTATATTTATGTCT
> TCAGTTGAATCAGCTTTATGTGGAACTATAATTTAGTTAGATACAGACAAATCTAGATGA
> AAGAAAAATAACCAATTTAGTTTCAAAGACTGTCTAAACGCACGTAGAGTAAGTGACGTA
> TATTTACTTTATAATGATCCGGAGATAGGGTATTAAACTCACAGGGTTCGAATGTCCGTT
> CATGTCCAATGTTACTCTTCATGCCCGCAATGTATAACCCCTGCCAAAATTGTATATTTT
> TATACTCTCATCGATGACCTGAATTTCATACGACACTATCTAGGTTACCTACTTTGGGAA
> CATATAGTGCGGGGTAGCCCAATCTTCTAAGCGTGCCGAGTACGTACTTAGGGGGCCATA
> TAGGCAAGCCACTAAGCTGCTACTCTCCTTCTCCTTGGGAAAATAGACAAAAACGGTTGT
> TTATATTACAAGGCGATAGGGCACGAACTATTTAATGAGATGGAATGACACGTTTCATAA
> TGTAACTCGAGGTCTGGAATTTCCGCATAGCCCGTTGAGCCTCAAGGATACTGTAAGCAG
> CTTCGAGGGACCTTACTACATCGTCTGCTCTGACCTTCAGCTCATACTTTGTTAACATTA
> CAGTGTTACATTGAGCCAGTTGCAAATTTAATGAGGACGGAAGATCCTACTTCCGTTGTG
> AGAATAAGTGATATCTACTATAAGAGAGTGATGCCGTCACCTCCTTATTGATCCGCTGCC
> GAAACGAAAGAGTAATACAGTGCTAGTCTCATTCGATTAAACGTTAAGCCAATAGTTTTG
> ATCCCATGTTAGCTTGCAGGCGCCGGTTACGCCGGCCATTCTCGGTTTTTGTGTCGGCTA
> CAGACTAAAACACTAACGCTAGTAGAACAGGTTTGGTAAATAAAGAGGTTATGAAAGTTC
> TTGGTACCATGAGAGCTATCAGTATTCAAGATACCCTTACGCGAACGCAATCTATTCGCC
> GACTTTTGCGTCATCTTTGTTGAGTTATTAGCGAAGGGACTTAGGCTAAACTATTATAGT
> GCCACTTCTCAGCCTAAATTGTTTTGGATTTGCCCTGCCGACTCTACGGCGTGACCGTAG
> TACAGTGAAACTACATTAATGCTCGGATATAACAGAGAATGGGTGGGGCTTGACACCACA
> TACCAGTAAACCTCTTTCCTTCAAACGTCTGAAGATTGTGAATCTTCGGTGGCTGAATTT
> GAATTATAGGCCCGTACTCTATCTACATACAGATTACAGATACCAAGTCGAGTAGCGGTT
> TACGATGCCCTGTCAATAGTCAAAATACGCAATTCTCATTAAGAACATTTAGAACCGTTC
> ACTTGGCCAGCGCCTTGATCAATTCGCTCTGCGTTCTAGGTTAGAACCTTTAAATTTCGT
> CCCCACCCGGACAAAAAGGAATGAAGTATAGCCAGTAGAGAATTGTGCTCTATGGTTCAG
> TGGTATGATCTGATACACTCCTAACTATGAATGCTTTTCTAGAAAACCACTGCTCATAAT
> CCGTTTATAATATATGTACCCTATCACGAACAGAAATATGACGCTAACATCTCTATGGTC
> AATTTAAATGGGTCTTGTTTATCCAGTGCAGGGAATGGATTAATAGATCGTTCAGTCAAC
> GGATGCCGCCCTGTCCAATCCATAGAGAACTTGTTAGTATTGTGATTAAGCCCTAAGCTA
> CTCACCGATATTACCAGGTATATAAGCAACACGAAAGTAGTCTTGAAGAAAACCCGGTTA
> TGCCAACGCCCACAGGGATCGGGATAATCAGCAAATAAAAACCAACATTGTACTCCAGCC
> AATTGTACCAGGTGTCCTTATTTGTAAACGCGTACGTGCGAGCTGGAAACCAAAAACGAA
> AACATATTCCGTAATTTAAATGAGTCTGTAGATACGCAGAAGAGTATTAAAGTCGTTAAT
> CGAGTATGAATTTCGAATTCACGTGAGTTGCTTAGACACAAAGCCTTAATCCTTAGAACG
> GCTTATTTGTAATTGAGTTACAGATTACAATTCCCCATTCTTTCAATCAGGTACTCCTTA
> ATTTGAACACTTCGGCTTCTTTAAGTCAAAAGCACTTTCTATAAATACAGGTTGGTAAAA
> TAATACAAATTTCCTGAGGATTTTAGAAACATGATGGTTAGTGTTATCATAGAATACCTA
> AATGCTCATCCATCCTAAGTCATTTTACCTAGTGACCGCTACACACCTTGTCTAAATTAC
> TTCGTACACACCCCGGATGAAACAATACTACGATTGCAACTCAAGGACTGTAAACATATC
> AAGTAAAACCGTGTATGGCATCTATTATGATATTCCTTGTGTGACGGTAGTTTTACTGTT
> CAACAATGCTACTTGGACCACCTTGCGAAGGTTGACCAACAACAATACCTGTAATGAGAT
> CGACTGCGGATTATTTATGTGACAGACGACTAACTGTACTTATGCACCCAGACGAATTTT
> CTTTGTATTTTATTTATTATAGCGACATTACAACGCTGGGAACTATTTAGTTACGAGTGT
> GATTGTATACGTGGAATATAGAAAATAAGTTTTCTTCTATCAGCCTGAATCATAAGACGC
> TAATCACGATGTTTCAGCCCATTCAAGGAATAATCGAGTACCTTCGCGTAGTAGTGAGGG
> GTTGGTAACACTTAGAGCGACTCCCTGCGGTTTTCGGTTAACTACTGTAAAGTCTGCTTT
> GCGCCCCCCGCGAAGCAACGAAAGTCTTGATAAAACCCCTCACATTGCCCCAACCATTGC
> ATACCTAAACTTGGAATTACATAAATAGGTTTGCGAAGGCGGCCGTTACTGTAGCGCATG
> GTGCAATTACGGGCTATATTAAACGGAATAAAGAGACTATTAGAGTTATCTCCGACGTGC
> GCGTTCCTGTTCTTCTTATCTTGCCTTAATTATTACACTATGCGCTAGTCGAAACAAGAG
> GCGGATACTTTAAGTACTTTAGTTCATCGTTAAGAGAACGAATGAAATGATCTTTATTGT
> CTTAACGAACCGGAAAGAAAAAACTTTCTTCTGGGTAATAAAACAGTCCAGAATATTGTT
> CTTATGCGATTGACCTACTATGGATGTGAGGTGGGCGTCAACAGCTAAAAAAGTGTGTCT
> GCATAAGAAACGCCATGTCTGATTCTTAAAGTATGCAACGGTACTAGTTTGAACACTATA
> ATAGTAATGCTTAAGTAACAATATTTTTATCATGAGGAGCTACCTCCATGGGTCATCAGT
> ATAACACTTTCTGGTAAAAAAAACTACATGCTGTCGAACATATAGCTTAATAGTCTAAAC
> TTATTTAAGCGCTGCGCATCAGTTAATTACAAATCCTTTCCGCTGATTTCCGAACATCTT
> TATTAAGCAATATACCTGCCCTCCGAAAATCTATAGAGGGACGTTACAACTATATCATAT
> TCTACGATGGCCTAATGTATCCATAAAATTTGTCTAGTCTTACATAATATTTAAATTCCA
> GTATACGAACACTCTAGTAGAAACATAATATTCTGGGACATTGGGAGCTACTGACAAGAT
> CAGATAACTAATACAACACCTCACCCGATCCATGGTCGTTAATATGTACTACCCGGAAAA
> CGTAACTCTAAATCTTGTATATTAAGTCGCCTAGATTATGGGTTCGTAAATCACTAAGAA
> CGGTACTCACCCATTGCCAAAATAGCTGAACCTTGAATATGATAATTTTTGAGACAGGAT
> TGGCCCATTGATGACCGTAATTGCTTAATTAATCGGGACGGTTGCAAGGTTGGGAACGGG
> TATTAGACATCATATGAATGTTAAATTCTATGTGGTATCATAATATAGTACTTACTCCGC
> ATAGCCTAACATTGTTTCCGCCCTAAGTTAGCGGATTAACATGAGGGTCTAAAGACAGTA
> ATTCATCTTATATGTTATTATCGGCAAACTTGAACATCAGGTGTTCTAGCGTCATCTTGC
> AGAGATTTTCAATCAACCGTTAAATCAATAATTTTTAAAGTTAGCAAACCTCATTATCCT
> TGTACTATGACCTATATGCCTCCTGTTACCTTGAATATATAGCGCAATACTCACACACTG
> CCCCGTCGAGTCAGGACAGTTTAATTCTGTAGCTGATATAATCGTGATGCTTGTAACTAC
> ACTACCAAGTCTGACGAAATAACCGGTTAAATTGGCAAAAATCTGCGAACTGAAAAGATG
> ATTTTCTTATACGACCCAATCCTCATTAATATTTTTCCGATGATCGAAGCGATAGTAAGC
> GGAAGTCTTTTTAACAATAACAATATGGCAGATACCGCATCCATTGTTCAAGCGCGCTCC
> CGGTAAATGACCAGAAATGATTCTACGGAGCCACTTTGCAATCGACGACTTTCCGTGTTG
> GTTATATATCGCATACGGAGCAATACCAGTAGAATAGCACATTCGTGGAATAAAATGGTC
> GAATATAGTATTAACAACCTAATTCTAATTTCTGGTCAGCAATTAGAAACGCTTGCCTAT
> AGGAGACATATATCTCAATACGTCTGGAGAACTATTTGTCTCAATCACTTATATGTTAGG
> TACGGCGCTTGGTTAAACGAGTTGCGATTTTTTCGTGTACTCCGTAGCCCATTGGGAAGG
> CGAGCCTTTATTTTTTACTATATTCAATGCAATTGGAGATATAAGCAGGACATAGTTGCC
> AATCGACTAATCAATGCCATCATCAGTGGTATCGATCAGCTTTTGAAAAGGTTTGCAGTA
> AAATGGAAAAAAAGAACGAATGTGCCATATTCGGTGGAACTATCGCACGAGCAATGAGTA
> ACGAAACTAAATGACTGCTAAAGCCAAATCACAATCGGTAAAGACAGCACAGATGTCAAC
> TAACAGAATACGGAAGATCTGTCGCTATATTTCAAATCCCGTGCTTTTATAGTTGGTACG
> ATTTCAGAGCATCTCTATGTCATTAGACCCCTTTGGCGGCTAATCCCCGGCTTTACATTG
> TTAGATTAGAACATACCTTGCTTTACACTGAAGATCAATACCTGCTTAGCCACGCCATGC
> CGTCAATATACATGGGTTCCAAGTCTTACACGGCGGAAGATTACACATACACATCCGAGC
> TTTTGTAAAGTTGGACCCTTACAAACGTAAAGTTTTATAAAAAGGAATGCCACTAGATAG
> CTATAAAACTGAGAATTCTGTGTTAGGGGAAGAAGTCAACCTTTGCACTTTCTGAGACGG
> ATTCTAGTATATTTCCTTAGGGACGCGAATTTAGGCGATTCAGATTTTATCACCATGACC
> TCATGGCCAGTTTTTTAAAGATTTGTAACTCAGGTAGGTTAGAATACCCTGCCTACTAAG
> TAATCCCGACGAAAACAATAGAATGACGGGTGATGCGTTATTTCTTCGTTGGATTAAGAA
> CCTAAAATCCCTTGAACTACCTGACGTACCCGTTCCTACCTTTAGCACTGTGAAGGTATG
> GGTGTTCCACTCGTTATAATGTCTATAGAATAACCTATTCGAAACTCCATAGTCATCTTT
> AACACTGGCTAAAGGTGACAGGAAAAACACGTAGAATTCATTTGGAAATACGTCAGTTAT
> TTCTTGGCTTAATTCTCCTGGTCAAAAAACGAGTCCTCATGCATGGAACTCTCTAACATA
> ACGATAGTGATTGCACGAATATCTTCATCCAGATCTCTTTGTATAATCTGTGTTTTCTTG
> CTTATTGCTCAGCGATTGATTTGGGTCACGAAGAGATGCTCTGCCCCATCCGAAGACATT
> TGTCAATGTACGGTTAAAAGTTTCTCGTGCTTTGATTCAAACAATTGTATAAAACTATAT
> GTGTCTCTATTTACGGAGAATTTAACCTCTAGCCAATACAATTTATGGAGGGGTGAGGCA
> GAGTTTGGCGTACAAACAGAAATCTATTATGGATAAGTGCCCCGCCAATATGTTTGAAAT
> TTGTATAATCCACACGCTTTCGGTGAAGGTTCACGCGTCGAGAAATGTGCACCCTCAGAT
> TGTACGCCTGATTTAGCATAGGAGAATTTTAATTACTAACCACCCAAATCTCTTACTATA
> GTCGCTCACTATCAAATTTTTACCATAGGCTTAAGTCTTAAATCTCGCCAAAAAAGCTTC
> TTGCCTACAGTATAATAAATACAGAGAAACTCGACCCTTGGTACTTAATCCCCTTGAATT
> AAACTGACTTAACAAGTAGGTCGCCAGGTTACCATTTTTCATTTTCATTGAAGAGTCGCC
> CAGAGCTGCTATATGTGGAATAGCACAACAACACGCAAGCCTCTAACTATATAGATGTAT
> TATGCTACGGTACGAAGCCCAAAGCCCGAAGTCTTCACGGGGTCTGATAATCTTTAGCAA
> CATTATGAACTGTTACAAAGATTCCTGCCTTAACATTTTCCCAGGCTTACTGTTTAATTT
> ATTTAAGCGTCATAAGTTCATAATAAACTAATAGTAGACGAATTTTTCGCAGTAATACTT
> GACTTCAGAGACGGGACTCGAGTGGTTTGACACATGGGGGCCCTAATGAAGATTTCATTT
> CGGTTCACCGTCAAGATGCATCGGAAGTGCGGACTTGGACACGTCCATATCATCATAAGG
> TCGACTATATCGGTTCTACGATGCTTCGTAAGTGTCAGCTGCTCTGTCTAATTTTGTTAT
> ATATATTGACCTTAAATTGAGATATTGATGTTGGAATAGCGGATCTAGAAGACTGAATTG
> CGTTAAGAAGCACTAGAATCGTAAAAACAAACGCATCTTAGCGTGCTCAGCCACAAGCAC
> CACCAACTTGTATATTCTCGTGCAGTTTAGATCGCGCTGTCTACAAGCAGGACTGGTCAA
> TTTGGTCAAAATTCTATTCCACGGTCCAGACTATCTACTAATCCTCTTAATGGCACAATG
> ACAGTTTCTGGCCATAATTAGATGTCGTCTGTACACTGGTGTTATAATAATGAGATACAC
> TTCGGCGCTATACTTCCGAAGATCCCCTCATTCCGAGCATTTAAGGTTCGACGAACATTG
> AGACTTTAGTATTAGTCTAAAGTCTCCATTTTGTTTCAGTGCTGTTAATAAAAATACAAT
> TGGCCATCAGCTCATCGTACTACGACCAAAATTAGACTGAACGACTTTTAATGTTATCGT
> ATTGCTTCATCCGCCGAGTAGGTGTCCTAACCGAATTGTTTTAAATCCCAAGAGTGGTTC
> CTCAGACTAAATTCTCGCTCAGGCGATAGGAAGTATGGCACATCTAATGGTGCTCTTTAA
> CCAAAGATCCGCAGATCTAAACCGTTGCGCAATTTATTTTAAGTACCTCTTTTGTAGATC
> CCAGTTTACAGGTCATATGTTTAAAACGAATCTGCTTATCCTTATAGAAAAGGCACAACA
> GTTTTGTTAGCCGAATAACACGTGCCATATATGTTCGGCGTAAGAAGTACGTAAGGTGGT
> TGAGTATTTACATGGTACTGTATTATTCCTCCTAAAAAAATAATATCATTTTCCCGTTCA
> GGTCTTGAACAATTTTTCAAAACTGCTATGCACAAAGGTAGCGCAACAATGCCCCGAAGC
> GATATCTGATAACGTACTTGTCTATAAGTACCTGATCAGTTAACGAGTGTGAGCTAGAGT
> CGCATTTCTGTCGAATATTCTATCAGACTTCTCGCGAATATGTGCATGCGTGGGTGAGGA
> GCTAGTCTTGGATATTAACTTCTTTACTAAGAAGGGCCCGAAAACATCTAAATCGGAACT
> GATGACATAATTTGGGAAAGGACTCCAACTACGATTAAATCGTTAAAATATAGTAATTAT
> GTTCCTGCTATGACATTTCTATGACTAATTCATTAAATGCGACTTCTCGTAACTCATACA
> CGATGCAATTCAGGATATTATCATTGAAATTTATCAATTAGTGGTTTTCTTTGTGAGTGC
> CCTTAGAGTATTCATTGCGAGTCGTAACGGATCTCTTGGTCAGTATAGAGCATTATAACC
> TTGGGAAATCCAGAAGTTTTCCTACCTTGTATTACTATGCTTTGCGGATGTTGCGCGCTG
> ACCCCATAAGTCATTGCATATATCTCAGGTTAGTTAGGTACATGGTAGTATCACGAACGA
> ACCTTTTACAAAGATTGTGATCATATGTAGTAAACAATGTAACAATTCATATTTTATGAT
> TCCTCGGCCGCTTAGCTACGTTGCATAGGCTATAATACAATGATCGTCTTGCGATAGGGC
> TTTTGTAGTGGTTGGACGTGAAATGTCTGTTTAATAAATCGCAAGCAGAATTAACGTATC
> TAAATGGTCTCTTTCTTTGTATAAATAACTCTGGTGGCTGCATAGCACAGAGGTTTTTAT
> GGCTGCAAATATAAATAGGTTCTTAGCACACAAAGATGGAATATCCCTTTGTTATCTTAA
> CTTACAGGCAACCTCTTATGGTATCTTAACTCGTCCCAAGGTCAGTTGGCCATAAGTGTG
> CATTCCACCGAGTTAGATGATATTAAAAACTTTTTCTTACACATATTGATAAGCCATTAT
> CATGCCCCTTATACTCTCTCTGTGTTACGTTCGACGCCAGAAAATATCTCTTTATAATAA
> TCTAGCTACTACTTGATTTACACTAGGAATGAGTGTGTGCATCTACAAGCTCTGTCATCA
> TTATGGTGTAAGTGACGTCTGAAGACAAAACTGTGAAGGTCAGTTAAATGGTCAAAATCT
> ACACTCGCTGTCACTTACTGATACATTTCAACCTTATTAAGTAAATGAGCAACGTGTTGG
> ACAAGTTAGCTCTAAGGTCCCTCAGGCTTTATTCATTAACATATGGTGGATGTAAGGACT
> AACCCTAACGATTTATTCAAGCTGTACAATGACTTCATCCATTTACAGGAAAGTCCGGCC
> TAAATTGTCCATTTAAAGTGCTACTCTTTCCTCCAAAGCGGGATACTCATTAGAGGTGTA
> CTGAATTTTTTTAATTGAATGATGTCGTATTTAACTTTAAGTATGTTCGATGTTGCAAAT
> ATAATCGAAACAGTGCCAGTTCATGAATGATAGTCTATCTGTTTAGCGAATCCATCACTA
> AGTGACGTTAATGTGATTTTATTTACATGTGAGAGCCATTAGTTATTGGATAAAAATCCT
> GACAATTTGAGCATGTCGGAACTCAGTCTAACGGATGACGTCTAGTTCCTACTGTTAAAT
> CATCGATTACATCAATGTACCAAAATTCCCTCTGTCAAGAGTTTTGCGGGAGTCATAATA
> GCAACACCGTGTACCATGGTAGTCAATTATGGTCTGGACACTCGAACAATTTCATACTGT
> GTATGTGGCCTAATGTGCTTTCGACCCAAGGGCTGCCTTACAATTTAGATTAATAGAAAC
> CATTAATAGGGTTAAACACCATGTTATTTATCCCGATAAAACTACGATTGAGGTATCGCA
> TTGCTAAGGACATGAAGCAAAAGACACTATGTGTCAGGCAACTTGGGTCAAGACAGTCCA
> CACCTCCTGCGATGTTGCACGCTCCTAGTCTAGACTAACGGTTCCTAATTGTAAAACTCT
> AGAATATATGGTCGACTCTTAGTTAATCTTGAATACCTTAATGACCACAATGATAGTTGC
> ATAGAGGATGTGAACTTGTCGTTACTCGGTCGCTGAGGCACAAGCGATGTTACAGTTTTG
> AATTCATTTCACGTGGTCCATCGTCGATCCTGTCTTGAATCAAAAGGTAACCGTAAAGAT
> TTCAGGTCGCAAGGCCGTTTCACTCGCTGTCAACTGTTGATTAGCATAACCCATATCCAA
> ACAGTAACATACGCGGCTATACGAAAGATCTTCAGACCTAATGTAGCTGAGGCTTGTAGA
> TCCCGTCACCTTAGAATTCGAATCCACACGTCACTTATAATCCTAAGGGTGTGGTGTAGT
> GAAAGACCGCCGTCTCATTGTGCCGGTTTATTCTGACGTTATTGTTAAAACAGTTGACGT
> ACAGATGATTGAGAAATCCATTTGAATGCAGTTATAAGATGATTCGACGAGTTTTTAAAA
> CCAGCATAAACGGTATCCCGGTGAAATCTTTTTCCACTCAGTCTAGATTCAAAGGTTGGA
> ACAAAAATTATCACGAATTTCTATGATACGCATTGTGTAGTAAACATCACGTTCGTCGCT
> TACGTGTGTTTCTGAGGAGTAATCTGCATTAAATTTGAAGGCTAGCCTCGTATTTGCCAA
> TTATTCTTTTCGATCACAAACCACGTGCTGCGTAGTTCTAATGGGACAACTCCTACTTAG
> CAAACAGTAGACAAGTTTGGAACGCATATCTTCAATTTGAAGCCAGATTATCCAATGGTA
> GCACATACTTGTTGAAAATAAAAACCCCCACATGACAGTAAATAAAATAGCCAAGTAAGC
> ATGTTTATAAAGCATGTATCCTAGATCAGCAATTAGTGGTATCTACATATGCACTGCAAC
> TCGTACACGATGTCGGTCATAAATCTATGAAACACTTACTACGAATACGGGTTTGAACGG
> AATTAAATAGTCGAAAAATTTAAATTCGTCGGTAACGCAGATGTTGGTTATCCTCTAATT
> GGATATACGGATCACTAGGAGAGAGGGATGGACGCGTCGGTTACAGAGTAGCCAACACTA
> TAAAGACGCGCAGCAAGATGGAGTAATTTCCACTACTTCACCTCGACCAGCAGAAATAAA
> GCTGTTATTATACATCGGGACATGAAGGTTTTATTCTTGTGTATTAGACATCTTACATCT
> GTTGATAGATTGGGCTTAAAACGTTTTTGTATTAATTGTATCTTAGAGTGTCATCTTCTC
> AGTTCTGCGTAGCTGCTTCAATGCGTGCTTCCTTCTTCTCCGTATACCGACATCAGTTAA
> AATTTGTCGTACTGCCGACACTTACGAGATTCCAATTTAATATGACAGTTAAATGCGCGT
> GCGCTTTCAAACCTCTATCAGGATAGGCTCCTTCGACCATGACGCGCTCTGAGAGGAAGT
> ACTATTTGTTGGTGCTGAGATTTAAACTCCCCCCATCCACTTGGGATTTAGATTCTTCTA
> ATCACGGGGAAGCTCCCAAGCGGTCTTCATGGAGTCTCAAGGCTGGACAACTTAAAATCT
> GTTATCGGAATCACTTTGTCGGCTATATTAGGTGCTATTATTTATGCAAGATGCGACATC
> TTACTTTCATGGCAGTTCTGTCAACAGCCAAAAAGTAATCAGCCGTAAATAAATCCCTTG
> CGTGGTAATGGATCCAGAGTTATTCGTATTCCTTTATGAATCTGATTAAATCAGCATAGC
> AGAGGAAGCACGTGACCTTAGCACATAAAAGTATTGTTGCGAATGATTGTACAAGATGTA
> GTGGCAGTTTATGATATTAGTTGATCAGAATAACGAGATCGCATTGTAATTAATCGAAGA
> CATGACTCATGTAGTTACACCTGACTTTTCAGTTTATACAGAATATTCCCTTACGTAGGT
> TTTTTTGTTAAAGCAAAATTTACTTCGCAAGTCTTTAAGGTCGGGTTTTTCTATCGGAAC
> ACAGCTCTTTACTTATATAACCTCTCTTAGGTCTAGATTATGGTAATAAGTTTTAATATA
> CCTGGAAATTATCCCCGTCCAATCAGAAGATCATACCCATACATAGGTACTAGCGAATAT
> GTGAGATTGTTTATTGTTTTGTCTTCTGGGGAATCACCTTTTGGTCCTAATATTATGTAG
> TGACATTATCTAAATTATTCTGCATAGATTAATAACCAATGTTGGGTAATTCTCTGTCGA
> ATACCTCGTTCTCTATCTGAACTATATGTTATTGATAATGTTACGCTCATTCGGGTTTAT
> TCGCTCACGCTGCGAATGTAACTTCTGGTACAAGCGTTCGATGAATGCCACATATCTAGA
> ACAAATGACAAAATTGTTTATTTTTAGTAGCTCATAGTTGTCCTCAAGTTCTGACCACAA
> TATATAGCTTACCTAATGGCGGAACTTTGAGTGCGGGCTACCACAATATTCGATGCCTGA
> ACTCTTCGTACTGAGCCGCCATGATAGGCATGACACTAAGATGCTACTCTCCGGCGCATT
> CGGTAATTTGTCTAAATCCGTTGTGTTTAGGAAAACGAGTTAGCGCTCGATCTTTTTATT
> CTGTGCGTAGGTAACGTTGATGAATGTATCTCCAGCTCTGGAATTGACGCAGAGAACGGT
> GACCCTCAACCATAAGGTAACAAGATGCGAGGGTCCTTTATTCAGCGGCTCCTCGCTCCT
> GCAGCGAATTATTTCGGAACATTACTGGCTTACATTGAGCAAGTTCCAAATGGAATCTCC
> TACCAAGTGCCTAATGCACGGGTCAGAATTTCGGAGATCTAATATAAGAGTGTCTTCACG
> GAAACTACTTATTGATCCGATGACGAAACCTAACAGTAATTCACTCCGAGTATATTTCGT
> TTTAACCTTAACCAAATTCTGTTGTTACCATGTTACCGTGAAGGAGCAGGTTTCCCCGCC
> CAGTATCCCTTTGTCTCTAGGCTTCAGACTTAATCTATTACGCGACTACAACTGCTTTGG
> GTATTTAAGTCGTGATGATAGGTATTGGGTAATTCTGTGCGAGCACTTTTAAACATTCAC
> GGTCGCGTTCGCTATCGATTCCAACAATTTTGAGTAAGATTGCTTCTGTGATTTGCGAAC
> GGAATTAGCCTAATCGATTATAGTCCATCTTAGAAGCCTAATTTCTTTTCCATTTCCCCT
> GAAGACTCGAAGGCCGCTACCGACTACAGTCATACGACATTTATGAGCCGTGATAAAAGT
> GAAGGGGTCCGCCTTGACAACACATTCATGGAAAACTATTTAATTAAAAAGTCTGATGAT
> TGTCTATAGTAGGGCCCTCAATTGCAATTTGAGCACACTAAGCGATCTTATGACAGATGA
> CAGAGAAATTGTCGTCTACCGGTTTACCTGGAAATGTCTAGACTAAAATTTAGCAATTCT
> AAGTATCAACATTTAGTTACCGTAACTGGGCAAGAGACTGCATCTATTACCGCTGAGTTC
> TAGGTGAGATACTTTAAATGGAGTCCCCACCCGGACAAAAAGGAATGTTGTATACAATGT
> TCAGTTTGCTGATATATCGTTCACGGGGTTGATCTGATTAACTAAGATATAGGATTGCTT
> TTCTAGAAAAAATCGGCTATTAAGACCTGTATATTATATCGACCCGTTAAACTTCTCAAA
> TAGGTCGATATAAGCTCGATCGTCAAGTTATATGCGTATTGTTTATCCTGTCCAGGCATG
> GCATTAAGAGTTCGTGAACTCATACGATCACCCACTGTACTTTACATAGAGAAATTGTTA
> CTATTCTGATTAAGCCCTAACCTAATCTCCGAGATTACAACCTTTATAACCAACTACATA
> GTTCTATGGAACAAAAACCGCTTTTGAATTCGCCCACACCCATCCGGTTTATCACCTATT
> TTATACCAAAATTCTACTACAGCCAATTGTACCACCTGTACTTTTGTCTAAACGCGTAAG
> TGCGAGCGGGAAAACATTTTCGTAATCTGATTCACTAATTTTAATCACTCTGTAGATACC
> AACAACAGTTTTATAGGCCTTAATCGAGTATGAATTTCCATTTCTACTGACTTGCTGAGA
> CACATTCACTGTATCCTTACAAAGGAGTATTTCTAATGCACTTACTGATGACATTTACCC
> ATGATTTAATTATGCTACGACGTAAGTTGTAAAAGTACGAGTCTTTTAGTCTTTAGATAT
> TTATATATATACTCCTGGCGAAATTAATACTAATTGAAGCTGGTTTTTAGATTAAGGTGG
> GGTACTGTTATAATTGAAGACCTATTTGCTCTTCCATCCTTTGTAATTGTACCGAGTGTA
> CGATACACTCAGTCTATAAAGGAATTAGTACAAACCACGGAGCATTCAAGAATACGATTG
> CAACGCATGCTAGCTTATCATATAAACTTTAAACCTCGATGGCATATATTATGATATGAC
> GTGTCTCACCCTACTTTGACTGTTAAAAAATGCTACTGGCACAACAGTCCCAAGCTTGAC
> CTAATACATGAACTCGATGCAGATCGTATCCGGTGTATTTATCTCTCAGAACACGATCTC
> TACTGATGCACCCAGTAGATTTTTCTTTCTATGTGAGGTTTTTTTGCGACAGTACAAAGC
> GGCGATATAGTGAGTTACGACTGTCAGTCGAGAACTGGTTTATAGAAAAGTTGTGTTCTT
> CTAGCACCATGATTATTAACTAGCTTTTCACGAGGTTTATGACAATTCTAGCATTAATCG
> TCTAAAGGCCCGTACTTCTCTGCGCTGGCTAAAACTGAGACCCTCTCACGCCGCTTGTAG
> GTGAACTAATGGTAAGTATCCTGTGCCCCCACAGCCATGCATCCAATGTCTGGATAAAAC
> ACATCACATTGACACAACATTTGCATAACTAATATTCCTAGTAAATATATTCCTTTGACT
> ACCCCCACGTTAATGTACACCATGCGGCATTTAAGCGCGATATTATAAGCATTTATCAGT
> CGATTACTGTTTGCTCACTCCGCAGACTTCCGCGTCTTCGTAGCTTCAATTAATGATTAA
> TCTATGAGCTAGTCGAATCAACACCAGGTTTATGTATGTTATTTACGTAATACTGTAGAG
> ATCCATTGTATTGATCTTTATGCTCTTTACGAACCGCTTTGTAATTACGTTCGTAGCCCG
> TAGAATTCAGTCAACAATATTCTTCTGTTGCCTTTCACCTACTTTCCAGGTGAGCTGCCA
> GTCATAACCGAATTAAGTCTCTCTGAATAAGTAACGCATTCTATGATGATGAATCGTTCC
> AACCCGACGAGTTTCTACAATATAATACTAATCCTTAACTTAATATTTGTTTAGCTTGTC
> GTCCTAACTCAATCCGTCTTCAGTATAAATATGGATGCGTATAATTAATACTGGATCTCG
> AAATGAGTCCTTAATAGTCTAAACGTATTGAAGACAGGCCAAGCAGGTAATGACATATAC
> TTTCAGCGGATTTAACAAATTCGTTAGTATGCTAGATTACTCCCCGACCAAAATCTAGTG
> TCCGACGTTACTACGTTATCAGTTTCTACGATGGCATAATGTAGCCAGATTATTTGTATA
> GTCTTAAATTATATTTATAGTCAAGTATACCTACAATCTAGGACTTTCTTAATATTCTGG
> GTAAGTGGGACATAATCACATCAGCAGATATAGTATAAATCAACTCAAAAGAGAAATGCT
> CGTGATGTTGTACTACCAGCAATAACGAACGATAAATATTGGTTTTTAAGTAGACTACTT
> TTTGGCGGCCTATATCACTTTCAACGCTTATAACACTTGGCCAATATTGATGATAATTGA
> ATTTGAGATTTTGGCACACACGATTGGCACATGGATGACCCTATGTCATTAATTTATCGC
> GAAGGGGGATACGTTGGCAAACCGGATTACAAATAATTTCATTGTTATAGTATATGTGGT
> ATCATTTTATACTTATTACTACCCATTGCCTAAATTTGGTTCCCACCTAAGTTAGAGCAT
> GATCATGACGGTCGTATGACACGAAGTCATCTTATTTGTTATTAGCCGCTAACTGGTAAA
> GCTCGGGTTATAGCGGATGCTTGATCAGTTGTGCAATATAACCTTTTATAAAGTATGGTT
> AAAGTTACAAAACCTAATTATACTGCTAATTGGAACTATATGAAGCCTGTGAACTTGAAG
> ATATAGCGAAATAAGAAATCAATGCACCGGCGAGTATGCTAACTTGTATGATGTAGCTCA
> GATAATCGTCATCCGGGGAACTAAAATAAATACGCGGACGTAATATCAGCTTAAATTGGA
> AAATAGATCAGTTCGGTAAACATGATGTTCTGATAAGACACTAGCCTATTTAATTTTGGT
> CCGATGATAGTAGCGATAGTATCCCCAAGGATTTGTAACATGTTATATATGGCAGATAAC
> GCATACATTGTTCATGCGCGATCCAGGGAAATCTAAACTTATCAGTATAACGTCAAACTT
> TGCAATAGTAGACTTTACCTCGTCGGTATATATCGAAGAACGTGCATTACCAGGTCAATA
> CCACTTTCCTCGTAGTTAATGGGCCATTATACGATGTACAACCTTAGTAGAAGGTCGGGT
> CACCTAGGAGAAAACATTCCCTATACGTGTAATATATCTATATACGTCGGCACAAAGTGT
> GGTCTAATGAACTTTTATGTGACGTACCCACCTTCGGTTAACGACTGGAGATGGTGTCCG
> GTACGAAGTAGAACTGGCGCAACGCCAGACTTTAGGTTGTAAGATATTCATGCCAATTCC
> AGATATAAGCAGGAATGAGTGGCCATTAGAATAATAATTCACAGCATATCGGGTATCGAT
> AACCTTTTGAATTCCTGGGCAGGTTATGGCATAAAAAGAAACAATCTGAAAGATGCGGTC
> CTACTTGCGAAACAGATTTGTCTTAAGATACGTAATCAAGCCTATTGACTTATCAATATC
> GGTATACACAGAACACATCTAAAATTACAGAATAAGGTAGATATGTCCATATATTTCAAA
> TACACTGCGTTGAGAGGGGGGTCGTGTTCTGACCATCTCTATGTCTGTAGAACCCTGGGG
> AGCATTTTCACCCCCTTTACTTGGTGACATTAGTTCATTCCTTCATTTACAATGAACATC
> AATACCTGATGACACTAGCCTTGACGTCAATATTCATGGCGGACTACTCTGACACGGCGG
> ATCAGTACACAGACACATCCCAGCTTTTGGTTACTTGGTACATTACTATCGTTATGTGTT
> TTTAAAAGGAATCCCAAGAGATACCGTTAAAAAGCAGATTTCTCTCTTTCGCCTACATCT
> CAAAATTGCAAATGTATGAGTAGGTTTCTAGGTGATTTACGGAGGCACCCGAAGTTAGGA
> GATTCAGTGTTTTGATCCTGGACCTCAGCGACTCTTGTTTAAAGAGTTGTAAATCTCCTA
> GGTTACAATTCCCTGCATACGTAGTATTCCCGACCTTAACTAGAGTATGAACGGTCATGA
> GTGAGGTATTCGTGCCTTGAAGAACCTATAAGAAATTCAAATTACGCACGGAACAGTTAA
> GTCCTGTACAAATGGCAAGGTATGCGTCTTCAACGAGTTAGTATCTAGATACAATTAACT
> ATGAGAAACGAAATACTAATCTGTAAATATCGCTAAACGGGACAGCAAAAACACCTAGAA
> GTCATGTCCAAATAAGTAACGTATGGATTCCATTAATTCGCCGGCTAAAATAAAGTGTCC
> TCATGCATCGATCTATATATCAGAACCATACGCATTCATCGAAGTTATGAAGCCTCATCT
> CTTTGTTGAAGAGCTGTTTTATTCCTTTTGGATAACCCATGCTTTTGGCTAACCATGACT
> GGATATGACACTTACGTTGAATTTTCTCATTCGACCGGTAAAACTTGCTCCTGCGTGGAT
> TAAATCAATGCTTTAAAACTATATCGCGAGCGTTTTACCGAGAAGTTATCCGATAGACTT
> GAAAATGTAGGGAGGCGTCACCCACTCTTGCCCGTACTATCTCAAAGATAGTATCGAGAA
> GTCCCCAGCCATGTGCTTTGATTTTTGTTGTATCAAAACGATGTAGGTCAACCTTAACCC
> GTCCTGATATCTCCACCCGCACAGTGGAAGAATCATTTAGAATTGGTGATTGTGAAGTAA
> TATACAACCAAAGATATTTATAGACTCGATAAATATCAATGGTTTAAATTACCATTTAGG
> CTTTAATCGACACAAAAATCATGATTGACGACTGGTTTATAAATTCAGTCAATCGAGAAA
> CTTGCTTCTGAATCCCCTTCATTTATACTGTCTTAACAACTACCGCGCAAGCTGACAATT
> TTTCAGTGTAATTGATCACTCGCCCTGACCTCATTTATCTGGAATACCAATTAATCTACA
> AACCCTCTAACGTTTTACATGGTTTATCCTAACGGAACAACCACTTACCCCCTAGTCGGA
> TCGGGGTATCATTATCTGTAGCTAATGGATGATAGGTTAAAATGATTCATCACTTAACAG
> TTTCCCACCCTTACGGTGTTATTTATTGAACCGTCATTTGTTAATAATAATATTAGACTA
> GAAGAAGTTTTCCATCGATTAATTCAAGTATGAGACGGCACTCCAGGGGTTTGAATCAGG
> CCCGACCTTATGAAGATGTCAGGGCGGTTAAACCTAATCTTCCAGCGGAAGTCCGCACTG
> GCAAAACTCCTTAGCTGCTGAAGCTAGACTTTATAGCGTATACCATCCTGAGGAACGCTA
> AGATCCTATGTATAATGTTCTTATATTGTTTGACCTTATATGCAGTTTTTCATCTGGCAA
> TAGCCCTTATACATGTCTCAATTCAGGTATCAAGCAATAGATTACTTTTTTCAAAACCAT
> ATTTGCGGCATAAGCCACATCCACCACCAACTTCTATAGTCGCGTGCAGGGGAGTTCCCG
> CGGTCTACAAGCAGGAATGGTCAAGTTGGTCAAATGTCGTTGCAAACGTAAACTCTTGAT
> ACTAATCCTATGTAGGCCACATGCAATGTTTCTGGCCATAAGTTCATGGCGTCTGGTAAC
> TCCGGTGATAATTAGGAGATTCACTGCGCCGATATAATTACGAACATAAACTCAGTAAGA
> GAATTGAACCGTAGACCAAAAGGGAGTCTTTAGGAGTAGGCTAATCTATCCATGTGGTTT
> CACGCAGGGGAATAAAAATACTATTCCCAATAACATAATCCGAATAACAACAAATGTAGA
> CTCAACGAATTTTAATGTTAGCGTATGGCTGCTGCAGCAGTGTACGTGTCAGTACACTAT
> TCTGTGTAATCCAAAGAGGCGTTACTAAGACGAATTTCTACCTCAGGCGAGTGGATCTAT
> CGAACATATTTTCCGCCTAGTTTACAAAACTTCAGCAGAGCTTAAAAGGTCAGCAAGGGT
> TGGGAACGACATCGTTGGGAGATACCAGTGTTCAGGGATTATCTGTAAAACCAATCTGCT
> TAGCCTTTTTGAAAACCCAAAACAGGTGTGGTTGCAGAATAACACCTGAAATTTATGTTA
> CCACTTTGTACGTCCTAAGGGGCTTGAGTATTTTCATGGTTATCTATTTTTACTCATAAA
> AAATGAATATAATTGGCCAGGTCAGGTCTGGATCAATTTTTATAAAATCATATCATCAAA
> GCTAGCCATACAATCCAACGAAGCGAGATCTGTTATAGTACTTGTCTATATCTAACTGAT
> ATCTTATCCACTCTGTGCTAGACTACCATTTAGGTAGAATATGCTATCACAATGCTAGCC
> AAGATCTCAATGACTCGCTGACGTGATACTCTTGCTGTTTATCTTATTGAATATGAACCC
> CAAGAAAAAATCTATAGCGCATATGTGGACTTATGTTGGCAAAGGACTCCTTCGACCATT
> ATTTAGTGAATATTTACTTATTATCTTCCTCCGTTGAAATGTATTTGACGTATGAATTAT
> AGGAGTAGGCTAGTAAATAAGTCACGTTGCAATGATCGATTTGAGAATTCAAAGTTATCA
> AGTTCTCGTTGTCTGTGTGTCTGCCCTTACTGGAGTAAGGGCCAGTCGGAACCCATATCT
> GGGTCAGGATAGTGATTGTTAAAAGTCGGAAATCAACTAGTTTTACTACCTTCTATTACT
> ATGATGGCCCCATGGTGAGCCCGGACCAATGAAGGAATGGCATATATAGCAGGGTACTTT
> GGGAATTCCGAGTAGCACGTACCAACCTGTTTCTAAGATTCTGAGATTTGGTAGTAAAAA
> AGCTAAAAAGTCATATTGTATCTTGCAGAGGAAGCTTAGAGAACTTGCAGACGCTATAAT
> TCTAGGTTACGCTTCACATACGGATTTGCTACGCGGTGCAACTGATATGTATCTTTTTTA
> AATCGCAACCACATTTAACCTTTATTATTGGTATATTGCGTGGTATAAAGATATCGCGTG
> GCGGAATAGATCACTGCTGTGGAGGCCGGCTATGTTTTATTGGGGATTTCCTATCTAACA
> GGCTATATCCCTTTCGTTTCGTAACTTTATCCCAACATCTTATGGGTTATTTAATAGTCC
> CATCCTAAGTTGCCAATAAGTCTGAATTCCACCGTCTTAGTGGTGATGAAAATATTTTTA
> TGTATCATATTGTTAAGCCAGTTGCAGGCAACTGATTCTCTCTCGCTCGTTCCTTCGACG
> ACAGTAAAGAGCGATTTATAATAATATAGCTTCTAAGTGATTGACACTTCCTATGAGGCT
> GTCCTGATTATTGCTCTCGAATCATTAGGCTCTAACTGAACTCTGAACAAAAATAGGTCA
> ACGTATGTTAATTGCGATTTTTCTACACTCCCTGTATATGACTGTGAAATTGATACATTA
> TGAACGAAATCACAAACGTGTTGGAAAAGTTAGCGCTAAGCTCACGCACGCTTTAGGCAG
> TTAATGATGGGCGTTCGTAGCTCTAACCCTAACGTGTTATGCAAGATCTTCTATGACTGC
> ATCCAGTGTCTGCTAAGTCCCGACTATTGTCTACATTTATACTCCTACGCTTGCCTACTA
> AGCGGCTTTCTAATTACACCTGGACTGATGTGTTTTAAGTGATTGTTGTACTTTTTAACG
> TGATGTTGCTTAGATCTGGAAAATATTTGACAATAAGTGCCTGTTAATGATGCATTCTCT
> AGCTGGTTAGCCATTCCTTCACTAACTGACCTTAATGTGATTTTAGTGTCATGTCTCTGA
> CTTTAGGTTTTGGATTAAATTACTGAATTGTTGACCATGTCGCAAATAAGTCGAACGCAT
> GTAGGCGTGTTCCGACTGTGTAATAATCGATTAAATAAATGTAACAAAATGCCCTCTGGC
> TAGTGTTTGGCGCCTGGCATATTTGCATAAACGGCTACAATGCTACTAAAGTTGGGTCGG
> GTCAATAGAACATGTTAAGTATGTGTATGTGGCCTAATGTGATTGCGACCCTAGCCCTCA
> CTGACTATTTAGATGAATAGAATAAATTTTTACCGGTATACTCAATGTGAGTTATCCAGA
> GATAAAGACGTTTGAGGTATCCCATTGATATCGACATCAACCAAAAGTCACGAGCTCGCA
> GCAAAATTGCCTATACACAGTCCACACCGCATCCGATCTTCAAAGCTCCGACTCGACACT
> AAAGGTGACGTAGGCTAAATCTATAGTATATTTCGTAGAAGCGTAGGTAATCTTGTATTA
> CTGAATCAACACAATGAGAGTTGCTTACTCGATCTGAAATGCGAGTTTCTACGTAGATGT
> CGCAATAGAGAGCTTACTCTGTGCATTTCTTTTCTCGGCCTCCAGACTCGATAATCGCTT
> GAATCTAAACCGATCAGGATTGAGTGCACGGCGCAAGGACGTTTAAATAGAGGTAAAATG
> TTGATTACCATAAACCAGATCAATAAAGTTACAGTACCGGCTATAAGAAACATCTTCTCT
> AAGAATCTAGATGAGGAGGCGAGATCCAGTCAAATTACAATTCGTATCAACAACTAACTT
> AGATTCATTAGGGTGTGCTGTACTCAAAGACAGAAGTATAAGTCGCCACGTTGATTCGCA
> AGGTATGGTGTAAACAGTTCACCTTCAGTGCATTGAGAAATACATGTGTATGCTCGGTTA
> TCATGAGTACTAGAGTGGTTTATTCAAGCTGATTCGGTAGACCGGTGATATATTGGTACA
> CTCAGTCTAGATTAAAAGGGGGCATCTAAAATGTTCTCCAAGTGATATCATTCGCTTTCT
> GTAGTAAACATCAACTTCGTAGATTACCTGTCTTTCGGTGGTGTTTTAGCCTGTTAATTG
> GATGCCGAGAATCCTAGTTGCATATTATTCTGTGCCTGCAAAAAAATAGGCATGCGTACT
> GCTAAGCCGAAATAGACTACTTTGCAATCAGTAGAATACTGTCCATCGCATTGATTCAAG
> TGGAAGCAAGATTATACTAGGCGACATAATTCTGGTGCTTATTTAAAAACAACTCATGAC
> AGTATTGAATAGAGAAAAGTAAGCATCTGTATAATGAATCTATAATTGATCAGCAATTAC
> TGGTAGCGACTGTTGCAATGCAAAGACGACACGATCTCGCTCATAAAGATATGAAAAAAT
> TTCGTCGTATTCCGCGGTGAACGCATGTAATTACTCCTAATAGTGAAAGTACTCGGTAAA
> CCAGTTCTTGGTTATCATCTAAGTCCTTAGACCGATCACGACGTCACAGCGTTCGAACCC
> TAGGGTACAGACTTGCCTACTAGATAAACTCGCCATGATTCTTGCAGTTAGGTCATCTAA
> TTCTCAGACTCAACATCTTATAAAGCGCGGTTGAGAATGCGGGACATGTTGCGTGGTTTC
> TTGTGTATTTCAAATATGTCATAGGGGGAGTGATTCCGATTTAATCGTTTTGCTTGTTAG
> GGGATCTGAGTCTGTAATCGTATCTCTGCGGACTAGAGGCGTATTTCCGTCATTACTTCT
> GCGACCGATACCCTCATCAGTTAATATTGCTCCTAATGCCGACAATTAAGACAGTCCATT
> TTAATATGACTGGTTAATGCGCGGGCGCGTTCTAAACGCTAGCTGCAGAGCATACTGCCA
> CCATCTCGCGCTCTCAGAGGTAGTTCTATGGGGTGCTGCGCTGTGGTAAACTCCACACAG
> CCACTTGCGTTGTAGAGTCGTAGAAGAAAGGCCAAGCGAAAATGCGCTCTTAAGGGACGC
> TCAACGCTGGAATAATTATTATATCGTTTCCGAATAACGGTGGACCCTATATGTGGGGAT
> ATGAGTTTTCAAAGAGGCGAATTCTTAATTGCATGGAACTTCTCGATTCTGACAATATGT
> ATTCTGACGTAAAGAAAGCACGTGCGTCCTAAGGGATCCACAGGTATTCCGATTCATGTA
> TCAATATGAGGAATTCAGAATAGAACACCTACAAAGTGACAGTAGCAAATAAATGTTTTG
> GTCCCTATGATTCTAAATGATGGAGTCCAACTTTATGAGTTTTGTTGAGCAGTATAACGA
> GAGCGCTTGCGTATTAAGACTTGACATGAAGCATGTAGGTACTACTCTATTGTCAGTTTA
> GACAGATTAGTCACGTACCTTCCTTTTTTTCTTTATCCTAAATGTACTTACCAAGGCTTG
> AAGGTCCCGTTTTTCGATCGGAAAACACCTAGTGACTTATAGTAAAGCTCGTACCTATAG
> TTTATCCTAATTAGTTTTAATATTAATGCTAATTAGACACGTACAATCAGAAGTGCAGAC
> CCTTTCATAGGTAAGACAGAAGTTCTGAGTTTGTGGTGTGTGTGCTAGGATCGGCAATAA
> CATGTTGGTCCTAATTGTATGGAGGGACTGTATCTATTTTAGTCTGCTTTGTTTTTGTAA
> AAATGTTGGGGAATTCTCTCTAGTATACATAGGTCTCTATCGCAACGAGTTGTTATTGAT
> TAGCTTAACCTCAGTCCCGTGGTTTCGCTCACCCGGCGAATCGAACGTATGGGAATAGCG
> GTAGAGGAATGAAACATATCTTGAAAAAATCAATAATGTCTTGAGTGTTAGTAGCTCATA
> CTGCTAAGCTTGTGATGTCCAATATAGAGACCTTAACGAATGGCCGATATGTGTCTCCCG
> CCGTCCAAAATATTCGTTCACGCAACTCTTACGTATGTGCCGCCATGATTCCCATCAAAA
> TATCAGGCTAATCTACGGAGAAGTCCGTTATTTCTCTTTATCCCTTCTGGTTTGGAAATC
> GACTTTCCCATACATATTTTGATGCTCTGCGTAGCTAAACTTGATGAAGCGATCTCCTGC
> TATCCATTTGAACATGAGAAACGTCTCCAGAAACCATTAGGTATCAAGAGGAGACCGTAA
> TTTATTCAGACGATCATAGCTCAGGAACAGATGTATGTCGGTTAATTAATCGCGTAAAGT
> CACAATGGGCCAAATGGTATCTCCTACCATCTGAAGTATGCACGGGGCACTATTTCGCAG
> ATATAATTTAAGTCTCGCTGCAACGAAAAGAAGGAGTCTGAAGATCAAGTTTACTAACAC
> GAATTAACGCAGACGAGATTTCCTGGTTACCGGAACAATTTTCTGGTCTGAAAATCGTTC
> CGGGAAGCACCACGTTTACACCCAAAGTATACCTGTGTCGCTACCCTTAACAAGTATTAT
> ATTTACCGTCGACAAATCCTTTCCGTTTTTTAGTCCTGAGGTTTCGTATTCGGTAATTCT
> CTCCGTGATCGTTGATACAGTAAAGGTCGACTTAGATATAGTTGACAACTATTGTCACTA
> AGAGGGCTTCTGTGATTTGCCATCGCTATTAGCAGAATAGAGTTGACGCAATAGTAGATC
> AATATTTTCGGTGCCTGTTCCAAGCAAGTAGCGTACGACGCTACCGTCTAATCGCTTAAG
> AAATTTAGCAGCCCTGTTAAAACTCAAGGCCTCCGCAGTCTAAAAAAATTCATCGATAAA
> GATGTAATTATAAAGTAGGTTCATGCGCTAGAGGAGCGCCATCATGGGCTAGTTGTCCAA
> ACTAAGAGATCGTATGTAACAGGAAAGAGTAATTGGACTCTACACCTTTTACTGCAAATC
> GATAGTCGATATTTTACCAATTCGAAGTATCAAAAGGTAGTTAACGTATATGCCCATGAG
> ACTGCATATTGTACAGAGCACTTATACCGGACTTAATTTAAATGGACTAAAATAAACCAA
> TTATAGCTTTCTTGGATTCAATCTTCACTTGGCTCATAGTGCCGTATCGCGGTTCAGATG
> ATTATAGAAGATAGAGGATGGATTTGATACAATAAATCGCAGATTTTGAACTGTTTATGA
> GATCGACAAGTTAAACTTATCTAAGAGCTAGAGTTATGCGCGATCGTAAAGTGTTATCCG
> GAGTCGGTAGAATCTCATCCCATGCCTTGTAGAGTTCGGGATCGCTTACCTTCACCCAAT
> CTAATTTACAGACACTAAGTGTGACTAGTCTGATTTTCACCGAACCGAATATCACAGATT
> TAAACCTTTAGTACCTTATACATACTTCTATGGTACATAAACCCCTGTGGAATTCGACAT
> ATCCCATACCGTTTTGAACATATGTTTTTAAAAATTGCTTATAAACAATAGTCTACATCC
> GCGACGTTTGTCGAAAACACTAAGTCACTCAGCCATTAAATTTTAGTTATCTGTTTAACG
> AATGGTAAGCTCTAGCGTCAGAACATCAACTCGTTTATACGACTGTATACACGTGCAATG
> TACTTGGATACGCTCTTGAGGACTATATTTCAAGGTTTACTTTCATAGCAGTAGTTCTAA
> TGCACGTACTGTGGTAATTGAAAAAGGATTTAATTATCCGAAGACGTTTGGTCTAAAAGT
> ACGAGGATGGTACGATTTTCATATTTATATATTGACTCCTGCCGATATGTAGAATATTTG
> AAGCTCGTGTTTAGATTAAGCTGGCGTTCGCTGAGAATTGTAGAAATTTTGGCTATTCAA
> TCCTTTGTAATTGGAAAGACTCTAACATAAACTAAGGCTAGTAAGGAAGTACTAAAAAAA
> ACGGTGCATTATAGAAGTCCTGGCAAACGCTTCCTAGCTTATATTTGAAACGTTAAAACG
> CGTGGCATGATTGGTTCATAGGAAGTCTCGCTACCTACTGTGAATGTTAATAAAGCCTAC
> GGCCAAAAAAGTCCCAAGCTGCACCTTATTAATGAAATCGTTGCACAGAGTATCCCGTGT
> ATTTTTCTCTAAGAACAAGTTAGCGTCTGATCATAAATCTACATTTTGAGTGCGATGGGA
> GGGTGTTGTGACACAGGAAATACAGCCGTTATAGGGACTGTACACGCGCTGTCGAGAACT
> CCTTTTTTGATAAGTTGGGGTCTTATTGCTCAATCATGATTTTCTACCTTTTATAGAGCG
> TTATCAAAATTCTACCTTGAATAGTCTAAAGGACACTACTTCGCTCCCCTGCCGTTATAG
> GACACACTCTCACGCACCGTGGACCTGAAATAAGCGTAACTATCAGGTCACAAAAAACAC
> ATCCTTACATTCTAGGCAGAAAACAAATAACAGTCACAAAAAATTTGAATAAATAATATT
> CCTTGTTATGTTATTCCGTGCACTACCACCAACTTTATCGACACAAGCCGCATTTGTACC
> GAGAGTTGTTTAGCTTTTTTCAGTAGTGTTCTCGTTGCGAACTACGCACACGGACGCGGA
> GTAGTTGCTTCAAGGATGGAGTTATAGTTGACCTACGAGATTCTTCACCACCTTTATGTT
> TGTTAGGGACGGATGACGGTAGACATACATGCTTTTCATCTTGTTGCGATGTAACTAACC
> CTTTGTATTTACGTTCGGAGCCCGTTGATTTATGTAAACTATTTGCGTAGGTGCACTGGC
> AACTAATTTCCAGCTGTCCGCCCAGTATTATCAGAATTTACGCGCTATCAAGAACTATAC
> CATGCTAGCTTGAGGTTTCGTTCATTCCCGAAGACGGTCTAATAGTTAAGACTTATCAGG
> AACGTTATTTTTGGTGAGATGCTCCTCCTTAAGAATGCCCGATTAACGAGAAATATGGAG
> CCGTTTTTTTTATTATGCATCTCCATATGTGTCATTTATTCGATTATAGGTTTGTACACA
> GCACAAGAACGTATTGAAATTTAATGGAAGCGCAGTTAACTTATGAGTTAGTTTGATAGA
> GTACTCACAGACCAATATAGAGTGTCCGAACTGTATAAGTGATAAGTTGATAACTGCCCA
> GTATCGTGACAGTTTATTTCGATTCGCTTAATTTATTTGGATAGTAAACTATAACTAATA
> TATTCGTCTTTATTAATTGTATGGGTAAGGCCGTCAGAATCTAATCAGAACATTTAGTAT
> AAATCTACTATAAACAGAAATCCTACGGATGTTCTAATTAAACCTATTACGTTCGAGATT
> TATGCGTTTGTAACTACAAGACTTTTGCGCGGCCTTTATAAATTTCAAACCGTAGAACAC
> TGGCCAAATATTGAGCATAATGCTAGTTGAGTTTGTGGCTCAATCCAGTGCAAAATGCAT
> CACACTATGTCATTAAGTTTTCGCCAAGCGGGATTCCGGCCCAAACCCGATTACAATTAT
> TTTCATGCTTATTGTATTGCTGGGTTAATTTGATACGTATTTCTACCCTGTCACTAAATT
> TGGTTAACAAATAAGTTTCACCTGGTTAAGCTCCGGAGTATGACACGTAGTAATATTAGT
> TCTGTTTAGACCCTAAAGGCTAAAGATCCGGGTAGTCACGATGAGGCATCACTGGTGATA
> GATAAACTTTTTTAAAGTTTGGTTAAACGGACATTACATAATTAGACTGCGAAGTGCTAC
> GTTATCAAGCATGGGTAATGCATGTTAGACCGAATTTAGATATATATGAAAACGACACTA
> TCCTAACGTGTTTGATCTACAGCAGTTAATCCGCTTCCGGCGTAATAAAAGAAATTCGAG
> CTAGTTTGATAACCGTTTATGCCATTATAGAGCACTTAGCTTAACTTCATGGTATGTGAA
> CAAAATAGCATATGTAATTTGGGGAACAGCAGACTTCACAGTGTATCACCTAGGAGTTGT
> TAATTGTTATTTATCGAAGATAAACATTAAATTCTTATTCAGACATACAGCGATAGCTAA
> ACTTATCAGTAGAACCTCAAAATTTCAAATACTACTCTGGAACGCGTCCGTATAGATACA
> AGTACCTGAATGAACTGGTCATGACAAATTGACTCCTTGTTAATCGGACATTATTCGTTG
> TACTAAAGTTGGAGAAGGTAGCCTAACATTGGACATTACAGGCCAGTTACCTCTATGAGA
> GCGATTTACCGCGCCACTAAGTGGGCGAGAATGATCGTTTATGGGACGGAACCACATTCC
> GTTATCCTCTGCACATGGTGGACGCTTCGAAGTACAAATGGCCCAACCACACAAGGGAGG
> GTGTTAGATTTTATTGCAATGTCCTCTGATAAGAACGTATGACTGCACTTGACAATAAGA
> ATTCAAAGAAGATCGCCTTTCCTTAACATTTTCTATTCCGGGGCTGGTTATGGCTTTATT
> TCTTACAATCTCAATGATGCCCGCCTACTTGACAAACACATTTGTCGTAACTTTAGTTTT
> CTAGCCTTTTCAATTTTAAATTTACCTTTTCTAAGAAAACAGCTAAAATTAATGAATAAC
> CTTCATAGCGACATTTATGTCTTTTAAACGCAGGTGTGAGGGCGGTACTGTTATCACATT
> AGCGTGCGATGGACAAAAAGGGCCAGCAGTTGCAACCCAGTGAATGGGTGACATGTCTTA
> TTTAAGTCAGTTACAATCAACTTCTTTAAAGGAGGACAATACACTGGACCTCAATATTAA
> GGCCGGAATACGCTGTAAAGGACCATCTGTTCTATGTCAAATAACAGATGTTGGTTACGG
> CCTAAATTAATATCCGTTTCTGTGTTTTATAGCAATCAAAAGACATACAGTGTTATAGCT
> CATTTATCTCGGTCGCCTTCATCGAAAAATTGCAAAGGTATCTCTACCTGGATTCGTGTT
> TGAAGGACCCAACCCATGTTTCGACATGCACTGTTTTGATAATGCACAGCAGCGAATCTT
> GTGGATTGAGTGGTAAATCTCCTACGGGTCATTTCCATCAATACGTACTATTAAACAACT
> TTAATAGTCTATCTACCCTCTTCACGGAGGTATGAGTGCCTTGAACTTACTATATGAAAT
> TCATATTACGCAACGAAAAGGGAAGTAAGGTACAAAGCGCTTCCTAGCCGGCTGCAACGA
> GTGAGTATCTAGAGTCTTGTAAATTTGACTATAGAATTTCTATGATGTAAATATCGATTA
> ACCGCAAACCTTTAAAACCTACATGTATGGTCCTTATAACGAACGTAGGGATGCCATGTT
> GGAGAAGGCGAAAATTAACTCGCCGAATCATTCCTTCTATATTTATGTTACAGACGCATT
> CATCGAAGTTAGGATGAATCATATCTTGGTTGAAGAGCGCTTTGAGGCATGTGGCAGAAC
> ACATGCTTGTGCCTAAACTTCACTGGATATGAAAATTAACTTCAATGGTCTCTTTCGAAC
> CGGATTACGGGCTACTCCGTGGAGGAAATAAAGGCTTTAATTCTTTAGCGCGAGCGTTGG
> AACCACTTGGTTTAAGATACACTTGAATATGGAGGCAGGCCGCACCCACTCGGGCCACTT
> ATTTCTCTATGAGTGTAGCCAGAACTCCCAACAAATGTGCTTTCATTTTTCTTGTAGCAA
> ATAGATGTAGCTCAACCGGATCCCGGCCTCATAGCTCAAACAGCTCAGTCGAACAAGCAG
> TTACAAGTCGTGATTGGGAAGTTATATAAAACATATGAGAGTTATTGACGACATAAAGAT
> ATATGGTTTAAATTACCAGGTTCGAGTTTTTCGACAAAAAATTCATGATGGAAGACTCGT
> GTATTTTTTATCTCATTAGACTAAAGTGCTTATGTAGCCCATGCATTGATTCTCTAGTAT
> ATTCTTCCGAGAAACCGGTAAAGTTGTAAGGGTAAGTCTTCACTACCAATCACATCATTT
> AGCTCCAAGACCTATTATTCTACATACAATATAACGTTTTACTTCGTTGATCATTACGGT
> ACATCAAATTTCAAACTACTAGGATACGGCGATCAGTTTAGGTAGATAATGGTTCTTAGC
> GGAATATCTTTAATCAATTAAATGGTTAAAACCATGAAGCGGGTATGTATTGATCACTAT
> TTTGTGATTTAGTATAGTTGACTACTAGATGGTTTACATCGTTTAATGCAAGTATGACAA
> CCCAATCCACGCGGTTGAATAAGCCCCCACCGTATCAAGAGGGAAGGGACCGTATAACGA
> TTCTTCCAGCGCAAGTCACCACTGGCAAAACGAATTAGCTGATGAAGCTACTATTGTGAC
> CGGATAACATCATGACGATCGCTATCATCATATCTATAATGTTCTTAGAGTGTTGCTAAT
> TATATGCTCTTTGGCTGCTGCCATTACACCTGATTCATCTATCTTTTCAGGGTTCTTCAA
> AGTCATGACTTTTTTAATAACCATAGGTGCGGCAGAAGCATATTCATAAAAAATAGTCGA
> TTGTAGACGCAAGGGGACTTACCCAGCTATTATTCCTCCAATCCTAATGTTGGGATAATG
> TAGTTGAAAACCTAAACTATTGAGACTTAGAATATGTAGCCAAAATGCTATGTTGATGCA
> AATTTGTTCTTGGAGGATGGTAAATCCGCGGAGTTTTTGGTCTGTATCTGACCACAGAGA
> ATTAACATCAGAAAAGAAGTAACTGATTTGTTCCGGACACCAAAAGGCTGTCTTTTCGAG
> TTGGATATTCGAGCAAGGGGGTTGAACGCAGCGGAAGTTTATGACTTGGCCAATTATCAG
> ATTCCGTAGAACAACTATTGGTGTATCATAGAAGTGGTAGCTTAGAGGAGGCATGATGAA
> CAACTCTACCGCGAAGTTAACTATGCGGTGTATTAAATTCAGGCCTGAATAACAAGAATT
> TAGACATATCCACTGTGCTTCTTTCCAAATTAGTTGCCGCCTAGTTTAAAATACTGAACA
> ACTGCTTTAAACGTCACAAAGGGTGGGGTACGTAAGAGGGGCGTCAGACAACTGGTATCG
> GATTATCTGTATATACAATATCCTGAGACTGTTTGAAAACCATAATAACGTGTGGTTCAA
> CAATATCAACTCAAAGTGATGGGACCACTTTCTACGTCCGATCGGCCTTCAGGTTGTTCA
> TCCTTATCTATTTTGACTAATAATTATTGAATTGATTTGGAAACGTATCCTATGGATAAA
> GTTTTATTAAAGCAGATCATATATGCTTCACATTCATTCAAAAGTTCAGTGAGATCTTAT
> ACGACTTCTATTTTTCTAAATCTTATCGGATACACGCTCTCATAGACGACATGTGAGCTA
> CAATTTGATTTCACAATGATAGACATGATCGCAAGCACTCCCTGTCGTCAGACTCTTCCT
> GTTTATATGATGGAAGATGTACCCAAACATTAATGCGTTAGACCATAGCTGCAATGATGT
> TCCCATACCAAGAATTCGAACATGTTTTACTGAATTGTTTCTTAGGTTCTTAATCCGTGC
> TATGGGATTGCAAGTATGATTTTTAGCACTAGGATAGGAAAGAAGTAACCTGCAAATGAT
> CGAGTTGAGAATGCTATGTTAGAATGTTCTCCGTGTATGTGGCTCGGACCTGACTGGTGT
> ATGGCACTCGAGGAACCCTTAGAGGCGTAAGGTTACTCATTGTTAAAAGTCCCATTTAAT
> CTACTTTTAAGAAATTCTTTGAATAGGATGGCACCATCGGCAGACAGGAAAAATGTAGGA
> ATGCATTAGATAGATCCGTTCTTTGGGAATTCCGACTAGAAACTTCCAACATGTTTATAA
> CTTGCTGAGATGTGCGTCGTAAATAGCTTTAAAGGAAGTTTGTTTCTTGCAGAGGAACAG
> GACAGAACTTCAAGTCCAGAGAATTATAGCTTACGATTCACTTTCGCATGTGCTACGCCG
> GCCAACTCTTATCTATCTTTTTTTTAGACAATCAACATTTAAACTTTAGTTTGCCTATAG
> TGAGTGGGTGTAAGATATAGCCTCCAGGAAGACATAACTCCTGGGGAGGCAGCATTTGTG
> TTATTGCGGATGTCCTATATTACTGCCTTGAGAAAGTTCGTTTAGGTACGGTATCCAATA
> ATCGTTTCGGTGATGTTAGAGTAAAATCCTAAGTTCCCAAGATGTCTCAATTAAACCCTC
> TTACTGCTGTGGAATTTATTTGTATGTATCAGAGGCTGAAGAATGGTGCAGCAAACTGAT
> TATATAGAGCGCGTTACTGCCTCCAAACTTAAGAGAGAGTTATAATTATAGAGAGTATTA
> GGGATTGAAAAGTCCTATCACGCTGTCCTGAGTATTCCTATCGATGATGTTGGCGCGAAC
> TCTACTAGCATCTAATATAGCTCATCCTATCTTATTGGCGATTTTGATAAAAGACATGTA
> TATGAATGTGAAATTGATAAAGTAGGAACGAAATCACAATACGCTGCCAATACTTTCCGC
> TATCCTAAAGATCCATGGAGGCAGGTAATGATGCGCGTGCGTACCTCGTTAAAGATAGTG
> TTATGATTGATCTTCTTTCTCTGAAGAAAGGGTATGCTTTCTCACCAAGATTGGCGAAAT
> TGATACTCCGAAGATTGAATACTAACACCCTGTCTATTTTCACCGCGTCTCATGTGTTTG
> TAGGGATTCTTCTACGTTGGTTAGGGATCTTGCGTACTTCTGCAAATGATTTGACAATAA
> GGCCATCTTAAGGATGCTGTCTCGAGAGCGTTACCCTTTAATGAAAGTACTCAACGGTTG
> CGCTGTGTAGGGTCATCTCTCTCAATGTACGTTTTCCTGTATATTAATCTATTGTTCACA
> TGCTAGCATATAACTCGTAAGCATGTAGGAGTCTGAAGAAGCTGTAATAAGCCTGTAAAG
> AAATCTTACAAAATGAACTATGGATACTCTTGGGCCCCTCGATTATTTCAATAAAACGCG
> AAAATCCGTCTAATGTTGCGTAGCCTCAAGACAAATTGTGAAGTATCTCTAGCTGGAAGA
> TTGTGATTGACAAAATTGCCCTCACTGAATATTTTCTTGTAGTCTTTAAAGGTTTACCGG
> TTTAATCAATGTGAGTTTGAAACAGATAAAGTACTTTCAGCTATACATTGCATATCCTAT
> GCATCAAAAACTAAAGTGCTCGAACCAATATGGCCGATACTCACTCATCTAAGAATCCCA
> TCTGCAAACAGACGACTAGACAATTAACCTGAAGTTGGCGTTATCTATAGTTTAGTTCGG
> ACTAGAGGTCGGTATATTCTATTAAGGAATCTAATCTAGCTGACGTCCTGACTCGAGCTC
> AAATGCGACGGTATACCTACATGTCGAAATACACTGCGGTATCGGGGCATGTATTGGATA
> CGCCTAAAGACGACATAAGCGATTGATTATTATCCGATCACGTTTCTGTGCACCGAGCAT
> GGAACTGTATATACAGCTATAATCTTCTTGACCTGAAACCTGTGAAATTATGGTAAAGTA
> CAGCCGATAACAAACTGATTATCTAAGAATCTACATCACCAGGCGTCTTAAAGTAAAATT
> ACAAGGCGTTGAATATACGAAAGTTGATGAAGTTCGCTGGGCTCGTCGCAAACACACAAC
> TAGATGTCGCAACCTTGATGAGCTACGTTGGCGGTAATAAGTTCACCGTAAGTGCATTGA
> GAAAGACTTGTGTTTCATCGGTTATCATCTGGACTACTCTGGGGTATTCAACATGATTAC
> GGAGAAAGCGGATTTATTGGTAAACGATGTCTAGAGGATTACGGGCCTTATAATTGGTTA
> TCCATGGGAGTTCTGTCGCTGTCGCTTCGTTAAAGATACGGACTACATGTCCTCGCGTGA
> GCTCGTGGTTGAGCCTGTTAATGGGATCCCGACAATACTAGTGCCATTTGAGGATGTGAC
> TGAAAAAAAATAGGCATCACGACGGATTTGCCCTATTAGAAGAATTTCCTATAAGTTCAA
> TACTGTCCATAGCATTGATGCTAGGGGATGAAACTGTATACTAGCCGTCATAAGTATGCG
> GCTTTTGTATAAAAAACTATTCAATCTTTTGAATAGACAAAAGTAACAATCGGTTGTATC
> ATGCTATAAGTCAGCACATTTTACGCCTTGAGAATGTTCAAAGCAATAGACGACTCGTTC
> TCCCGAAGATAGATATCATTATATTTAGTACTATTCCCCGGTGTTACCTTGTATTTACTA
> CTAATAGTGAAAGTACGACGTAAACCACTTCGTCCGGTTAATATTTGTCCTGAGTACCAT
> CTCGTCCTCACTCCCTGCCTACACGACGGTAATCACTTGAATAATAGATTTACTACCCAT
> GATTCTGCCTCTTTGGTAATCTTATTATAAGACTAATCATCTTTTATACAGCGGTTGAGA
> ATGACCCAATGCTTCCGTGGTGTAGTCTGTATTTCTAATATGTAAGAGCGGCAGTCATTC
> CGAGTTTATACGTGTGCGTGTTAGGCGAGATGAGTCGCTAATAGTATATCTGAGCACGAC
> AGCCGTATTTCACGCATGACGGATGAGAACGTTTAACTAATAACGGTATATTGCGACGTA
> TCAAGAAAATTTACTCAGGACATGTTATGATCTATCGTTTAGCACACGCAGAGTGATTTA
> AGAGTGCTCCAGTCCATAATGACACATGCTCCACAGCGCTCTCCTACGTATTGGGCGTCC
> TGAGCTCTGGTTTACTAAACAAAGACTATTCCGTTGTTGAGTAGTAGAAGAAACCCCATC
> CGAAATTGCGCTAGGAAGGCTCGATATACCAGCCTATAAGTTTTATATCGGTTACGTATA
> AAGGTCGACCATATAGGTCCGGAGTGGAGTTTTCAATCAGCCGTATTAGTTAGTGAATCC
> AACTTATCGATTCTGAAATTTTCGTTGCTCAACTTATGAAAGAAAGTCAGTCCGAAGCCT
> TAAACACGGAGTACGTGTCATGTATCAAGAGCAGGAATTAACAATAGAACACCTTCAAAC
> TCACAGTACATATTAAATGTTGGGGGCCCTATGAGTCTAATTCTTGGACTCCAACGTTAT
> GAGTGTTCTTCTGCTGTATATCCTCAGAGATTGCGTATTTAGACTTCAAAGCAAGATGGG
> AGGGACTAAGCTAGTGTAACTGGAGACTCATTTGTAAAGTTACTTCCTTTGTGTCTTTAT
> CATTATTGTAATTACATAGGCTGGTACGTACCCTTGTGAGTTAGGAAAACACATAGGGAA
> TGATAGTAAAGCTAGTACCGAGTCTTGATCCTTATTACGGGTTAGAGTAATCCTTAGTAG
> ACAACTAAAATCTCAACTGCAGTAAATTTAATACGGAAGACACTAGTGCTCACTTTCGGG
> TGTGGGTGCTAGGATCGCCTAGATCAGGGTGCGAATAAGTGTAGGGTCGCTATGTATATA
> TTTGAGTCTCATTTCTTTTTGTAAATATCGTCGGGATTTATAGCTACTATACATACGTCT
> AGTTAGCAAAGTGTTCGTATGCTTTAGCTGAACATATGTCCCCTGGTTTAGATAAACCGC
> ACATGCGAACGGATCCGAATTCCCGTAGAGGAATCAAACATAGATTCTTAAAAGCAATTA
> TGTCGTGAGGGGGTGTAGAGAAGACTGCTAAGCTTCTGATCTAAAATATAGAGTCCGTAA
> AGTATGCACCATATGTCTCTCACCCCGTCAAATTGATGACTTCAAGCAAATAGTACGTAG
> GTCAACCAATCTTTCCATTCAATAGTTCAGCAGAATAGAACCAGAAGGACCTTTTTTCTA
> TTTATAACGTCTCGTTTCGAAATACACTGTCACATACTTAGTGGGATGCTCTGCCTTCCT
> AAACTTCATCATGCGTTAGACTCCTATCCATTGGAACATCTCAAACGGCTAAAGATTAAT
> GTAGCGTTCAACAGGACACCCTAAGGTAGTATGACGATAATAGATAAGCATCACATGTAG
> GTAGCTTATTTTATCCAGGTATGGCACAATCGGCAATTGCCTAGATAATACAATCTGAAG
> TAGGAACCCCGATCTATTTCCCACTGAGTAGTGTACTCTCGATGCAACCATAAGAAGGAG
> GCTGAACATCAACTTTACTTTATCGTTTTATAGAAGTCGAGATGGACTGGTTAACGGATC
> AATTTTCGCGGCTGAAATTCGTTAACGCAACCACAACCGGTAAAACAAATCTATACATGG
> CGCGCTACCAGTAACTAGTTTTATAGTTACAGTCGTAATATCCGGGCCCTTTTTTTCTAC
> GCTGCTTTCCTAGGCCGTAATGATCTCAGTCATAGTGGATTATGTAAAGCTACACTTACA
> TATAGTGGACAAATAGTGGCACTATGAGGCATTCTCTGTTTTCACTTACCTAGTTCAAGT
> TTACTGTTGTCGAAATAGTAGATCAAGTTTTTCGGGGAATGGTAAAAGCAACTAGACTAC
> CAACATAAACTAGTATCGATTTACAATGTTTGCACAACTGTGATATCTCTACCCCGAACA
> AGTCTATAATATGTAATCGTTTAAGATGGAAGGATTTACGAGCTTCAGGCGATAGACGAC
> CCCAAGATTGGGATTGTTGTCCAAAATTAGAGTGAGTATCTAACAGCTATCTGTAATTCG
> ACTAGTAACCGGGTAATGCAAAGCGATTGTCGATTTTGTACATTGGAGATCGTTAATATG
> GGACTTAACCTATAGCCCAATCACAAGGCTTATTGTAAAGAGCACGTAGTCCGCACTTAA
> TTGTTTTGCACTAAAATAAACCTATTATTCCTTGCTTCGTTTAAATCGTCACTTGGAGCA
> TAGTGACGTATAGCCGTTCTGAGCAGTATAGAAGATAGTGCATGCAGGTGAGACATTAAA
> TAGCAGATTTTCAAAGGGTTATGTGTTCGAAAACTGAAAATTATATTAGACCTACAGTTA
> TGAGACAGACGATAGGGTTAGCACGAGGCGGTTGAATCGCATCCCTTGCATGGTTCACTT
> ACGCATAGATTAACTGCAAAAAATCTAATTGAAAGTCTCTAAGGCGGTAGAGGAGCATTT
> TCAAAGTACAGAATATAACTCTGGTAAAAAGTTTGTTCATTATACTTACGTAGATCCTTA
> TTAAAAACCTGTGCAATTACAAATATCAATGAACCTGTTGAACATATGTTTTTAATTATG
> GCTTATAAACAATTGTCTTAATAAGCGAAGTTGCTAGTAAACACGTACGCACTCACCCTT
> TAATTTTTACTTATATGTTTAAAGATGGGTTTGCTCTAGCGTCTGTAAATCAAATCGTGG
> TTACGACGGTAGACTCGTGCTTGGGAATTGGATAAGCTATGCAGCTCTATATTTCAAGCT
> TTAATTTAATACCACGAGGTAGTAGGATAGGTATCTGCTATTGGAAAATGGAGGGATTTA
> TCCGTACAAGGTTCGGCTAAAACTACCACGAGGGTTCGATTTTCATATGGAGTGTTTGTA
> TAAGCCACATTTGTTGTATTTGTCAACATCCTGGGGACTTTATGCTCCCCGTAGCTGAGA
> ATTCTTCTAAGTTTGCAGATGAAAGAATTTCTATGGGGTAAGACTCTAACAGTATATAAC
> GAGAGTATGCAAGGACTTATAAAAAACCTGATTTATTCAAGTACTGGCATAACATTCATA
> GATTATATTTGATTAGTTTAAACGCGTGCCATGAGTGGTGCTGTGGAACGCGAGATACAT
> AAGGGCTAGCTGAATATTGCATTAGGCCTAAAAAGGCAAAACCGGCTAATTATTATTCTA
> AGAGTTGCACTGACTAGAACCTCTTTGGTTATATATCTAATACTTAGCGTAGGATCATAA
> ATCTACTTGGGGAGTGAGTGCGCTCGGTGGTGTCACTATCGTAATACACCCCTTAGTGGC
> TCTGTACTCGCGATCTCCTGAAAGCCTTGTGTCATTACTTCGCGTATGAGTCATAAAGCT
> TGATGTTATACAGTTGATACTCCGGTATCAAATTTATACCTTGTTTACTAGTAACCAAAC
> GTATTAGATCCCATCCCGTTATAGGACTCAATAGAAACCACAGGCGACCGCATATTAGCG
> TAACTAGAAGGTCAAAAAAAACAAATCATTAATTTCGAGCCTGAAAAAAAATAAAAGGCA
> AAATTAATTTCAAGTAAGATTATGACTTCTTATGTTTGTACGGGCACTTAAAACAACGGT
> AGCGTCACATGCACCATTGGTACCCACTGTGGTTTACATTGTTTATCTACTGGTCTCGTT
> CAGAAATAACAACAAGGAACCGGAGTAGGTCAGGAAAGGATGCAGTTATAGTTCACAGTC
> GACATTATTAAAAACCTTTATGTTTCTTAGGGAAGGATGACGGTTCACTTACATGCTTTG
> CTTATGGTTCCGATGTTACTTAACATTTCTTTTTAAGGGAGGACCACCTTCTTTTATCGA
> ATCTAGTGGAGTAGGTGCAATGGAAAATAATTGAATCCTCTCCGCAAACTATTATCACAT
> TTTACGAGAGAGCAAGTTCTTTACAATGCGAGCTTGAGCTTTCGTGAATTACAGTACTCG
> GTCTAATAGTGTTGTAGTTTAAGGTACGTTATTGTGCGGGTGATGCTCCTAAGTAAGAAT
> GCACGATGATCGTGTTATAGCGAGCAGTTTTTTTTATTATGCATCTACTTATCTGTAATT
> TTGTCGATTTTACGTTTCTTCAAAGCAAATGATCGTTTGCAAATTTAATGGAACAGCAGT
> GAAATTATGAGGGTGGTTCATTGAGTAATAAAACAACATTTGAGACTCTCCCAACTGTAT
> TACTGAGATGTGGAGTACTGCCAAGTTTCGTCAAACTTTTGGGCGATTCGAGGTATGTTG
> TGGGTTTCTAATCGTGTAATAATATATTCCTCTTTATGATTTGGAGCCCTATCGCCCTCA
> GAAGCTAATATCATCTTTTAGTTTAAATATAATATAAACTCAATTCCTACGCTTGTTCTT
> AGTAAACCTTTTACGTTACAGATTGATGCGTGTGTATCGACAAGTCTGGTGCCACCAAGT
> TTTAAAGTTATAACAGTAGATAAATGGCAAAATATTCAGCTTAAGGCTAGTGCTCTTGGT
> CCCTAAATACTGGCCAAAAGCCAGCTAAAGTTCTCATGAAGTTTGACACTACCGGCATTA
> CGGCCCTTAAACCAGGACAATGATTTGATTGCGTTTTCTAGTGCGCCGTGATTTTGAGAC
> GTATTTAGAACATGTCAATAAATGTCGTGAACAAAGTACGTTCACCTGGTTATGCTCCCG
> ACTATCAATAGTTCGATTATGTGTGCGGTTGTCAACATTTAGCCTTAACATACGCGTAGT
> CACCATCAGGCATATCTGCTCATAGATTAAATTTTTGAATCTTTGCGTTTTCGGACATTT
> AAGATTGAGAATCCGAAGTCCTAAGTTTGCAAGAATCGCTAAGGCTTCTTTGTCACATTG
> TACATATATAGCAAAACGACACTATCATATAGTGTTGCATCGACAGCAGTTATTACGATG
> CACCCGTTAGTATAGTAATTAGACCTACTTTGATAACCGTTTAGGCCATTTTAGAGCACT
> TAGCTTAACTTCTGGGGATCTGTACTAAATTGAATATGTTTTTGGCCGAACTGCTGACTT
> CACTGTCGATAACATACGAGGGCGTTATTCTTATTGTTCCATCATAAACATGAATGGCGG
> ATTCACACAGAAACCCTTTGCTAAAATTTTCTGGAGTACCTAAATAGTTCAAAGACTACT
> AGGGAAAGACTACGTTGAGAGACATGTAACTCATTGTAATCGTCTTGTAAAATGGAATCC
> TTCTTTTGCCCACATTTTTACTTCTAATAAAGTTCGAGTACCTAGCCGAAAATTCGTCAT
> TACAGGCAAGTGACCTCTATGTGTGAGATTGTACGACCATCTAACTCGCCGAGATTCATA
> GTTGATCGCACCGTACAAAAGGCCCGTATACTATCCACTTCGTCGACGCGTACAACTTCA
> AATCGACATTACAATCAAGGGTGGGGGTTACTGTGTATTGCATTGGAATCTGATTTCATC
> CTATGTCGGCAATTGACAAGAAGAATGAAATCAAGATACCCGTGACTGATAAGTTTCTAT
> TCCGCGCATCCTTTTGCCTTTTTTTCTTACTTGCGCAATCATGACCGCATTATTCACAAA
> ATCATTTCTCGTTACTTTACTTTTCTAGAAGTTTCAATTTTAAATTTACCGTTTCTATCA
> TAACAGCGAAAAGTAATCTATTACCTTCATAGCGAAATTTTTGTATTTGAAAAGCAGGGG
> TCACCGCCCTACTCGGATCAAATGAGAGTGCGATCGTCAAAAAGCCCCACAAGTTGAAAA
> CCAGGGTATGCCGGTAATGTCTTATGTAAGGAAGGTAATATCATATTATTTAAAGCAGCT
> AAATACAATGCAACTATAGTGTATGCCCCGAATTCGATGTATACCACCATCTCGTATATG
> TATAATAACTCATGTGCCTTTCGGCCTAAAGTAATTTACGTTTCTCTGTGTTTTTCCATG
> AAATACACATTCACTGTTTTAGATCTTTTAGAGAGGTACAATTCTTAGATTAATGCAAAA
> GCGAGCTCTACCTGGAGTCCTCTGTGAAGGTCCCAAAACATCGGTCCACAGGATCTCGGT
> TGATAATCCAAAGAAGACAATCTTCTGGATTCACGGCGATATATACGACCGGTATTGTAA
> AGCAAGTAGTTCGTTTAAACAACTTTTATACTCTTGCTAACCGATGCACGCAGGTAGGAC
> TCACTGCAACTTAATTTTTGAAAGTCATATTAAGATACCAAAACGGAAGTAAGCGTAATA
> GCCCTTCCGAGCACGAGGAATACACGGTCTTGAGACAGTATTGTTAATTTGACTTTACAA
> TTTCGATGATCTTAATATCCAGTTAACCCAATCATTTTAATACTACATGTATGGGCATTA
> TAACGATACGTGCCAGGACATGTTGGAGAACCAGATATTTTACTCGAAGATGCATGACTT
> ATATATTTATGTTAATGTAGAATTAATACATGTGAGCATCAATCTTAGAGTGCGTCTACA
> GAGCTTGGAGGAAGGTGGCAGAAAAAAGGCTGGGCCCGAAACTTCTATGCAGATCAAAAT
> GAACTTCAATGGGAGATTGAGTAACCGATTAAGGCATAAGCAGGGCTGGAAATATTGGCG
> TGTATTATTGTGCGACAGAGTGGGAAACTCTTCGGTTAAGATTCAATTCAATATCGTCCC
> ACCACGAAAAAACTAGGGAAACTTATTTATATATCAGTCTTGACTCAACTAAAAACAATT
> CTGAGTGCTTTTTGCTTGTTGAATATACATGGACCGCTACAGGATAAACGAATCTTAGCT
> AATAAACATAACTCCTACAAGATGGTTCAAGTCCTCATGCGGTAGGTAGATAATAAATTT
> CAGAGGTAGTCTCGACATAAAGTGATTTGCGGGTAATTAAAAGGTTCCAGGTTTGACACA
> ATAAATTAAGGATGCAACTATCGTGTTTTTTGTATCTAATTAGACTAAAGGCCTTATCTA
> GAAAATGCATGGTTTATCTAGTTTATTCTTAAGACAATCCGGTAATGGGGGATCGCGAAG
> TCTTATAGACAAATCTAATCAGTGTGAGCCTTGTAATATTATTATAAATTAAATAGTTAG
> TTTTTATTCCTTGAGCAGTAACCTAAATAAAATTTAAAACTACGACGATACCCCGAGCTG
> TTTAGGGTCATTATGCTGCTTACCGGTATTTCTTGAAGAAATGTTATCGGTAAATAAAGG
> TACCGCGTATGGTGTCTTCACGATGTTCTGATGTAGTTTAGTTGAAGTCTACTTGGTTTA
> AATACTTTTAGGAAACGATCTCAACCCTATAATCCCCGGGCAATATCCCCACAAAGTAGC
> TACAGGGAAGCGACCGGATAAAGATTCTGAATCACCATCGAACAAAGCCCAAAAAGAATT
> AGATCATGAACAGACTATTGTGACAGGAGTACTGCAGCACGATCGCGATCAGAATAGCTA
> GTTGGGGATTAGTGTCTTGCTAATGTTTGGATCTGTGGATGATCCATTTTCAAATGAGTC
> TTCTATCTTTTCACCGTTATTCAAAGTCTTGAAGTTTTTATTTACAATAGGTCACCAAGA
> TCAATATTAATAAAAATTAGGAGATTGGAGACGCAACCGGACTTAAACACCGATTATTCA
> TCCAATCCTAATCTGCCGATATTGTAGTGGAATACCGAATCTAGTGAGAATTAGAATAGG
> TAGCCAAATTGCTATCTTGATCCAATGTTGTTATGCCACGATCGTATATAACCGCTGTTT
> TTCCTCTGTATAGGACCACAGTGTATTAACTTCTGAAAAGAAGGAACTCATGGGTTACCG
> ACAAATAATGGCTCTAGGTTCGACTTCCATTTTAGAGAATGCGCCGGGAAACCAGCGGTT
> GTTTTTGAATTGGCAAATTATCAGATGAACTAGAAAAAATTTTCGTCTAGAATACTAGGG
> GTTGCTTTCACGTGCCATGATCAACAACTCGAACGCGAACTTAAATAGGAGCGGTATGAA
> ATTCACGACTGAAGATCTACTATGGAGACAGATCCACTGTCCTTCGTTACATATTAGTTG
> AAGCATACTGTAAAATAATGAACATCTCAGTTAAACCGAACAAAGCCTGCCCTTAGTAAG
> ACGGCCCTCTGAAATCGGGTATCCGATGTGCGGTATTTAATTTAGCAGGTGAATGTTTCT
> ATTCAATAATAACCGGGCCGTCAACTTGATATACTCAAAGTGATCGGAACAAGTTCTTAC
> TACGATCCCCATGCACGTTGTTAATCCGTAGATAGTTGGAATAAGAATTTTTGATGTGAT
> TGGGAAACGGATCCGAGGCTTAAAGGGTTATTTTAGAAGTTAATATATCAGTCAAATTAT
> TGAAAAACTTCACTCTGAGCTGATACGAATGCGAGTGTTATTAATCTTATCGGTTAATAG
> ATCTCAGTCACGAAATGGGACCGACTAGTTCAGTTAAAAAGGATACAATTGAGAGAATGC
> ACGCCAGCTACTCAGTATATGCATCTTTTTAGGATGCTAGATCTAACAAAACATTTATGA
> GTTTCACCTTAGCTCCTATGATCGGCCCATACCTAGAATTAGAAAATGTTTGACGGTTTT
> GTGTATTAGGTTCTGAATAACTGCTATGCGAGTGCTACTTTGATTTTTACCACTAGGAGA
> CGTAAGAACTAAACTGCATAGCATCCAGTTCACATTGATATGGGAGATTCGTATCCGTGG
> AGGGCGCTCGCAAATGTCTCGTCTATCCCAATCGACGATAACTTAGAGCCCTAACCTTTC
> TCATTCTGTTAACGACCTTTGAATATACTGGTAAGTAAGGATTGGTAGTGCAGCGAAAAA
> GCGGCACAAAGCAAAAATGTTCCAAGGCATGTGTGAGATCCCTTATGTCCCAATGCACAC
> GTGATACTTAAATAATCTGTATAACTTGATCTGATGTCCGTCGTAAATTGCGTTATACGA
> TGTGTCTTGATGGAACACCAACAGGACACTACGGCAACTACAGTGATGTATTCCTGACCA
> GTCAATGTACCAGGTCATTACACGGCAAAATCTTTTCGAGCGTTTTGTTTGACATTAAAA
> TTGGTTACGTGAGTTTGCCTAGAGGGAGTCCGTGTTTCTTAGAGACGCCACCATGTCATA
> TCTCCTGGCCACCCACCATTTGTGTTTGTCCCGATGTCATATATTTCTCCATTGTGAAAG
> GGCCGTTAGGTTAGGTATCAAATAATAGGTGCCCTGAGGTTAGACGAAAATACTATCGGC
> AAATGATCGAGCATTGAAAAACTCTGTCTCCTGTGCTATTTATTGGGATCTATAAGTGGC
> TGTACAATGGTCATCCAAAAGGTTTATAGAGAGCGACTTACTGACTACAAACTTATCTCA
> GAGTGTTTTGTAGAGTCAGTAGTACGCAGGCTAAAGTAATTGCACGCTCGAATCAGTATT
> CATATAGATGATGGTCCAGAGTTCTCTACTAGCATATATTATAGCTCATACTATCTTTTT
> GCCGATTTTGATTAAAGAAATCTATATGAAGCTCAAAGGCATTAAGTAGCTTCGTTAGCA
> AATTACGCGGCCAATACTGTCACATATCAGAAACATACATGGACCATCGTTATCTTCCCC
> CTGACTACATAGTTAAAGATACTGGTATCATTCAGCTTATTTCTATCATGAATGGCTATC
> ATTTCTAACCAAGTTTGGCGAAATGGTTACGAAGAACAGGCAATAATTTCACCCTGTATA
> TTGTAACAGCGTATCTTCTCTGGGTACGCTTTCTGCGAAGTGGGTTACGGTTCTTCAGTA
> CTGATCCATTTGAGTTCACATTATCGCAATCTTAAGCTTGATGTCGAGTGAGCCGTACAA
> TTTAATGAAAGTAATCAAAGGTTGCGCTGTGGTCGGTATTCTCTATCAATGTTCGGTGGC
> CTGTTTTTTAAGCTATTCGGCTCATGCGACCTTATATCGAGTTACCTGCTACCACTCGGA
> AGTAGCGCTTATAAGACTGTAATGATTGCTTAATTAATGAAAGAGCGATTCTCGGGCCAC
> AATCCATGTTGTCATTATAACCAGAAATGCCGTAGAATCGTCCCGACCCTATAGACTAAT
> TGGGATGTATCGCGAGCTCCAAGTTGCGCATTGACAAAATTCAAATAAAGCTATAGGGTC
> TTGTTGTCTTTAATGGTTGTAACCGTTTATAATTCGCACTGTGAAACAGATTTAGTACTG
> GCACCTTTACATGGCAGATACTATGATTAATATACTAAAGTCAGACATCCAATAGGCAAG
> ATAATATCGAATATAAGAATAACTGCTGAATACAGAACTATAGTATATTAACCTGAAGTT
> CGAGTTTTAGAGTCTTTTGTTCCGACTAGACGTCCGTTGATGCTTGTAAGGTAGATAATA
> TTGCTCTCGTCATGTCTACTGATCTTAGCACACGGTATAACTACAGCTCCAAATACACTG
> AGGTATAGCGCAATGGATGGGATACGACGAATCAAGACTGAAGAGAGGCTTGATTATAAG
> TTAACCTTTCTGGCAAACCACATTCCAACTGGATATACAGCGATTATCGTCTGGTCATGT
> TAAATCTGAAATTATCGTTAACTAAACCAGTGTACAAAATGATGATATAACTTTAGTCAG
> CTCCACCAGTCTGAAACTAAAAGGTAATGGACTTGAATATACGATAGTTCTTGAAGTTCC
> CGCGCCTCGTCGAATACAAACAACGAGATCGCCAAAACTTGTTGACATACGTTGCCGGTT
> TTATCTGCAACGTATCTCCTGGCACAATGAATTCGCTTGCATCGCTGATAAGCTCGACTA
> CTCTCCGGTATTAATCATGTTTACCGTGAAACCGCATTGAGTCCGAAAAGATCTAGTCTG
> GATTACCCGCATTATTATTGCTTATACTTCGGAGTGCTGTACATGTCGCGTCGTTTATGA
> TACGGACGACAGGTACGCGAGGGAGCTCCTCGTTGACAATCTTTTGGGCATCAAGACAAG
> ACGTCGGCAATTGGAGGATCTCAATCATATATAATACCCATCACGTAGCAGTTCAACTAT
> TACAAGAATTTCATTTATCGTCTATTATCTCATTACATGTGAGGATTGGCCTTCAATCTG
> GTTAATTCCCCTAATAAGTAGGCGCATTTTGTATTTAAAAATATTCAATCTTTTCATTTG
> TCAATACTTACAAGAGCTTGTTTCATGATATAAGTCTGAACATTTGTCGCCGTCACAATC
> TGCATAGCATTAGAACTATACTTCGACCGAAGATTCAGTGCATTATAGGTACTACTAGTA
> ACCGCTCTTACCTTGTTTTGTCGACTAATTGGCTTACTAAGACCGAAAAATCTGCGTCCG
> GTTAAGAGTTCTAATGTCTACCTTATACTACTCTATCACTGACTAAAAGACCCTTATCAA
> TTCAATTATACATTTAATACAAATCATTATGCATCTTTGCTAATATTAGTATAAGAATAA
> TCATATTTGTTACACACCTGGTCAATCACCCAATGCTTCCCTGGTGGAGGCGCGATGTCT
> AAGATGTATGACCCCCTCTCTTGCACAGGTTTTACGGGGGCGTGGTTCCCCAGAGGTCTA
> GCTAATAGTAGATAGGACCAAGTCACCAGTATTTAACGAAGGAAGGAGCACAACCTTTAA
> ATATGAACGGTTTAGTGCGAAGTATCAACAATATGTACTATCGAATTGGGTTGTGCTATC
> GTTTTGCACACCCACAGTGATTTAAGAGTCATCATGTCAAGAAGCAATAATGATACACAG
> AGATCTCCTTCGTAGTGCCCGGCAGCAGATCTGCTTTTAGAAAAAAAGAATATTCACTTG
> GTCAGTACTACAACAAACCCAATCACAAATTCACCGAGGATCCCTACATATTCCAGCCTA
> TTAGGTTTTGAGACGTGAACTTGAAACCTCGAAAAGTTAGGTCCGCAGTGCTGTGTTAAT
> TCAGCACTATGAGGTAGGCATTCCATATGAGCCATTATCAATTTTTCGTTGATCAACGTA
> TCTTTCAAAGGCACTAAGTTCCCTGAATATCCGAGGAAGTGTAAGCTTGCTTGAGCTCGA
> TTGATCATTACAAATACTTAATACTCAAAGGACATATGATTTCGTGGCCGAACTATCAGG
> CGTATTCTGCGACGCAAACGGGTGCTGTGGTCGGCTCATCTAGTTACTCTCACATTCCGT
> TGGTTCAATTCTATGCAACATGCGTCGGAATAAGCTAGGCGATCTGGTCTATCATTTGTA
> AACGTACGTCCTTGGGGGCTGTTTCATTATTCTTAGTAAATTCCAGGGTACCGAAACGGG
> GGACTGACCTTATATAAGACGGAAGGATACTAAAGAGACGTAAGAGTCTGGTGACTTTTT
> TCGGGGTAGAGTAAGCATTTGTAGAAAACTAATTGATCATCTGAAGTAAATGTATGTCCG
> AACTAACTACTGAGCTCTGGCGCGTCTCGCGCAGAGCATCCCATTGATAAGCGGCCGAAT
> TAGTGGTGCCTCGCTATGTTTATTTTTGACTAGCATGTCTGTTTCTTAATTGCGTCCCCT
> TGTAGAGCGACTTTTAATACCTAGAGTGACATAAGTGTGCGGTGGCTGTTGATGAAAATA
> TGGAAACTCGTGTACAGATACACCACTTGAGAAACGAGCCGAATTCACCTACACCTTGCA
> ATAAGTGAGTCTTAAAAGAAATTTTGGAGGGTGGCGGTCTTCAGATGAAGCATAACATTC
> GGATCTAATATAGTGACTAAGGTAACTAGCCAACTTATCGCTCGAACCAACTAATATTGA
> GGACTTAAACCAAAGAGGAACTAGCTCAACAAAGCTGTAAATTATATAGTTAACCAGTAG
> AGAACCACAACGACCTTTTGGCGAGTTTTAAAGGAGCGTGTCCTATTACAATGTAAAATA
> CTTAGGGGCTGCATAGCACGTCAGATAAGGCATCTTGAGTTAGAATCAGAGAATTGGCTA
> AATCTCAAAACGATAAACATTAATGTTCCGTTAATCAGCACTAACTAAGGTAGGATCACC
> AGAAGACATAAGCATCACATCGAGCGACCTTATGGTATACAGGTATCGATAATTCCCAAT
> TTGCCTTGAGAATAAATTAGCAAGTTGCAAACCCGATCTTGGGACCTCTGAGTTGTGTTC
> TATCGAGGATAACTTAACTAGCTCGCTGAACAGATACTTTAAGTTATCCTTGTATACAAC
> TACACATGGAAGCCGTTAACCTTAAATTGGAGCCGCTCTAATGACGTAACGCTTCATAAA
> CCGGTAAAACAAATCGTGAAAGGGCGACAGACCAGTATATACTTTTATAGTTAAACTACT
> ATTATAAGGGAACTTTGGTTCGAAGCTGCTTTCCGAGGCCCTTATGATATAACTCATACG
> GCTTTATCTAAACCTACACTTACAGTGACTGGAAAAATTGGCGATCGATCTCGCAGGATC
> GCTGGGCACTTACCTTGGTCAACTTTACTGGTCTACAATTACGACATAAAGTTTGGACGG
> CAATCGGAAAACAATCTACACTTACAACATAAACTAGTATACATTTACTATGGGTCAACA
> AATCTGTTATCGATTCCACGAACAACGATATAATATGGAAGACTTTAAGAGGGTTGGATT
> TACGACCTTATGGCCATTCACCTCCCAAAGATTCCCATTCGGCTAAAAAAGTACACTGAG
> GTTCTATCTCCTATCTCTAAGTCGAATAGTAAAAGGGTAATCAATAGACATTCTACATTT
> GGTTCATTGGAGATCGTTATTATCCGTCGGTAACGATAGCACATTCTCAAGCATGATTCG
> TAACACATCGGAGTCACCTATGAAGGGTTTGCCTAGAAAATAAACCTATTTTTCCTTGCG
> TCGTGTAATTAGTATAGGGCAGATGACTGAAGGATACACCGGATCAGCTGTATACTTCTT
> ACTCCTTCCAGGGCAGTCTTTTTAGACCACTTGTTCTAAGCGTGTGGTCTGACTAAACGG
> TTTAGGATATTTCTCATACACTGATCACACTGACGATTCGCTGTGAACGACGAGGGTGAA
> TAGAATAAATTCAATGCTTCTCTGACCCATAGATGAACTGAAAAATAGAGAAGGGAATGT
> ATCTTTCGCGGTAGTCGAGCTGGTTCAAACTTAACTAGAGAAATCTGGTAATAAGTGTCT
> TAATTATAATTTAGTAGAGCCTTATTTTAAACAGCTGCATTGACAAATATAAATGAAACG
> GTTGATAATTTGTGTTTAATTTTGGAGTAGAATCAATTCGCGTAATAACAGAACGGGCGA
> CTTTAAAAGTACGAAATAACCATTTAATTGGGACTTTTAGCTGGAAAGTTGGGTTTCATA
> GAGCCTCTGTAATTATTATACTGGTTTACAAGCTTGAATACTGCTTGCGAATGCGATTAG
> CTAGGCACCTATATATTGATAGCTTGAAGGTATTACCACGTGGGAGTTGCATACGTAGCT
> CCTATTGCTAAATGCTGGGTTTGTGCAGTACTACGTTCCGAGTTTACGAACTCCAGCGGT
> CCATTGTCATTGGGTGTGTTTGTATAAGCAACTTTGGTTCTATTTGGCTACATACGGGGG
> TCTGGTTCCTCCACGTACAGCTGATGTCTTCTAAGTTTCCAGAGGAATGAAGTGCGATGG
> CGTAACTAGATTACTGTATATATCCAGAGTTTCCTACGTCGTATATAATACCTCATTGAT
> TCTTGTAATCCCATTACATTCATTCAGGTGATGTCTTTAGTGTTTAAGACTGCCATGTGT
> CCTGCTGTCCAACGAGACATAAAGTAGCGCTAGCGGATTATTGAAGTACCCATAATATCG
> AAATTCAGGATAAGTATTATTCTAAGACTGCATATCACTTGAACCTCGTGGGTGAGATAT
> CTTATACTTACACTAGCTGAATAAATCTACTGGGGGACGCACTGCCCTCCCTGGGCTCAC
> TATCGTATTAAACAACTGTGTCCCTAGCTAATACACATCGACTCTAAGAAGTGTGTCTTT
> TCTTCGCCGAGGAGTCATAATGCTGGATGTTAGACAGGTGATACTCACGGATCAAATGGA
> GTAATGGTTGACTAGTATCCAAACGTAGGAGATCAAAGCCACTTTTACCTCTAAAGAGAA
> ACAAAACGCGACAGCTTAGTTGACTTTCGAGAACCGAAAAAAAATAAATGAATGAATTTC
> GACCATCTTTTATAAGATATCGAAAAATTAATGGCATGTTAGTTGTGGAATTCGTTTCTG
> TGTAACGGAAATTAAAAATAAGGTAGCCTAAAATCAACCATGGGTTCACACTGTGCTGTT
> CATGGTTTATCTACTCGTATAGGGCACAAATAACAAAAACGAACACCACGACGTCAGGAT
> ACCTTCCTCGTTTACTGCACAGTCCACTTGATTATAATCATGGAGCGTTCGGAGCCTACC
> ATCAACCTTCTATTAATTCCTTGGATGAGGCTGCACAGCGTAATTAAAATTTCGTTGTTA
> CGGACCACAAACTTCTTGTATCGAATATTGTGGACGAGCTCAAATCCATAAGTAGGGAAT
> CCGCTAAGAAAACGATTTTAACTTGGTTACACAGAGCTTGTTAGTTACAATGAGACCTGC
> ACCTTGACTGAATTAAACTACTCCCGATTATTCTGTTCTAGTTGAAGGTTACTTATTGGG
> CCGGTCAGCCGAATAAGTAAGAATCAACCATGATCCTGTTAGTGCCACAACGTGTTTTTA
> GTAGCCTGAGACTTATCTCTAAGGTTGTACAGTTTACGTGGCTTCAAACAAATTCATACG
> TTGCTATTTGTAGCCAACACATCGGAAATTTGCACGGTCGTGCAGTCTCGTAGAAAACTA
> ATTTTGACTCGCTAACTAAGCTATTACTGTGATCTGCAGTACTGCAAAGTTGACTCAATC
> TTTTGGGACTGTACAGGTTTGGTGTGCCTGTCGAATAGTGTAAGTATTGAGTACTATGTA
> GGTTGTGGAGCCCGTTCCCCCTAAGTAGATATTATCATATGTGACGTGTATGATAAGATT
> TTATCATTGCAGAAGCTGCTGAGTAGTAATAATTGTAACTTACACTTTGTGCACTGTCGT
> TAGACAAGTATGGTCACACCAAGTTTGATAGGTATTAAACTACATAAATCCAAATTTTGT
> CTGCTGTAGCATTCTGCTCTGGGGCCATATATAATGGCCATATGCCTGCTAAAGTTCGAA
> GGTTCGTTGACACTTCCCCCATTAAGCAAATTAAACCTGGTATATGATGTGATGGCGGTT
> TCGTGTCCGCCCTGATGTTGTGTACTAGGTAGAAAATCTAAAGTTATGGCCGGAAATAAG
> TTCGGTCTCATCCTTATCCTAACCACTTTCTATACTTCGATGAGGTGGGCGCTGGTCAAC
> AGTTACCATTATCATACCCGGAGTCACCATCACCAATATCTGCGCATTGTTTTAAGGTTT
> GATTCGTGCCGGTTTCGCTATTTTAAGATGGTGAAGCACTAGGCATAAGTGTGAAACAAG
> CCCTTAGGATTCTGTGTAACTTTGTTCTTTTATAGCAAAACCAATAGATAAGTTAGGCTT
> GCTGCGTCACATCTGTTGAACATGAACCACTTAGTTTTCTAAGTACACATACGTTCTTAT
> AACGTTTGGAAATTTGTCACATATTACCGTTTATGCTGCCGAGCTGTTATAAAGTCAAGT
> GGGTTGTGCCCGAACTGCTCTCTTAAATCTCGTTAAAATTCCTCGGCGTTATGCGTAGTG
> TGCCATCTGTTACATGAATGGAGGATGAACAAAGAATCACTTTGATAATAGTTGATCGTC
> TAACTATTTAGGGAATTGACGAATAGCCAAACACGAACGTGTCTGAAATCTAACGCATTG
> TAATCCTATTGTAATAGGCAAGACGTCTGTTGCCCAATTGTGTACTGCTTATTAAGTTCC
> ACTTCCGACCCGATAAGTCCTATTTAAACCAAACTGTAATCTTTCTCTGAGATTGTACCA
> CCATATTTCTCCCAGACATGCTTACGTGTGCGCTACGTAAATAAGGACCGGTTACTAGCA
> AATGCCGCCAACAGTACATCGTCATATCCACATTAAAATAAACGCTCCGGCGTACTGTGG
> ATGCAATTCGAATCTCTGTTCATACTTGCTAGCAAATTCTATTGTTCTTGGAAATCATGA
> TACAAGTGAATGATAAGGGGCTTGTAAGCCCATCCGGTGCCATTTTTTTATTAATTGAGA
> AATCTGCACCCAATTAGTCAAATTATATTTGCGAGTTAATTTACTTTGATTCAAGTGTCA
> AGGTGATATTGACAGTTTATATCTTATATCAGTTTTGTTATCTTGTACATTATGTCACAA
> AGTGTGCGATTTGAAAACAACGGCTCTCCCACCGAATCGGATATAATGAGACTGACATCC
> TCTTAAACCCAATCAACGGCAAAAAAACGCTATCCCGCTATGGTAGTATGTAAGGAACGG
> TATAGATTATGATTGTAACCAGCTATAGTAAATGCAACGATTGTGGATGCCACCTAGTAG
> AGCTATACCAACTTATCGTATATCTATATGAAATCAGCGGCCGTTACCCCTAAAGGTATT
> GACGTTGCGCGCTGTTTTTCATTGAAATACTCTGTAACGCTTTTTCATCTGGGAGAGACC
> GACAAGTATTACATTATGGCAATACCGAGATATTACGCGAGTACGCTGGGAACCTACATA
> AAATTCGGTCCAATGGATATCGGGTCATAATCATAACATCACTATAGGCGCGTTTCTCGG
> CGTTTGATAAGTACCCTATTGTAAAGCATGTACGTCGTTGAAAATAATGTTAGTCTCTTG
> ATAAAAGATGCACCCTCCGAGCACGCAATGCTTCTTAAGTTTTCAATGGATTTGTAACAT
> AACTAATCCCTTCTAACCGTATTACACATTCAGTGCACCAGCATTACACGGTCTTGAGAC
> TCTATTGGTTAGTGCACTTTACTTTGTAGATGAGCGTTTTAGACAGTTTAACATATCATT
> TTTATAAGTATTCGATCCGAATTTGTACCATACGTGCCTGGAAAGCTTGGACAACCAGAT
> TTGTTAAGCCAAGATGCATGAATGAGAGAGTGATCTTAATGTACATGGAATACTTCGGAC
> CTTCAATATGAGAGGCCGGCTTCACACAGGGCACCAAGCGCCATGATAAATGCATGGGCC
> AGATAATTATATCCAGAGCTATATGAACTTATAGGCGAGATTGACTAAACCTTTTACCCA
> GAAGAACGCCTGCATTTATTCCAGTGTTTTAGTGTCACACTCACTGGCTAAATCTTCGGT
> TAACAGTAAAGGCTATTGCCTCCCTCCAACATAAATATAGCCAAACGTATTTATATTTCA
> GTCGTGAATCTTCGAAAAAAAATTCGCAGGGATGGGGGCGGCTTCATTTTACAGCGACAG
> ATTAAGGATAAACCAATATGTCAGAATAAACATATCGCCTAATTCATGGGTCTTGTACGC
> TGGCCCTTCGTAGTGTATAAATTTCACTCGTTGTCTACAAAGTTTGTGATTTCCGGGTAT
> TGTAAAGCGTACACGGTTGACAATATTTTTTAAGCAGCCTACTATCCTGTTGTTTGTATA
> TATTGACAATATAGGCAGTAGCTTGAAAAGGATTGGTTTAGATACGTTATTAGTAACACA
> ATAAGCTAATGGGCGATCGCGTTGGATGATAGAAAAATATAAGAAGTGTCAGACTTCTAA
> TTTGATTATAAATTAAAGAGTTACTGTGTATGCCTGCTGAAGTTACCTTATTAAAAGTTA
> AAAATTAGACCATAACCACTGATGTTGAGCGTCAGTATCCTGCTGTCCGCTATTTATGGA
> AGATAGGTTATCGGGAAATAAAGCTACAGCCTTGCGTGGCTTAACGATGGTCGCATGTTG
> TTTACTTCTAGTCTTCTTCGGGGAATGACTTGTAGCATACGTTCTATACAATAGAATACC
> CGGGCTATATCAAAAATAACGTGATTCTGCCATCCCAAACGATAAACATTATGAATCACA
> TTCGAAAATAGCCATTTTAGAATGTCATCAGCTTCAGTATAGTCTCAAACCAGTAATGAA
> GCTACTTACAGTTCAGAAGAGAGAGTTGCGGAGGTGTGGCGGCATAAGGTTTGCATAGGG
> GCATGAGCAATTGTAAAAGGAGTATGAGAGATTGGATCCCTTATTCATTGTCTGCAAGGT
> TGTATTTAAATGACCTCACCAACATCAATATTAATAATAATTACGACTGTCGACAACAAT
> CCCCTCGGAAAAACCGAGTATTAATAATAGCCGATTCGGCCCATTTTCGACGGCAATTAA
> GAATAGAGTCTGTAGTTGAAGAGCTTCCAATATTCATAGCGGCAGCAAATGTTCGTATGC
> CACGAGCCTATAGAACAGCTCTTGTTCCTATGGATAGCAAAAATGTGTAGGTAATTATCA
> TTACATCGAAATCTTGGCTTAACGTATAATTTTCCATCTAGGGTACTCGTCCAGTTTACA
> CAATGCGCCGGCATACAACACCTTGTTTTTGTAGTCGAAAATGATATGATGAACTTCTTA
> TAATTTGCCTCTAGATTACTACGCCTTCCGGTCACCTCCCAGCAGCATAAACTAGTAACA
> GAACTTAAATTGCAGCGCTTTGAAATTATCCAAGGAAGATATACTTTGGAGAAAGATAAA
> ATCTCCTTAGTGACTTATGTCGTGAACAAGTCGGTTATTTTATCAAAATATCAGTTTATC
> CGATAATTCCCGCCCCTTACTAAGACGGCACTATCTAATAGCCTATACCAGGTGAGCGTT
> TTAATTGAGCAGCTCAAGGGGTCTTTTAAATATTATACGCGCCGGCAACTTGTTATAAGC
> TTTGTCTGCCGAAATAGTTATTACTAAGTTCCCCAGGCTCCTGCGTATGAAGGTGAGTGG
> TGCAAGAAGTTTTTTTCTTGTGTTGGCCAAACCGATAAGAGCCTTATTCGGGGATTTTAG
> AACTGAAGATTTCAGTAAATGTATTGAAATACTTCACTCTCAGATGTGTCCTAGGCGAGT
> GTTAGTAAGATGAGACGTTAATACAGAGAAGTCTAGTAATGGCACAGAATTGTGCAGTGA
> TATTGCAGTCAATTCTGAGAATCAAAGAAAGCTACTAAGTAGAGGAATCGGGTTAGGTGC
> CTACTGCTTAAAAATATTTTTTGACTTTCAAATGAGCGCATAGGTTCGGACATTTACTAC
> AAGTACTAATGCTTGGACGCTTTTGTGTAGTTGCTGAGGAAGAACTGATTTCCCAGGCCT
> ACGTGCTTGGTTTCAACGACCAGACCTTAGATCTATAAGCAATTGCATACTGTGCTCATG
> CATTTCGGTCATTCGGAGAACGCGAGCGCGCGACCAAAGGTAGCCTCGTTCCCAATAGAC
> CTTAAATGTCAGCACGATCCTGTCTCATGCTGTTTACGACATTTGAATAGTAGGGGAAGT
> AAGGAGTGCTAGTCCAGCCAAAATGACGCACAAACCTAATTTCTTCCTTGCAATGTCTGA
> CATCACGTAGGTCCCTTTGAACTAGTCATAAGTAATTAAGCGGTATTTCTGCAGCTCAGC
> TCACTAGTTTATTCAGTTTTTCGATCTGGCGTGAGGCAACTCCAACAGCTATCTTAGGAA
> TCTACACTGTTGGAGTCCTGTACAGGAAATGTACCAGGGCAGTACACCGCATAAGATGTG
> AGAGAGGGGGGTTTCACATTAATATTGGTTAAGTGAGTTGCACGAGACGCACGCCGTCTT
> TCTTTGACAAGACACCTTGTATTATAGAAGCGCCTCCAACAATTGCTCGTTGGCCCCTGG
> TAATATATTTATCCAGTCTCAAAGGGACGTGACGTTACCGATAAATTAAGACGTGACCTC
> AGGTTTGTCGAAATTAAGTTCGGCAAATGTTCGAGAATGGAATAAAGAGGTAGCATCTGC
> TTTTGAGGGGGAGCTATATGTCCATGTTCAATCCTCATCAATAAGCTGTAGAGAGACAGA
> CGTAAGGACTAATATCTTTTCTCACACGGTGTTGTTGTGTCACTAGTACGCTGGCTATAG
> GAATTGATACAGCGAAGCTCTAGGCAGAGACATGATCGTCCACAGTTAGCTAAGACATTA
> TATTTTACAGATTAAGAGAGGTTGGCACATGGTCAGTATACAAAGCGATTGCTAGCGCTA
> TGGCATTAAGGTCCTTACTTTGATAATTACCAGCCATATTAGGTAACAGTTAAGATACAT
> ACAGCCTCCATCCTTATCTGCCCACGGACGTAATAGTTAAACTTACGCGGTGCATTCAGA
> GGAGTGCTAGCATGAATCCCGATCATTTAGAAACAACTGTCCAGTATGGCTGTAGAACTA
> CAGGCAAGTAGTTAACAATCTAGATGGTATAAGCCTAGATTCGCGGGGTTCCCTTGCTGA
> GAACGGCCTTACCCTTAGTCAGGAATGAGCCATTTCTGGGCAATTTATCCCAATCGGATC
> CTGCATCGAGAGTCACCCGGTAAATGGAATGATAGTTAGATAAGGTTCCCCTCGCGTCGC
> TATGAGATAGATATGGTACGTGGACTCTTTTGGAAGATTTTCGGATAATCAGACATTTGA
> TAGACTTACATGCTACCACTAGCAACTACCGCTTTGATCAATCGTATCATTGAGTAATTT
> TGCAAAGAGCCATTATCGGCCCAAAAGACATGTTGGCATTTTAAACAGTAATGAACTAGT
> TTCGTCACGACCATATAGAATTATTCGGATCTAGAGAGTCAGCCAAGTTGCGCAGGCAAT
> AAATTCAAAGAAAGCTATTGGGTATGCTTCTATTGATTCGGTGTAACCGTTTATAATGCG
> CTCGGTCAAAATCTTTTTCTAAGGGATCCGTGAAATGCAAGTTAATATCATTAATTTTAT
> ATACTCAGACATAAATTAGCCAAGAGTATATCGAATATAACAAGAACTGAGCATTTAACA
> ACTAGACTATAGTTTACGCTACTTCCACTTTTAGTGTCTTGTGTGACCAATACACGTACG
> TTGAGGCGTGGAAGCTTGATAATATTCCTCTACGAATCTATACTCAGATTAGCACAAGCT
> AGAACGTAAGCTACATATTAACTCACGTAGACCGCATGCGATGGCAGAACAAGAATCAAG
> ACTGAAGACAGGCTTGATTTTAACTTAACCTTGATCGCATACCACATTCCAACGGGATTG
> AAACAGATTAGAGGCTGCTAATCTTAAATCTCATTTTATCCGTATCTTAACAACTGTAAT
> TTATCAGGAGATATCTTGAGTCTGATAATCCACTATGAATCGATTTGGTATTGCACTTCA
> TTATAACTTAGGTCTTCAACTTACAGCCCAGACTACATTTATAAATTCGTGATCGACAAT
> AAGGCTGCACATACCGTGCAGCGTTTATCGGATAAGGATCTCATGGCTCTTTCAATGCGC
> TTGCATACCGGTTATGATCCTATTATCGCCCCGTTGAATAATCTTTAACGTCTAACACCT
> TTGTGGCCGAATACATCGAGTCTCGATTTACCCAATTATTTTTGCTGAGAATTCCCAGTG
> ATGTACAGGGACCGTCGTTTATCATAAGCAAGAAAGGTAAGAGACGGACATCCTCCGGCT
> CAATCGTTTGCCCTGAAACTCAAGAAGTCGCAATTTGGTCCAGCGCAATCATATTTAATT
> CCAAGAACGTACCAGTTCAACTTTGACAAGTAGGGAATTGATCGTCTAGTAGCGAATTAC
> ATGTCAGCATTCCCCTTCAATATGGTGAATTCAACTATGTTCGAGCACCATGTTCTTTTT
> TATTATATGATATAGTGTCTTGTCTATATTCGTTAATGAGCGTCTTGCTTGAGTGAACTA
> TGATAATTGGTACACGTCACTAGCTGAATACCATTTCAACTATACTGAGACAGATCTTTC
> TGTGATTTATAGGTACTACTTGGAAAACCGCTTACATTCGTTTGTAGAAGTTTTCGCTTT
> CGAAGAACGTTAAATATGAGGAACCTGAAGAGTTCGAAGCTCTAACTGATACTAAGATAT
> AAATCACTAAAACTACCGTATATAGGCAATTATTCTGTTTAGACAATGCTTTATGCATAG
> GTCCGATTAGTTGGATAACAATAATAATATGTGTTTAACACCGGCTCTTGCAAACTATCA
> TGAACGCCTCGACGAGCGTGGTATATGTGCTATCACACCCTCTCTGGAACAGGGTTGAAC
> GCGCACTCGGTCCACTGAGCTCTACCGTTGACGTGATAGCACAAACTCACCACGTTTGAA
> AGAAGCAACCAGCACTAACTGTAAATATGATACCTTGTGGCAGAACTTGAAACTATAGGT
> TCTATCCAATTCGGTTGTGATATACGGTTGAAAAACAACACGGAGTTAACAGTCAGCATC
> TAAAGTAGCAATAATCATAAACACAGATCTACTTCCGAGTCCCACGAAGCACATCTCCGT
> TTAGAATAAATCAATAGGAACTGCGTCTCGACGACTTCATAAAAATTAACTAATTCACAG
> ACCATCCATACAGATTACAGAATTTTACGTTTTGAGACCGGAACTTGATACCGACAAAAG
> TGTCCTAACCACTGCTCGGGGAATTATCAACTAGGAGGTACGCATGAAATAGGAGACAGG
> ATCAATTTTGCCTTCATAAAAGTTTCTTTCAAACGCACGAAGTTCAATGAATATACGTCG
> AACTCGATGCGTGATTGACCTCCTTTGATCATGTCATATAATTAATTAGCTAACGTCATT
> TGTTTTCGGCCCCCAAATTGCTGGAGTTTTATGCCTAGAATTACGGTGCTCGCGTCGGAT
> CATCTTGTTAATATCACAGGCACTTGGTTCTAGTATATGATTCATGCCTCCGTAGTACAT
> TCGCGATAGCCTCTATCTTGTCGATACGTAAGGAAGGGCGCGAGGTTTAAGTTTGCGTAG
> GTAATTCCAGCCTTACGAAACGGGGCACTGACCTTTTATAAGACGCTAGGTGTCTTTTCA
> GACGTAAGTCTAGGGTGAAGTTGTTCCCCGTTGTGGATGAATTTCGTCAATAAGAATTGA
> TCTTATCATCTAAAGGTATGTCCCTTCTAACTTCGGAGATATGGACCCTCGCCCGCAGTC
> CAGACAATTCATAAGCCGCACAAGTTGTCGTCCCTACATATCGTGAGTGGGCTCGAGAAT
> GGAGGGGTCTTTTTTGCCGACCCTTGGAGACAGACTTGTAAGAACGAGAGTGACATTACT
> CTGCCGTGCATGGTCAGCTTAAGATCGAAACGCCGGGACAGATAAACCAATTGACTTACC
> AGCACTTGTCAACGACTCCTTGATATATGTCAGTCTTTTTTGATATTTGCGAGGCTCCCG
> GTCGTCAGATCTAGCAGTTCATTCGCAGATAATTGTGTCTCTAACGTTACTTGCAAAATG
> TGCGATAGAAAAAACTAATTTTCTGCAATGAAACATTAGAGGTACGTCCGAAAAAATGCT
> GTAAATGATATACTTATCAAGTTGACAACCTCTTCCAAAGGTGGGAGAGTTTGAAACGAG
> CCGGTACTTTGAATAGCTAAATGTATGAGGGGCTGCAGAGCAAGTCAGTTAAGGATGCTT
> CACTGACAAGAAGAGAATTGGCTTAATCTATTTACCATAATCTTTAATCGTCAGTTATTA
> TCCTATAAAGAACGGTGGATCAACTGAAGACAGAACCATATCTGCGTCCGACCTGATGGT
> AGACACGTATCCATAATGACCAATTTCCCTTCAGAAGTAATTAGCAACGTCCATACCACA
> TAGTGGGACATATCTGTTCGGTTAGAGACAGCATTAATTTTCTACCTCGATCTTATGATT
> AGGGAAGTTATACTTGGATACAACTACTCTGCGAAGCCGGTAACCTTAATTTGGACACCA
> GCTTATGACGTAACCATTAATAATAAGCGAAAAAATATCGTGAAAGCCCCACAGTAAAGG
> TTATTCGTTGTGTCGTTAACTACTATTAGAACCGAAAGTGGGTTAGAACCTCAGGTAAGT
> CCAACGTTGCAGAGAACTCTGACGGCTTTATCGTTTCAGAAAAGGAAAGTGACTGCAATT
> ATTGGCGATAGTTCTCCAAGGAGAGCTGGGAAATTAAATTGGTAAACTTGAATCGTCTAC
> AATGACGTCTGATTCTGGGGACCCCAATCCGAAATCATTAGACACGTAATACAGTAACTA
> GTATACAGGTACTATCGGTCATCAAAGCTCTTTTAGATTCAAACAAAAACGAGATTTTTT
> CGATGACTGTTTCTGCGTTGCTTTTTAGACATGATCCACAGTCTCCTAACAATGATTCCC
> ATTCGGCTAATATAGTTCTCTGACGTGCTTTATCCTTTATCTTTGGACTAGACTATAACC
> CTAAGCATTTCACTGTCTACTTTTGCGTAATTCCACTTCCTGATTATCCCTAGGTAACGT
> TACAAAATGATATACCATGTGGCGTATCACATAGGACTAACCTATGTTGGGTTTGCCTAG
> TATTTAAAAATATTTTTAAGGGAGGACTGTATTGACGATAGGCCAGATGTCTCAACGTTA
> CAACGGATCTCATCGTTACTTCTGTCTCATGCAACCGCTCTATTTTTTGACAACTGGTTC
> TAACCGGGTGCTCTGACTAATAGGTTTAGGTGATTTCTCAGAATCTGTTCACACTGAAGT
> TTCGCTGTGAAACTCCACCGTCTTGACATGAAATGCAATCCTTCTAGGAACATTACAGGT
> AATGATAAATTGAGTTGGGTATCTATAGTTCCACCTAGTCGAGATGGTTAAAACTTAACT
> TGTGATATCTCCGTTTAAGGGTCTTAATTAGTATGTAGGACTGAATTATTTTTAAAAGCG
> CATTGGAAAAATATAAATCAAAAGCGGCTTAAGTGCGGTGTAATTTGCCAGTTGTTTATT
> TTCGAGTATTAACACTACGGCAGACTTTAATACTTAGATATAACAATGTTTTGGGGAAGG
> TGAGCGGGTTACTTCCCGTTCATAGTCACTATCTTATTATTATACGGCTGTACAACCTTG
> AATACTCATTGCGAAGGCCAGTACAGAGGAACCTATTGATGGATTCAGGGTAGGGATGTA
> ATACTCCGACTTGCATACCTAGATCCTTTGCCTAATTCCTCCCTTGGTGAACTAATACCG
> GACCAGTTTTAGTAATACACCCGTACAGGGTATGTGGCTGTCTGGCTAGAACCAACTTTG
> CTTCTAGTTCGCTTCAGAAGCCGCTATGGTTCAGAAAAGGACAGCTCTTGGATTATAACT
> GGCAACAGCATTGAAGGGAGTTGGCCTTACTAGAGTTATCTTTAGATCCAGTCTTTCCTT
> CGTAGTATTTATTAAATCATGGAGTCTTCTAAGCCATTTACATGAAGTCAGGTGAGGGCT
> TTACGGTTTTACACTCAATTCTCTCCTGATCTCCTACCAGACATTAAGTACCCCTACAGC
> TTTTTTCAAGTACCAATATTTTCGAAATTAAGCATAAGGTGTTTGCTTACACGGCATATC
> TAGTGAAAAGCGTGGGGGAGAGATATTATAATGACACGAGCTGAAGATTGAGTATGCGCC
> ACGCACTCACATCCCGCCGCGATATATCCTTTTTAACAAAGGTCTCCCTAGCTAATACAC
> AGCGACTCTTACAAGGCTGGATTTTAGGACCCGAGCAGGCAGAATCATGCTGCTGAGTAA
> CGGCTTAATCACCGTGATTTTGGAGTAAGGCTTGAAGACTTTACTAAAGTAGGACAGAAA
> AGAAACTGTTTCCTATATAGACATACAAAACCCCTAACCTTAGTTCACGTTAGTCAACCG
> AAAAAATATATATGAAGGTATTGACACAATCTTTTATTTGATATCGATATTTTATGGGAT
> TCTTAGTTGTGCAAGGCGTTTCGGTGGAACCCATAGTAAAAATTACGTTGACTATATTCA
> AAATTGGCTTAAATCTCGCCTGGTAATGCGTGATAGTCGCCTAGACGGCACATAGAAAAT
> ATACCAACACCTCGACCTCAGCATTCCTGCCTCGTTGACTGATAACTACTATTGATTATA
> ATAAGGGTGCGTGAGGTCCCTACCTGCTACCGTATATGTATGCAGTGCATGAGCCTGCAC
> AGCGTAATTTAAAGGGAGTTGGTACCGACCTCAAAAGGATTGGAGACATTAGTCGCCACG
> ACCGCAAAGCCATAAGTAGGCAATCAGATAACAAATAGATGTTATATTGGTTACACAGAC
> ATTCTTAGTGAAATGCACTCATGCTCCGTGACGCATTTAAACTAATACCGAGTTTTCTCT
> TCTAGTTGATCCTTACGTTGGGGCCCGCTCAGCAGAAGAAGTTACATTCAAACAGCTTAC
> TCTTTGTGCCTCAACGTGTGGGTTGGTGCATGAGAATTTGCTCGATGGTTCGACTGTTTA
> ACTGGCTTATATCATATTCATACGTGCCTATGTGTAGCCATAACATCGCTTATTTGCTCC
> CTCGTGATGTCTCGTAGATAACTAATTGTGACTAGAGAAATAAGCGTGTACGCTCATCGC
> CACTAAGCAAATCTTGACTCAATATGGTGCGACTGTACACGTTGCGTGTGCCTGTCGATT
> AGTGTAAGTATTGAGTACGAGGGTGGTTGTCGAGAAAGTTCCAAATATCTTCAGATGATC
> ATATGGGTCGTGTTTGATTAGTTTTTATATTTGAAGTACCTGCGGAGTACTTATAATTGT
> TACTGACTCTTGGTGCACGGGCGTTACTATACTAGCCGCAAACAAAGTGTGATACGGATT
> AAACGTCTTATAGCCAAATTGTGGATCATGTTGCATTCGCATAGGGCGACATATTGAATC
> CAATTATCAATCATAAAGTGCGATGCTTCGGTCAAAATTAACCATGTAACCAAATTTAAA
> CTCGTATTTCTGGGCATGCACGTGGAGTCGCACAACGCTTGGGCTCTACGTGGGACTAAA
> TCGAAAGTTTGCGACGGATATATCTTAGGGATAAGCCGGTTCAGAAACACGTGATATACT
> TCCATGTGCTCGGACCTGCTCAAAAGTTACAAGTTTCTGAACACGTCGATACTGCACCAT
> GATAGCAGCTTTCTGTTAAGGGGGGTTTCGGGCACGTTTACCTATTTTAAGTTGGTCTAG
> CACTTCGAATTACTGTCATTCATGACCGTACCATTCTGTCTAAATTGCGTATTTGTTTCA
> ATTTACTATAGTGAAGTTACGCGTCATGACTATCATCTGTTGAACAGCAACAACTTACTT
> TTCTTTGTACACATAAGGGCTGTTAACGTTTCCAATTTTGTCTCATAGGTCAGGTTAGGA
> TCCCCAGATCTTATATAGTCAAGTGCGTTGGGCCACTAATCATCTAGTAAATCTACTGAA
> AATTACTCCCAGGTTGGAGGTGGCTGAATTATGTTAAATCTATCCACGTTGAAATATGTA
> TAAATTTCAGTTTAGGTGATCCTCTTAAGATTTTCGGATTTGTAGTATACCCTAACACGA
> ACGTGTCTCTATTCTTAAGATTGCTAATACGATTCTATTTGCCAAGAAGTCGGTTGAACA
> ATGGTGTACGGCGTAGTTACGTCCTCTTAAGTCAACATATGGCCTATTGTATCCAAACTC
> TAAGAGTGCTCTCACTGGGTAACAAAATATTTCGCCCACTCTTGCTTACGGCTGACATAA
> CTTAATATCCAACCGTTAATAGCATATGACGCCAACAGTACTTAGTATTTGCCAAATTAA
> AATATACCCTCCCGCGTTATGTGGAGGCAATTCGAAGAGCTGTTAATAATTGCTAGCAAA
> TGCTATTGTTCTTGCATATCATCTGACAAGGCAATCTTAACGGGATTGGAACACAAGAAG
> GTGCAATGGTGTTATGTATTCAGATTTATGCAAACAAGTAGGCAATTTATATGGGAGACG
> TTATGGTAGTTGATTCAACGGGATTGGTGTTTGGGTAAGGGGATTTATTATATCAGTTTT
> CGTATATTGTTAAGTATGTCACAATGTGTGCGAGGTCTATACAACCCCTCTACCAACGTA
> GCCCTGATAATCACACTCACAGACTATTTAACACAATAATCGGCATAAAATCGCTTGCCA
> CCTATGCTAGGATCGTACGATCGGTATTGATTATGAGGGTTACATCATATAGTATAGCAT
> AAGATTGTCGATCAAACCTAGTACAGCTTTAAAAAATGATCCTATATCTATATGTAATAT
> GCGCACGGTACCAAGTATGGTAGTGAACGGGAGAGCGCGTTTTAATTCAAATTCTATGTA
> AAGCGGTGTCATATGGGACACACCGAAAAGTATGACATTTTGGCATTTCCCTCATAGTAA
> GCCTCTAAGCGGGCTTCCTAAATAAAATGAGCTAATATCCATAGAGCGGCTGAAGCATAT
> CATCAATTGAGGAGCCTGTATAGCACTTTGAGAACTAACCTATTGGAATGAATGTACGTA
> CTGGAAAATTAGGGTTGTAGAGTCAGTAAACATCATACCTCCGTGCAAGCAAGCCTTATT
> AAGTGTTCTTTCGATTTGGTACATAAATTTTACCTTCGAACACTATTTCACAGGAACTCA
> AACACCATTAATACCTAGTGACTCTCGAGGCGTTTGGGCTAGTTACTTTGGACTTCAGCG
> TTTGTGAAAGTTTAACATATAATTTTTATAAGTATGCGATCCCAAGTTGTTACTTAACTC
> CCTCCAATGCGTCCACAACAACTTTTGTTTAGACAACATCAAGGAATGAGTGTGTGATCT
> GAATCTACATGGATGAATTCGGTCATTAAAGATGACACGCAGGATTCTCACAGGCCTCCA
> ACCGCCATCTTAAATGCAGCCCAAAGTTAAGGATAGCATCTGATTTTGGTAAGGATTGCC
> CACATGCACTAAAACTTGTACCAAGAACAACCCATCCTTTGTTTCCACGGTTTGAGTCTC
> ACACTCACGGCCTTAATAGTACCTGTTCTGTATAGGCTTGTGCCTCAATAAAACATAAAT
> AGACCCAAAAGGAGTGAGATTGCTCTCGTCAATATTAGAAAATAATTGCGCACGCATGGG
> GCAGGCGTCATTTGAATGCGTAAGATTAACCTGAAAACAAGATGTCAGAATAAACAGATA
> GAATTATTCATCCGTATTCGAAGATGCCCCTTCCTTCTGTATTAAGTTATCTCCGTCGAT
> ACAATGTTTCTCTTTGCCGCGTTTGGTAATCCGGAAACCGTGGACTATATTTTTGATGCT
> GCATACTAGACGCGTGTGGCGAGAGATTGACTATTTTCGAAGGTGCGTCAAATGCATGCC
> TGTAGAGACGTTAGGAGTAACTAATTAACCTATTCGGCCATACCCTTCGATGATACAAAA
> AGATAAGATGGCTCAGAATTCTAATTGGTGGAGTATGTATTGTCTTACGGGGTATGAAGG
> CTCATGTTAACTTATTAATAGGTAATAAGTAGTCCTGAAAAACTCATCGTGACCCTAAGT
> TGCATCAGGTCACCTTTTGATGCTTCATTGGTTTGCCGGAATTAAACCTTAACACGTGCC
> TGGCTGATAGATCGGAGCTTGTTCGTGTCGTCTAGTATTATGCCGGGAATGAAGGGTTCC
> ATTCGTGATATAAAATTGAATACAACCCATTGTTCAAAAATAACGTCATTATCCCTTCAC
> TAACCTTTAACTTGAGCAATAAAATTAGAAAATACCAATTTTACTAGGTCAGCAGCTTAA
> CTATAGGCTCTAACCTCTAATGAAGATACTTACAGTGATCAAGTGAGTCTTGCGGAGGTC
> TCGCGGCATATGCTGTCCATAGCGCCAGCAGAAATTGTAAAAGCTCGATGAGAGATTGGA
> TAACTGATGATTTCTATGCTACGGGGGATGTTAATGTCCGAAACATCTTAAATTTGATTT
> ATTTTGTCCACTGGCCTCTACAATACCCTAGGAAAAAAAGAGTAGTAATAATTGAAGTTT
> AGGAACAGTTGCGTCGCCATTTAACTTTAGAGGCTCTAGTTCAAGTCCGTCAAATATGCA
> TTGAGGCAGAAATTCTGCGGATCAAAACAGACGTTAGAACACCTCTGGGTCATAGCGATA
> CCAAAAATCTCTTGGTAATTATCTTTACTTCCTTATATTCCCTGAACCTATAATTTTCCA
> GAGACCGTACTCGTACAGTGGACTCAATCCCCACGCATAAATCACCTTCTTTTGCTAGTC
> CAAATTGTGATCTTCAACGTCTTATTATTGGCCGATACATGAATTCGCCTTCAGGTATAC
> TCCAAGCTGAATATTAGAGTAACACATCGTTTAGTGCACCCCGTTCAATTTATACAAGCT
> TGTTATTCTTGGCTCTAACTGAATATCGAATGACTGAATTAGGTCGGCAACAAGTAGCGT
> ATTTTAGCTTAATATCACGTTTTAACATAATTCCAGCCAATTACTTTCACCCCACTATCT
> AATAGCCGATAACTGCTCAGCGTTTTAATTGTCAACCTCAAGCGGGATTTTAATTTTGAT
> ACGCGACCGATTATTCTGATTAGATTTCGCTGACCTAATACGGAGTAAGAACTGAACAAG
> GATACGGCGGATGAACGTGAGTCGGGCTAGTTGTTTGTTGCTTCTCTTGCCCTATACGAG
> AAGAGCATGATTCGCGGTGTTTTCATCTGATGATTGAAGGAAATGTATGCAATTAATTAA
> AGCTCAGAGCTGTACTAGGACAGGGGGAGTTTGATGTGACCTGTATACAGAGAACTATAC
> TAAGCCCTCACTATTCGGAACGGATATTGCAGTAAATTCTGACATTCATACAAAGATAAG
> ATCTAGAGCAAGCGGGTGAGCTGCCTTCTGATTAAAATTATGTTTTCACGGTCAAATGTC
> AGCATTGCTGACCAAATGTAATTCTAGGACTTATGCGGGGTACCTTGTCGCGAGGTCCTG
> AGCAAGAAAGCAGTTCCCTGGCATTCGTGCTTGGTGTAATAGTCCACTACTTTCTTAGAT
> AAGCATTTGATGAATCGGCTCTTGCATTTCCCTCATTCCGAGAACGCGTCCCACAGACAA
> AAGCTAGACTAGTGACATATACAACTTAAATGTCTCCAAGATAAGGTAGATGGCGGTTTT
> AGAAATTTGTTTAGTAGCCGTACTTAGCAGTCCTTCTCATCCCAAAATCACCATAAAACA
> TATTTGCTTAATTCCAATCTCTCTCATAACGTAGCGAACTTGGAACTACTCATAAGTAAT
> TAAGCGCGAGTTATGCAGATCTGCGCACTACGTTTTTCACGTTTTACTTCGCGCGGCAGC
> CATCTAATTAACCTATATTAGGAATCGAATCTCTTCGAGTCAGCTAAAGGATAGCTAAAT
> GCGCAGTACAACCAATTAGATGTGACTCACGGGGCTTTCAATTGATTATGGCTTAACGGT
> CGGGCAAGTCTCCCACGCACTCTTTATGTCACAACAAAAATTCTATGTTAGAAGCCACTA
> AAACATGTGCGCGGTGGAAACTGCGAAGTGTGTTATCAAGTCTCTAACCCAAGGGTCCGT
> ACCGTGAAATTATGACCGCAAAGCTGCGGTCTAGAAATGAAGTTAGCAAATTCTTACACA
> TTGGAATAAAGAGGTAGCAGCGCCTTGTGTGGGCGTGAGTGATCTCCAGCTTATATCCGC
> ATCAATTACCTGGTGTCACACACACGGAAGCAAGAATATAGTTTCTCACTCGGTGTTCGT
> GTCTATCGAGTTACATGCCTATACGAAGTGATACAGACAAGCTCGTGGAAGAGACTGCTT
> CCGCAACACTTAGAGTAGTCATTATTTTTGTCAGATTAAGTGAGGTTGCAACTGGGGCAG
> TATTCAATGAGTGTGCTTGAGCTTTCCCTGTATCGTCCTTACTTTGATATTGAACAGCAA
> TTTTAGGGAACAGTGAAGATACTTAATGCCTCCATCCGTTGCTGAACAAGCAAGTAAGAC
> GTAAACTGAAGCCGTGATGGATGAGGAGTGAGAGCATCTATCCAGAGAAGTTAGAAAATA
> CTGGCCACTATGCCTGTAGAACTACAGCATAGTAGTTAAAAAGCGAGTTGGTATAACACT
> AGATGCGCGCCCTTCCATGGAGGAGTACGCCCGGACCCTGAGGCACGTATGAGAATTTGC
> TGGGCTATTGTTACAATGAGGTTCATGCATCGACACTCTCAACGTAAAGGGATGCTTTCG
> TAGATAACCTGCACATCGCCTCCCGATGAGAGAGATAGCGTACCGGGAAGCGTTTGGTTC
> ATTGGCCGATATTCACTAATGTGTTACACTTTAATGAGTACTCGAGCTACTTCAGAGTTG
> TTCAAGCGTTTCTTTCAGTTATTTTGCAAACACACAGTAGACCCCAAAAAGACTGCTGCG
> ATTGTTTTAAACTTTTCAACGAGTTGAGGCAACACAAGATTCTATTATGCGCTTCGTGAC
> ACTCAGAAATCTGCACATGGCAATTTAGGAAAAGATACATTGTCCCTATGCTTCGATTGT
> TTCCGGCTAAAACTGTTGATTGAGCTCGGGCAATATCTGTTTCTAAGGCATAAGTGAAAT
> CCATCTGAATAGCATGAATTTTAGTTTCGCACACATAATTGTCCAAACTGTATATAGATG
> ATATCTTGAAATCAGCATTTAACAACTAGTCTATAGTTTAAGCTTCGGCCACTTTGACTG
> TAGGGTCGGAACTAGTCTCCTACCTTGAGCAGTGGTTCCTTGAGTATAGTCAGCTACGAA
> GCTAGAATCAGATTTCCACTACCGTGTAAGTATGAGAAATTGTATATCACCTAGACCCCA
> TGCGAGGCCAGAACAACATTCTACAATCTTCACTCCATTCAGTTTAACTGATACTGGATC
> CAATAACAAATGAATTAGCGTTTGTATCAGTTTTGAGGATCCTAATCTTTAAGCTCATTG
> GTGACGTATCGTAAAAACTGTTATTTATCTGGAGAGTTCTTGAGTATGATAATCCACTAT
> GTTTAGTTTTGGTATTCCAAGTCATTATTACTTACGTCTGCTTCGTAAAGACAAGACTAC
> ATTTATATATTACTCTTCCACAATAAGGCTGCTCAGTACGGCAACCGTTGATAGGATAAC
> GATAGAATGCATATTTCTAGGCGAGGCAAGACAGCTGATGATACTAGTAGAGCACCGTGG
> ATTAAGCTGGTAACTCTTAAACATGTCTCGAAGTTTACATAGACTATCCTGTTAACCAAG
> GTGTTTTCCGGTGAATTCCCTCTCATCGAAAGCGACACGACTTTATCAGTACCTACTATC
> CGAACACACCCACAGAAGACGGCTCAAGAGGTTCCCATGAAACTATTGAACTACCAATGT
> GCTCCTGCGAAAGCATTTTTTTGTACATGAAACTACAAGGTCAAAGTTGTCTACTTGGGA
> AGTGATACGATTGTAGAGAATGTAATGGCTCCAGTCCAATTAATTATCCTGTAGTCAACT
> ATGTTCGACCACCAGGGGCGTTTTTATTAGTTGATATAGTGGCTTGTCTATTTTAGTTAA
> TCACAGTCTTGATTCAGTGTTCGATCATAAGTGGTACAAGTCAATTGCGCAATTCAATGT
> CTAATAGAATGACAAACTTCTTTATCTGATTTTGTGCGAAGTAGTCGAAAACCGATTAAA
> TGCGTTGCTACAAGTTGTCCCTTTCGTACTAACTTTAATAGCACGAACCTGTTGACGGAG
> AAGCTCTAAATGATACTAAGATAGAAAGCAATTATACTAACGTAGATAGGAAAGTAGTCT
> GTGTAGAAAATGATGGAGCAAGAGGGCAGATGAGGTCGAGATCTAGATGATGAGGGCTTT
> ATCAACGCCTCTTGCTAAATATCAGGAACGCCGCCACGACAGTGGGAGTTCTGCGTTCTC
> AACATCGATGCAAATCCGGTGTACCCGCACGCGGTCAACTCTCCTAGACAGTTGACGTCA
> GACCTCATACTATCAACGTGGGATACATCCTACCTGCAATAACTGGAAAGATCTTACCTT
> GTGGCACAACTTGATAATTTTGCTTAGATCCTATGCGCTTCTCATTGACGGGTCAAATAA
> AAATCGCTGTTTACACTAAGAATCGAATCTTGCTATAATCAGAAAAACACAGAGAAGTAC
> GACTCACACGAACAACAGAGCCGGGTAGTTTATATCAATAGGAAAGGCCTATCGTAGTCT
> TATTTAAAATGAACTTTGGAAAACACCTTCAAGACTGAGTAATCAATTGTTCGTGGTCTC
> AACGCTAAGTGTTACAGACTAAAGTGTCCGAACATCTCCTCGGGGATTGATCAAAGTGGA
> CCGTCCAATGAATTAGCTCACTGGAGATATTGGGACGGCAGATAACGTGCTTTCATTCCA
> TAGAACTTCAAGCAATATAACTCCAACGCGATGAGTCATTCTCATCCTTGGTTATTGTAT
> TATAAGTATTTAGATATCGTAATTTCTTTGACGCCAACAAAGTGATCGAGTTGGAGGACT
> ACAATTACGGTGATCGCGGACCATCAGAGTCTGAAGATCTAAGGCACGTGCGTCTAGGAT
> ATCATTAATCACTACCTAGTACAGTCCCCTTAGCCTCTAGATGGTCGATTACGTACGAAG
> GGCGCGAGCGTGATGTTTGAGTAGGTAATTAAACCCTTAACTAAAGCCGCACTCAAATTT
> TATATGTCCCTACCTGTCGTTTCACACCTAACTCTAGCCTCAAGGTGGTACCCGTTCTCG
> TTGAAGGTCGTCTATAAGTATTCAGATTAGCATCTAATGCGATCTAACTTATATATTAGC
> ACATAGGGACACGCGACCGAACTCCTGAAAAGTCTGATCCCGAACAAGTTCGCGTCAATA
> CATAGCGTGAGTGGGCTCGAGAAGGGAGGGGGCGTTTTTGACGAAACTTGGAGTCACTAG
> TGTATGTAAGAGACTGACATTACTCGCACGTCCAGCGTCAGCTTAAGATCGAAAAGCCGG
> GTATGTTAAACATATTCACTTAACTGAACTTGGAAAAGTATCATTCATTTATGTCACGAG
> TTTTTCATTGTTGCCACGCTCCACCGAGTATCTTCTAGCAGTTCAGGACCTGAGTATTGT
> CTCTCGAACCTTTCTTCAAAAATGTGAGAGACATAAAACGATTTGTCTCCTAGGATAAAT
> TAGACGTACGTCAGAAAAATTGAGCGAATGGATTTTCTGATCATCTTCTCTTAATATTCC
> AAAGGTGCGAGTGGGTGTAACCACACGCGAATTTGAATAGCGAAATGTATGTCGCCATGC
> AGAGAAAGTAAGTTTACCATGATGCACGGTCTAGAACTGAATGCCATTATGATATTTAAC
> AGATTCTTTAATCGTAACGGATTATCATATAAAGTTCCGTCGTTATAATCTTCTAAGTTC
> ATTATATGCGTCACAAAGGTGCCGTGAAACCGTGCCATATTGAACATTTGCAAGTCAGAA
> GTAATGAGATTCGTCATTAAAACAGAGTCGGAAATATCTCTTCGCTTAGAGACAGCATTA
> ATTTTATTCCTACAGCTTATCATTAGGGTAGTTATACTTCGTGACATATACTCTGCCTAG
> CCGGTTACCTTATTGGCGACACCAGCTTTTCAACGATACATTAATATTAACCGTATTAAT
> TTACTCTAACCCACAAACTAATCGTTATTAGGGGTGTCGGTATAGAAGATGTGAACCCAA
> AGGGCGGGAGAACATCAGGGAACTCCAAAGTTGCAGAGATAGATGACGCCTGTATAGTTT
> AAGTATAGGTATGTCTAGCCTATTAGTCCCCATACTTATCCAACCAGACAGCCGATAGGA
> AAGTCCGAATAGTGTATCCGCTAAATTGTACTATGATTCTGGCCACCCCAAGCCCATTTC
> ATTAGTCTAGTAATAAAGTTAAGACTTGACAGGGTATTTCCGTCATATAAGAGCTTTGAG
> AGTAAAACAAAATCCAGTGTTTTTCGTTGAAGGTTTCTCCCTTCCTGTTTACTAAGGATC
> CAAAGTATAATAAAAATCAGGCCAAGTACGAGAATTTACTTATATCTCGTGAGTTATAAT
> TGATAGTTGGACTAGACGATAACCCGTAGAATTTCACTGGAGAATGTGGCGTATTTCCTC
> TTACTGATTTTCACTAGGTTAACTGTCAAATTGATATTCAAGCTGGACTATATAATACCT
> CGAAAATAGGTTCCCTGTCAATACTTTTGTTTAAGTGGTGTAAGGCAGGACTCGATTGAC
> GATAGGCAACATCTCGCAACCTGAAAAAGCAGATCATCGTGTCTTATGTATAATGAATCC
> CATCTATTGTTTGTAATATGCGGATTACACGCTGCGAGCAATTTTAGCTTTAGGTGAGTT
> CTAAGTATCGGTGATATATCAACTGTACAGGTCAAACTCCACCCTCTTGACATGAAATGA
> AAGCCGTATAGCTAAATGACTGGTAAGCATTATTTCACTTGGCTTTCTATAGTTACACCG
> ACTCCACATCCGGATTTATTATCTTCTGTTATATCCGTTTAACGCGAGTATGGTGTATGT
> ACGACTCAAGGATGTTTTTAACCGCATTGGTATTTGTGAAATCTAAAGCGGCTTATGTGC
> GGGGGTTTTTGCCACGTCTTTATTGTCCACTTTGAACACTTACGCACAATTTTATACTTA
> CATAGATAAATGGTTTGGGGTAGGTGTGAGCCTTACTTCCCGTTAAGACTCACGATCGTA
> TGATTAGAAGCCGGTAATACCGTCTAGACGCAGTCCCTAGGCCTGTACAGACCATCATAG
> TGTGGGATTCAGGCTTCCGATGTAATACTCCCACGTCAATAACTTGAGCAGTGGCCTTTT
> TCATCCCTTGCTGAACGTATTACGGAACAGTTTTAGTAATACTCCCGTAATGGGGATGTC
> CCTCTCGGGCTTGAACAAAATGTGCGTAGTGGGCCATTAAGAAGCCCCTATGGTTAAGAA
> AACGAAACATCTTCGAGTAGTTCGGGCATCTGCTTTCTTCGGACTTCCACTTTATACAGT
> TATCGTTTGTTAAACTCGTGAATTCCTACGTTTTTTTTAAGAAGGGTGTATTCGTAGAAA
> TTTTATGGAAGTAACGTGTGCGATTGACGGTTTTACAAGCAATGCTCGACGCAGCTAATT
> ACACAAAGTAACTACACATTCACCTTGTTTCATCGTCAAAGTTTTTACATATTAACCATT
> TGGTGGTGGATTTCAAGGAATAGCTAGTCATAAGACGCCCGCACAGTGATTATTAGGTCA
> AGTCATCATGTTTGAGTAGGCCCCTCCCAATCACATAAAGCCGAGATATTTACTTTGTAT
> AAAAGGTCTAAATACAGTATACACAGACAAGATTACAAGGCGCGATGGTAGGACACCTCC
> TCGATGATTCATGCTGCGGAGTATCGGCTGTATAACCCTGATTTTCCTGTAAGGCTTCTA
> GACTTTAATATACTACGACAGAAAACAAAAGGTGTAATAGATAGTCTTTAATAACCACTA
> ACATTTCGTCAAGTTACTCATCACATATTTTTTATATGATGGTAGGGACTCAATATTTTT
> TTTCTTTTACATTTTTTTTGCCATTCTTTCTTGTCCAAGGACGTGCGGTCGAAACCATAG
> GAATAATTACCGTCAATATATTAAAAATGGCCGTAAATAGCGCCGGGTAAGGCGGGATAG
> TAGCCGAGACCGATCTTAGTAAATATAACTTAAACTCCTACGATCCATTAATGAATCCGT
> GTAGCATATCGACTATGGTGGATAATAAGCGTCACGGACGTCCATAAATGATAAAGTATA
> TGTATGCAGGGCAGCTCCAGCAAATCAGTTAGTTTAAGGGAGGGGGTTACCTAATAAAAA
> GGATGGGTGACTTTAGTCGCCAACTCAGCATAGCCATTTCTTCGCAATAACAGAACAAAT
> ACTGGTGATATGGGGTAAAAACTCATTCTTAGTGTATTGCACTCAGCATCAGGGAAGCAT
> GGTAAATTATACCCAGTTGTAGCTTCGACGTCATCCTTACGGTGGCGCACCCTATGCAGA
> AGATCGTTCTTGCAAAATGCTGACGCTGTGTCAATCAAAGGGGGGGGTCGTGAATCACTA
> TGTGAGAGATCCGTCGAATCGTGTACGCCAGTATATAATATTATTAACTGCATTTGGCTT
> CCATTATAATCCCTTAGGTGCTACCTACGGATGTATCGTTCATTTATTATGGGCTCTAGA
> GAAATTACAGTGGTAGCTCTGAGCCTCTTAGCAATTCGTCAAGATTTAGGGTCCCAATCG
> ACTCCTTGCGGCGCCCGGTACTTTACTCTTAGTTGTCTCGAAGAGGGTGCTTCGCCTCAA
> AGTTACAAAGATCTTCAGTTGATATGATCGGTAGTCTTTGTGTTCTGTTTATATTTCAAC
> TACAGGAGCACGTCGTTTAAGTGGTAAGGTATATGGCTCCAAGCGACTGACTATTCTAGC
> CGCAAAAATACGGTCTTTCGGAGTTAACGTATGTTTGAAATTTTGTCGATCAGGTTCCAG
> TAGCATAGGCCCAAAGATTGAATCCAATTTTCAATCATTTACGGACATCCTTACGGCTAA
> ATTAAAAATGGAACAAAATTTAAAATCCTATTGCTGCGCATGCACCTGGACTCGCACAAC
> GCTGCGGCTCTACGTCCGTCTTATGCGATTCTTTGCCAACCTTATTTCTTACCGATAAGC
> AGGTGAAGAAACTAGTGATTTAAGTACTTGTCCGCGCACAGCCGATAATGGGTCAAGGTT
> ATGAAAACCTCGATAATGATCAATGATAGCACATGTCTGGTTACCGGGCTTTAGGCAACC
> GTGACATATGGTTTCTTGCTCTTCAACTTCGAAGTTCGCTCATTATTCAAAGTTCCAGGA
> GCTCTATATGGCGTATGTGTGTCATTTTAATATACTGAAGTTACCAGGCATCACTATAAT
> AGCTTCTACAGCATAAAAGTTCTTTTATTTGGAATAAGTAGGGCTGTTAACCGGTCCAAT
> GGGGTATCATAGGTAAGGTTAGCATCAACTCAGCTTAGTTTGTATTCTGCCGTCGCAAAC
> TTAGCATATAGGATATCGACTGATAAGTAATCCCACGGTGGAGGTGGCGCAATGATCTTT
> ATGCTTGCCACCTGGATATATCTTTAAATGTCAGTTTAGGTCATACTATTAAGATTGTCC
> CATTTCTAGTAGTCCCTTAAAACAAACTCTATCTATTAGTAAGATTGCTTTGAAGAGGCT
> ATTTGCCTACAAGGAGGTTCAAATATGCTCGAAGCAGTTGTTTCGGACTATTAACTAAAC
> TTATGGAAGATGGTATCCATTCGCTAAGAGTGCTATCTCTGGCTTACTAAAGAGTTAGAC
> AACTATTGATGTCCGCTCACATAACGTAATATCCAAACGTGTAGACAATAGCAACACTAA
> ACGTATTACTATTTGAAAAATGAATATATTCCAGAACCACGTAGCGCCTGGAATTGCCAA
> GAGCTCTGATGAAGTGAGACAATTGGCTATTCTTATTGCATTGATTCTGAAAACGCTAGC
> TTATCCCCAGTGGAACAAATGAAGGGGAAAGGGTGGGAGGTAGTCACATTGATCATAACA
> AGTTCGATATTTAGATGGCAGACGTTAGGGTAGGGCAGTAATCGGGATTGGGCTTTGGCT
> AACGGGAGTTATGTTATAACTTTTCGTTGAGTCGTAAGGATCTCACTATCGCTCCGTGGG
> CTTTACATACCAGATAAAAAAGTAGACCTGATATGCTCTAGCACTGAATATTTTTAAAAA
> TAATCGGATTTTAATCCAGTGCAACAGATCCGAGGTGCGTTCCATCCCTTTTCATTAGCT
> GGCTTTCATCATATTGTATTGCATTACTTTCTCGTGCAAAAATTGTACTCAGTTTAATAA
> TGAGACGTGTGAGTTTTCTTATATCCCCAAGGTAACAAGTTTCCTTGTGTACGGGACACC
> GCGGTGGAATGCATTGTATATCGATAGCGGTGTAAGATGCCTCACAACGAAAAGGATGAC
> TGTTTCCAATTTCACTCAGAGTAAGACTCGAAGAGCCCTTAATAAATTATATGACCGAAT
> ATCCTGAGACCCGATGTTGAATTTATTAAATTGACCACCCTGGATACCACTTTCTGAACT
> AAAAGATGCGTTTCATTCTTAGGACTGCTTTATTAGGGTTGTAGAGGCAGTAAACAGCAT
> AAATAACTCCTACAAAGCATTAGGTTCTGTGATTTCCATGTCGTTAATTAATTTTAAATT
> AGTTAACTATTTCAAAGGAACTCAAAAACCTTGTATACCTAGTCACTATCGAGGCGTTTC
> GCATAGGGTATTGCGACTGCTCACTTTGTCAATCGGTAAAATTTAAGGGTTTTTACTATG
> ACTGAACAAGGTCTTAATTAACTCAATCCAATCCGGCCTATTAAACTTTTGGTTAGAATT
> CTTCATGCAAGGTCTCTCGGTGAGGTAGCGAAATCCATGTATTAGCTCATGATTGAGCTC
> TCCAACGATTATAAAACCCATACATCCGAAATCTTATATCAAGCCCAAACTTTAGGATAG
> AATCTCATTTTGCTTAGGATTGCCCACTGGCAATTAAACTGGTACCATCTACATACAATC
> CTTTGTTTAAACGCGTGGTCGCTAAAAATATAGCCCTTAATAGGACCGGTTATCTATTGG
> ATTGTCACTAAATAAAACATAATTAGACCAAATACGTGGGTGAGTGATCGACGCAATATT
> ACATTTTATTTGAGAACCCATGGCCCACGAGTATTGTGTATCACTAACATTAACCTGTAT
> ACTAGAGGTCACATTTTTATGATACAAGTATTCATCCCGATTCGAAGATGCACATTACGT
> CTGTTTTTTGGGATATACGTCGATAATATCTTTCTCTGTGAACCCTTTGCTAATCAGGAA
> TCCGGGCTATATTTTTTGGATCATCAATTAGTGAAGCGTCGGGCGTGAGATGGTATAGTT
> TCCAACGTCAGTCTTTTCCATGCCTGGTCAGTCCTGTGGACGAAATATTGAACAGTTTCC
> CCCTGACACTTCCAGGAGTCTATTTGATATCATCGCTAACAATTCTATGTGGTGGTGTAT
> GTATTCTCTTTAGCGCTAGCAAGCCTCATCGTAAAGTATGATTTGGGATTTAGTACTAAT
> GTAAAACTCATCGGCTCACTATGGTGAAGCAGGTAACATTGTGAGCCTTCATTCCTTTGA
> CCCTTTTAATCAGTAACACGTCCCTCCAGGATACTGCGGACCTGCGTCGTGTAGGATACT
> AGTAGGACCCCTATGAAGGCTTCAATTACTGATATTAAATTCTAGAAAACCCATTGTGAA
> AAAATTTCGTCAGTATCAATTAAATAACCTGTTAATGGAGCATGATAATGACATAATTCA
> AATTTTACTTGCTATGATGATTAACTAGTCGCGATAAAATCGTATCATCATAATGAAACT
> GATCATCTCACTCGTCACCACCTCGCGAGCAAGTTCCTGGCAAGAGCGCCAGCACAAATG
> CTATAAGCTCGAGGAGTCAGGCCATAACGGAGGATTTCGATGATACGGGGGTTGTTATTC
> TAAGATAAATCTTATTGTGGATGTTTTTTGTACACTCGACTATAAATTAAAATAGCTATA
> TAACTCGTGGATGAATTCAACTTGACCAACTGTGGACTAGCATTTTAACTTTAGTCGATC
> TTCGTCTTCTCAGTAAATTTTGAAGTGACCCTCAATTTCGGACGAGCAATACTCAAGTTT
> CAAAACAGCGGCGGAAGAGCGTGTCATAATATCGCTTCCTTATGAGCTTTTCTTACTTAG
> ATGCCAGGAAACTATTATTTGAAAGAGTCCCGAATACGAATCTGGACTATTGCACAACCA
> TTAAATAAAAGTCGGGTGCTTGGCCAATTGCTGATCTGCTAAGTATTATTTGTGGACGAG
> TCATGTAGTCCACGGCACCTATAATCAATCATGATTATTAGACTAAAACTTAGGTTAGTC
> AACACAGTGCTTTGGATAAAACCTTCTGAGTATTGCCTCTATCTGAATAGAGAAGGACGC
> AATGTGCTAGGCAAAATCTACCGTTTTGTAGATTATTAGATCGGTTTAACATATTTAAAG
> CAAAGTAAGTTCTACCAAAGATATTTTACAAGTGAAATGCTCACACTGTGTATTCTCATC
> ATATTCCGCGATTTTAATGTTGTTAACACAACGATTATTCTGTTTACATTTCGCTCAACT
> TATACGGAGGAAGTACTGAAAAACCATAAGCCCGTTCAACGTCACTCCGCCTTCTTCTTG
> GGGGATTCGCTGCCAATTTAACTGAACTCAATGTTTCCCCCTGGGTTCATATCATGTGTG
> AACGATATGGTTGCATTTTAGGATAGATCTCAGCTGTACTTCCACTCGCGGACGTTCAGC
> TGAACTGTATACACAGATCTATACTATGCCCTAACTAGTCGCATCGCTTATTCATCTATA
> TGATCACATGCATACAAACAGAAGATCGACTCCAAGAGCCTGTCCTCAAGTCTGAGTAAA
> TTTATGGGTGCTAGGTATAATGTCAGAATTGCTGACCAAATGTAAGTATTGGTATTATCA
> GGGCTACATGGGCGCGACGTCCGCACCTTCATAGCAGTGCAATCGCATTAGGCATGCCGG
> TAATAGTAATCTACTTTCTTAGTTTAGCATGTCATGAATCGCATATGCCAGTGACCTATG
> GACGACAACCACTCACACAGACATTTCCTAGAAGACTGAAATAGACTAATGTAAGCTCTC
> AAACTTAAGCGAGATGCAGCTTTTACAAATGGCTTGAGTACCCCTTCTTTCCACGCAGTC
> TAATCAAATAATCAACATATATAATTTTTGAGTAATTCAATGCGCTCTATGAAACGACCG
> AAATTGCAAATACGATGTAGGTATTTTCACCGTGTTAGCCACATATGCGAACGACGTTTG
> TAACGGTGTACTGCGCCACGCAGCATTATAATTATCCTATAGTACCATTAGAATCTCTTC
> GTGTAAGCTAATCCATAGCGAAATCCCAACTAAAAACAATTTCAGGTCACTCACCCGGCG
> GTATATGGATTATGCCTTTACGCTCGGGCAACTCTCCATACAACGAGGGATGTCTAAACA
> ATAATTCTATGTGAGAACACAATAAATAATGGGAGAGGGCGAAAATCCGATGTGTGGTAG
> AAAGGATATTTCCCAACGCTACGTTCCGTGAATTGTTCTCCGCAAAGATCCGGTCTACTT
> TTGAACTGACCAATTTCTGACACATTCCTTTTTAGACCGAGAAGAGCATTGGGTCCCCCT
> CAGTGTTCGCCAGCGTATTGACGATTAATTTTCATCGTCTCTCTAACAACGTACCTAGTA
> TTTAGGTTATATATACCTCTTCGTCTCGATCGTCGTACATCCAGTTTCGAAGGCATAAAC
> ACATGATCGTGGATCTCAATGCTGACGAAACACTTACAGTACTAATGAGTGGTGTAACAT
> GAACTGACCGGGCAAATGGGGATCTTTTCTATCACTGTCATTCAGATTTCCATGTTTCCT
> CATTAATTTCATATTGTACACCAATTGTACCGATATCTGAACTTTATGAATCCATAATTA
> AGTTGATCAAAAAGCAAGTAAGTCGGTTTCTGTAGACCTCATGGATCACGTGGCAGTCAT
> TCTTTACAGTGAAGGGACTTAATTATGGACACTTTCCATGTACATATTATCCATTCTTGG
> GATAAAGAGTCTGCCGATAACAAGTCATGACACCCCGTACATGCAGCACTAAGCAAGGTA
> AAGGACGAACCTAGCACAATGTGATCGGATATTGTGAAATTGACCTTAATGAAGCGACTC
> GATCAACCTATAGGCTTGCTTTCGTACATTACCGGAACAGCCACGACAGTTCACAGAGAT
> TGCCTAACGCCAAGCGGGTGCTTCAGTGGACCAGATGCACTAATGTCTTACTAGTTAATC
> AGTAATAGACATTATTCACAGTTCTTCTAGACTTTCTGTCACGTTTTTTCATTTCTCAAT
> GTAGACCAAATAAAGAATGCTGCGATGGTTTTAAACTTTGCAACGACTTGACGAAACTAA
> AGTGTCTATTTGGACCTGAGTCACACTAACAATTCTGCACATCCATATTTTGGAAATCAT
> TCATTGTCCCGAGCAGTAGAGGGTTTCCGGCTAAAACGGGTGTTTCACATACCGCTTTAT
> ATGTGTAGTAGCCATAACTCTATGCCATCTGAAGTGAATGATTTTTAGTTTAGAACAATT
> AATTGTCCAAACTGTAGTTACTTGTGTTATTCATATCACAATTTATATTATACTATATTC
> GTTAACATTAGGAAACGGGGTCTCGAGGCTCGCAAATAGTATACGAACGGCTCCAGTCGT
> TCATTCAGTTGTGTAAGATACCATGCTAGAAGCACATTTCAAATACCGTCTAACTATCAG
> AATTTGTATAGAACCGTGACACAATGACTGCCATGTAAAACTTTATACTATCTTCAATCC
> ATGCTGGTGAAATGTTAAGGGAGACATTAAATATTGAATTACCCTGTCTATAACTGGTCA
> CCAGCAGATGATTTTTGAGCTTTGGTGAAGGTTAGTATAATCGCGTATTTAGATCCTGAG
> TTAGTCACTATCAGAATAAAAGAGCTTTACTTTTCCTATTCCTAGGCTTGTGTACTTTCC
> GAGGATTAGGAAACACAACAAGACATGTATTTATTACTCTGACAAATTAACCAGCCTAAG
> TAACGCAACAGTTGTTACCATTACGTGAGAATCCATATTGCTTGCACAGGCATGAAAGCT
> GATCAGACTAGTAGACAACAGTGGTTTATGATGGTAACTATTTAACATGGCTCCAACTTT
> TCTGACTCTAGCCTGGTAAAAAAGGTGTTGGCAGCTGTATGAAATCGCAGCGTATGCCAC
> ACGACGGTTTATGTACCTACTATCCGTACACAACCTAAGAAGAAGGCTAATGACGGTCAA
> ATGAATATATTCTACTACAATTGGCCTACTCACATAGATGTTTTTTGTAAATCATACTAC
> ATCGGAAAAGTGGTATTCTTCCGATGGGTGACGATTGTACACAAGGTATTCGATCCTGGA
> CAATGATTTAGCCTCTTGTAAAAGATGTTAGTCAACAAGGGGAGTGTGTTTTTGTGCATT
> GACGGGATGGTAGATTTTACGTATTCACACGCGTGATGCACTCTTCGATCTTATGGCCGA
> CAACGATATTGAGCATGTAATGGTATAATTGTAGCACTAACTTCTGTATCTCATGGTGTC
> CGTAGTAGTCGTAAAAACAGGTAAGGACTGGCTACTAGTTGTACATTTACTACTAACTTT
> ATGAGCACCAACCGCTTCTCGGACAAGCGAGTAAGCTGTAGAAGAGAGAAAGCAAGTATA
> CTAAACTTGATACGATTGGTGTATCGGTAGTATATGATGGAGCAAGACGGAACTTGTCGT
> CCTGTTATAGTTGATGAGGGCGGTATAAAAGCATATTGATAAATTGAAGGAAACAAGACT
> ACACACTCCGAGTTCTCAGTTCTAAAAAGAGAGCCAAATCCGGTGTACCACAACGACGGA
> AAATCTCAGAGAAACTTCTACTCTGACATAATAAGATAATACTGGCATACATCCTTAATC
> ATATTAAGCGTTAGTTCTTACCGGGTCCAACTACGTCATTATTGTCCGTAGATAATTTGC
> CCTGCGCAGTGAACGGGCATATAAATATACCTGGGTTATCGATGAATAGAATCTTCATAG
> TTGAAGTATATATCAGAGAAGTACGTCGCAAAACAACATAAGAGAACGGGTCTTTTTTTA
> TTGTCCAAAGCACGATACTACTATTATTTAAAATGATATTTGGATAACTCCTTAAAGAAT
> CTGTAATCAAGTGTTCCGGGGCTCAACGCTAAGTCTTTAACAATAATCGCTCAGAAAATC
> GCATACCGCATTGATAATAGTGCTCCGTACATTCAATGACCTCAATGGTGATTTGGGGAC
> GGCTGATTACGTGAGTTATTTACATACAACGTAAAGCTTGAGAACTACTAAGACTTCACG
> CAGTCTAATAATTGCTTATGCTATTATAAGGATTTACATTTACTATGTGCTGGGACGCCA
> AAATAGTCATCCACTTGGAGCAATACAATTACCCGCATAGACGACCAGATGAGTCGGTAG
> AGATATGCAAAGTCCGTATAGGATTTCATTATGCACGAACTTGTTAAGTCCACTGACAAT
> ATTGATGCGACTTTACGTACGAACCCCCACACCGTGATGGTGCACTTCCTATGTAATCCA
> GTAACTAAACCCCCTAGCTAATGTTTTATCTACATTCCTCTAGTTTATCTACTATCTCGA
> GCCTCAACGGCGTACCCCGTCTCGTTCAAGGTCCTATTTTACTTTGCTGATTAGATTAGT
> TTGCGTTCTAACTTATATAGTAGCACATAGCCACAAGACAAACAACTAATCAAAAGGCTG
> TTCACCAACTTCTTCGACGAAAGAAAGTGACTCTCTGGCCTACTCATGCGAGCCGGAGTT
> TGGCACCAAAATGCCTCTCACTAGGCTTTCTAACTCTCGCTAAGTTAGAGCACCTCAAGC
> GGAACCTTATCTGACTAAACAAGCCTATCTGTATAATAGGCAATTTACTCAAATTGGATA
> ACTATAATTCATTTTTCGCTCGAGGTTTTCATTGGTGACACCATACACCGACTATCTGCT
> ACAACTTATGGACATCAGTTTTGTCGATAGATACTTTAGTCAATAATGTGACAGACATAA
> ATAGTTTTGGCTCATAGCATTAATTTCTCCTAAGTAAGATTATTTCAGCGAATGCATTGT
> CGGATAATCGTCTATTAATATTACTAACGGCCCACTCGGGCTTACCACAACCGAAGTGGT
> ATACCGATATCTAGCTCCCCAGCATCACATACGAACTTTACCATCATGAAAGCTCTTGAT
> CTCAATGCCATTATGAGATTTAAAAGTTTATGGTTGCGTAACGGTTGATAATAGAAACTT
> CCCTCCTGATAATCTTCTATCTTAATGATATGACTCACTAAGGTGCCGTCTATACGTGAC
> AGATTGAAATTGGGAAAGTCTCTTCTTTGGACATTAGTCATTTAAAATGAGGCCCTAAGA
> GCTCGTAGCGGAGACAATCATTTAATGTTATTAAGACAGATTATCATTAGGGTTCGGTGA
> AGGCCTGTATTAGAATATCCCTACAACGGTTAATGTTTGGCCTAAACACATTTGCAACGT
> TAAATTAATATTAACCCTTTTATTTGACTCTTTCACACTATCTAATCCTGAGTACGGCTC
> TACGTATAGTAGTTGTCATCCCAAACGCCCGGACTAAAGAAGCGAACTACAAACTTCCTC
> ACATAGATGTACCATGGTGACTTTAACTATACCTATCTCTAGCATTTTTGTCCACATACT
> GATAAATCCTCACAGCCCATAGGTAAGTCCGATTAGGCTAGACGAGAATTTCTACTATGA
> TTCGGCCCTAACATTGAACTTTTAATTAGTATAGTAATTATCTTTAGTCGTGAATGCGTA
> GTGACCGAATATTACAGATGTGACAGGAAAACTTATTACAGTGTTGTGCCTTCAAGGGTT
> ATCACTTCCTGGGTACTAAGCAGCAAATCGATAATAAATTTCTGGAAATGGACCAGATTT
> TTCGTATAGCTACTCAGTTATAAGTGAGAGTTCCAATACTCGTTAAACCGTTCAATTTAA
> ATCGAGTATGGGCCCTATGGCATATGAAGCTGGTGAAAGACCTTTACTGTCAAATTGATA
> TTAATGCTCGACTTTATAATACCTAGAAAATAGCTTCCCGGGCAATACTTTTGTTTAAGT
> GGTGGAAGGCACCAAGCGTTTCACCTTACCAATCATCTAGATAACTGTAAAACCAGATAA
> GCCTGTATTAGCTAGAATCAATCCCATCTAGGGGTTCTAATATCCGGATTTCACGCTCAG
> AGCTAGTTTACCTGTTCCTCTGGGATAACTATAGCTGATATAGCTACTGTACAGCTCATA
> ATACAAACGATTCAATTGAATGCAATGCAGGAGACCTAAATGTATGCTTAGCTTTTTTTC
> ACTTCCCTTTAGAGAGTTACACAGTCTACTCATCCGGATTTAGGTTATTCTCTTAGAGCC
> GTTGTTCCCGAGGTTGGTCTTGCGACCTCTCAAGGTGGGGTTTATCACAATTCCTATTTG
> TGTTTGCTTAACCCGATTTTCGCACCGCGTTGGTGCATCGTCTTGATTGGACACGTTGTT
> AAATTACCAACTAGTTTTTTAGTACATAGTTAAAGGGTTGCCCCTACGTCTCAGCCTTTA
> GGCAACGGATGTCTAAAGAGAGTTTGTGTTGAACCCGCGAATTCAGGCTAGAAGAAGGCA
> CTTGCAATCTTAAGTCCATAAGAGTGTGCCTTTAACGCTTCCGTGGTAATAATACCTAGT
> CATGTAAGTCAGAAGTGCCATTTTGAATCACTGCCTCATAGTATTACGGAACACGTGTAC
> TTATAATCAACGAATCCCGATCTCCCTCGAGCGAGTCTTCAATATGGCAGGAGTCGGACA
> TTATCAACAACCGAGCCTGAACAAAACGTAACAGATGCCAGGAGTTCGCCAATCTCCTTG
> CTTCCCACTGCCAAGTTATACACTTATCGTGTCTTAATCTAGTGAAGTACTACGTGTGTT
> TTAAGATGCCTGGAGTAGTAGAAATGTTATGCATCTATCCGCTGCGATGGTACCGGTTTA
> TAGAAATGATCGAAGCAGAGAATTAAACTATGTTTCTTCAAAGTCACCTTGTGGAATCGT
> AAATGTTGTTACTTTGTATCAAGTTCGTCGTGCAGTTCTAGCATGAGATACTCTTAACAC
> GCCCGCTCTCTGAGTTGTAGCTATAGTCATCATGTTTGACTAGCCCCATACATAGCAAAG
> AAACACCACATAGTGAAGTGGTATAATAGCTCGAAAGACAGTAGTAAATGACTAGATTTC
> AACGAGCGAGGGGACCAAAACTCATCGATGTTTCAGCATCAGGTCTATACCATGTAGAAA
> CCTCATTTGCCTCTATGCAGGCTACTCGTTAATTTACGTCCTATCATATCAATAGGTGTA
> ATAGTTTCTCTTTATTATAAAATAAAATGTCGTAAACGTACTATTAACATTTTTTTTATT
> GCATGCTTGGCAATAAAGAGGTGTTTTCTGTGACATTTTGGTTCCCATGAGTTCGGCTCA
> TTCGACGTGAGCGCCTTAAAATTCGTTTTTTTACCGTCAAGTTTTGAATAATGCCAGTAT
> ATAGAGCAGCGTATGCCCGCTGACTAGACGTCAACCATATTTCTTATTATTAATTATAAT
> ACTACGATCCTTTAAGGAAGACGTCTAGCATATAGAATATGCTGGTGTTTAACCCTCACG
> CACCTAAATTAATGATTAACGAGAGCTTGCAACGCAAGCTCAAGCATATCACGTAGGTTA
> TCCCACGGCCTTACCTAATATTTACGAGGCCTGACTTGTGTAGAATACTAACAATTCAAT
> GTTCGTCCATTGAACAGATAATTTACTGCTGTTATGCCGGAATATCTAATTAGGACGGTA
> TTCATCTAAGCATAAGGCTACATTGGTTTAGTAGAAACTCGTGTAGCGGAGTCGGCTTAA
> GGTACGTCGCCAAACAGATCAACTACTTCGTTATTGATTAATCCTGAAGAGGTCTCAATA
> ATACGCGGCCGTCGTCAATCTCTAGGTCAGACTTCCGGAGAATCGGGTAAGCCAGGATTT
> AATTTGATGAACGGAAGTGCGCTTCAATTATAAGACCTTTGGTCATAAAGACGCATCGAT
> ACTTCTTTTATTTGGGGCTATACACTTAGTACAGTCGTACAGCTGACAATAGTAGAAATT
> AGGCAAGATTGAGCCGCCCAATCGAATCCGTGCCGCGCAAGCGACTTGACGCGTTCTTGT
> CTCGAAGTCCCTCCGGCGACTCAAACTGAAAAAGTTAGTCTGTGCTGATGAGCGCTACGC
> TTTCTGTTCTGTTTAGATTGCATCTAAAGCACCACGTAGTTTATGGCGTTAGGTATATGG
> CTCAAACCCACGGACTATTAGTCACCAAATAATTCGCGCTTTCCCTGGTATACTATGTTT
> CAAATTTTCGCCATAAGCTTCAAGGACAAGAGCCACAATGTGTGTAGAAAATTTGCAAGC
> AGTTTCGCACTTCATGACCGCTATAGTAAAAATCGTAAAAATGGTTTAAGCCTTTTGCTG
> CCCTGCAACCGCGACTCGAAAAAAGATGCCCATCGTACTCCGTATTTTGACATTCGGTCA
> CAACCTTTTTTCGGACCGATATGAAGCTGAAGTAAATACTCAGTGTAGGACTGCTCAGAC
> CACAGCCGATTATCGGTAAACGTGATCTAAAACTAGATAATCATAAATCTGACAACATGT
> ATCGTTTCCCCGCTTGACGCAAACGGGAAAGTTGGGTTCTGCCTATTCATAGTACAAGTT
> AGCGCATTATTCAAAGTTCAAGGAGCGAGATATGGAGTATGTCTGTAATTTTAATAGACT
> CATCTGTACACGAATCACGATATGAGCGGCTAATGCTTAAAAGGTCGTGTAGTTCGTATA
> AGTACGGAGCTTATACGGGAAAATGGGCGATATTACCTAACGTGTGCAGCAAATCAGAGT
> AGTTTCGATTCTCACGGCCCAAAATTAGAAGATACGATAGAGACGCTTTTGGAATACCAC
> GGTGCACCTCGAGCAATGAGCTTTATGCTTGCAACCTGCATATATCTTTAAAGGGATCTT
> TTCCGCTGACTAGTTACTTTGTCCCATGGCTACTAGTCAATTTATACTAACGCGAGCTAT
> GAGTTACATGCAGTTGAACTGGAGTTGTCCATTCTACGACCGGCAAATTGCCGCGTAGCA
> CGTGTTTACGAATAGGAACTAAAATGTTCGAAGAGGGTTTAATTTAGAGTACACTGAGAG
> ATATCGCGTAATAATGTGGTACAAAAATATGCATGTACCCGCAAAGTAAGTTTTTTCATA
> ACCTGTAGTCAATAGCAACAATTATCGTATTACGATTTCAATATGGTATTGATTAAAGAA
> ACACGTAGCGCCTGCATTGGACTTGAGAGCGGATGAAGTCAGACAATTGCATAGTCGGAT
> TCCTTTGATTATCTAAACGATAGATGTTACCCAGGCCTTAAAATGAACCGCAATGCGGGG
> GAGGTTGGCTCATTGAGCATAAATTCGTCCATATGTTGATCCCACTACGTTGCGTAGGGC
> TGTATTAGCCATTCCGCTTTCGCTAACGCGTGTGATGTGTGATCTTGTACGTGAGTCGTA
> ACGATCTAAATTTCGCGCACTGGGATTTTAATAACAGAGAAAAAACTACACATCATTTGA
> TATAGAAATCAAGATTTTTAAAAATATTACCATTTTTTTACAGTCAAACAGTTCAGACCT
> GCCTTACTTACCGTGTCAGGTGCTGGCGTTAATAAGTTTCTATTCAATTACTGTCGACTG
> AAATAATTCGTATCAGTGTAATAATCTGACGTGTGAGTGTTCTTTGATCACAAACCGTAA
> AACTTTCCGTCGCTAACGCACACACCCGGGGAAGGATTTGTAGATCGTTACAGGGGTATG
> AGCCCTATCTAACTATTCGTGCTATGGTTCCATTTTAAATCAGACTAACAATAGAACAGC
> CATTAAGAATGTTTAGGACCGAATAGCATGACACCCCATCTTGAATTTATGATATTCTCC
> ACAATGGATACAAAGGTCTCTTCTAAAAGTGGCCTTTCATTCGTACGACGCCTTTAGTTC
> CGGTCGAGACGAAGTTAACTGCATAAATAACTCATACATTCCAGGAGGTTCGCGGATTTC
> CTTGTCCTTATGTAAGTTTAAATTACTTAACGTTGTAAATGGAACGAATAATCATTGTAT
> ACAGACGCTATAGAGTGGACGTTCGCATAGGGTATTGCGTATGATCACGTTCTCTATCGG
> GTAAATTGATGGGGGTGTTCGATGACTGAAATTGGGCGTAATGTAAGAAATCATTTCAGG
> AATATTAATATGGGCGGTACAATTATGCATGCTAGCTCTCTCGCTGAGGTTGAGTATGCC
> TTCTAGGACCTAATGATTGTGCTATACAACCAGTATATAACCAATAATTCACAAATATTT
> TTGCATCCAAAATCTGTTGCAGTCAATATCATTTTCCTTACCATTCAACTATGCATAGTT
> AAATGGTTAAATCTTCATACAAGAATGGCTGGAATCCCGGGGTCGAGATATATATACCAA
> GTTAGAGGAACGCTTATCGATTCCATTGTCAAGAAATAATAATGTTTGTCTAAATTTACG
> TCGCTCTGTGATAGACGATAGATGACTTTTTATTGCACATCCCAGCCCCAACCACGATTG
> TGTATCACTAACTGTTTAATGTTTAATTCAGCGATCTTGTTTATGTGACAAGTATTATGA
> CCGATTACAACAGCCAAAGGACGTCTCTTGTTTGGGATATACCTAGAGTATATCTGTAGC
> TGGCAACCCGTTCCTTTTAACGAATACCGGCTATTTTGTTTGCTTCATCAATTAGTCAAC
> ACGCGGGCCTGACTGGCTATAGTTTACATCCTCAGTATTTTCATGCAAGCGTCACTACGG
> TGGTCGTTATATTGATAAGTTGACCAATGAAAATGACAGCTGTCTATTTCAGTTCTTCCC
> GATCAAGGAGTTGTCCTGCTCTTTGGTTTCTCGGTACCCCGTGCAACCAGCTTCGTTAAG
> TTTGTTTTCCGTTTTTCGACTAATCTAAAAATATGACGCTAAAGATCGTCAAGAAGCTAA
> AAGTGGCAGCCTTCTTTCCGGTGAACCTTTGTTTCAGTAAAAACGCAAGCCAGGTTACTG
> CCCACATGCGTAGGCTACGATTCGAGTAGGAACCCTTTCTAGCCGTCATTTACTCAGATT
> AATGTCTTGAAAAAAAATTCTGAATTTATTTACGAAGTATAAATTAAATAAAATGTTTAT
> GCTCCTTGATAAGGACTTATTTCAATGTTTTATTCCGATCATCATGATCTAGTCCAGATA
> TAATCGTTGCTTCATAAGGTATCTGATATTCTCACTCGGCACCTCCTAGACACCAAGTTC
> AGCGAATGACACAATGATCAATGGCGATTTCATAGTGCACTCTGGCCTTAAAGCTGGATT
> TAGAGCATTACCCCCTGGGTTTTCTAACATAATTATGATTGTGCTTGTTGTTGGTACTAT
> CGACTATAAATTAAAATACCTTTATAACTCGTGGTTGAAGTCAACTGGACCAAATGGGCA
> CTACAATTGTTAATTGTCTCCATAGTCGGATTCTAACTAATTGTGCATGTCACCATCAAT
> TGCGGACCTGCAATAATCAACTGTCTTAAAAGAGGCCGAAGTGACTGTCATATTATAGAG
> TCCTTTGGTGATTTTATTAATTAGATGCCAGGTTAATAGTTGGTGAAAGACTAACGAATA
> CGAATCGGCTATATTGAAAAACCATTTATTAAAAGGAGGGGGATTCGAATTTTGCTGTTA
> TGCTTAGTATTTGTTGGGCAAGAGTATTGTAGTACAAGGAACCGATAAGAAATCATCATT
> ATTACACGTAAAATTACGTTTCGCATAACACTGATTTGGAGAATACATTCTGAGTAGGCC
> ATATTTCTGAATAGACAAGCTCGCTATGTGCTACCATTATTCTACCCGTTTGTTCATTAT
> GAGATCCGGTTAAATTATGGAAACAAAAGGTAGTTATAAAAAAGAGATTTGACAACTGAA
> ATCAGATCACTGGGTTGGCTAATCAGATTCACCCAGGGGTTTGTGGTTAACACAACCATT
> AGGAGGTGTTCATTTACATCAAATTTTTACCACGTACTTAGGAAAATCCAGAAGCACCTT
> CAAACTCTCTACCCATTCTTCGTGGGGCATGAGATGCAAATTTAACTGAACTCAAGCTTG
> ACACCTCGGGTATTAGCTTCTGGGATCGATTTCGTGGCTTTTTAGGATAGAGATCACCGC
> TAATTCCACTCGCGCTCGTTCAGCTCTAAGCTTGTATCACATCGATTATTTGACATAAAT
> AGGCGCATAGCTGTTTCATCTATTGGAGCTATTGAATTATATCAGTACATAGTCTCAATC
> ACCCGCTCATCAAGTATCAGGTTTTTTATGGGTGATAGCGATATGCTAACAAGTCATCAA
> AAATTGTAAGTATTCCTATTTGCAGCCCTACAGGCGACCGTCCTAAGCTCATTCTTACAA
> GTGAAATCCAAGTACGCATGCCGCTAATACTAATCTAAGGTATTACTGTACAATGGCATC
> TAGACCATATGCATGTGACATATGGACCTCTAACACTAACAAACTAATTTCAGTCAAGAC
> TGAAATTGAATAATGTTTGCTATAAAACTGAAGCGACATCCACCGGTTACTAAGGGCTTG
> TCTACACCTTAGTTCCTCGCAGTAGAATCAATTTTTAAAAATATTTAAGTTTTCAGGAAT
> GAAATGCGAGCTATGAAACGTCCCAAATTCCTTAGAAGATGTACGTTTGTTCACACTCGT
> AGCATCAGATCACAAAGAAGTTTGGATAGGTGGAATGAGCCACGATCCATTATAATTATA
> AGATAGTTCCATGAGTATAGAGGCCTCGAACCTTATCCTTTGAGTAATCACATCGTATAA
> AATGTTCAGCGCACTCTCCCCCCGGGATATGGTTTTGCCAGGTTACCTACGCAAACTCTA
> AATACAAAGAGGGAGCTATATAAAATAATGAGATCTGTCATCAAAAGAATTAATCGCACA
> CCGCCAAAATCACTTCTCTCGGTGAATCGAGATTTACCTACCCTAAGGTAACTCTTTTGT
> TCTAAGCAAACATCACGTATACTTTGCTTCTGACAATTTGAGGAATAATGCCTTTTTACT
> CCGACAACAGAAGGGGCTCCCACTCACTCTTAGAAAGAGGATTGAACATGAATTTTCAGC
> CTCTATATATATACCTTCATAGTATTGACGGGAGATATACCGCGGCGTCTAGATACTCGT
> AAAGCCAGTGTACTTCGCAGAATCAATTCATACTCCATCTCTATGATGACGAATATAGGT
> CAGTTCTAATGTGTGGTCTAACTTGTACTCACCGGCAATATCCCCATCGTGTATTTCACT
> CTCATTCACATTTCCATCGTTACGAAGGTAGGGCTTTTGGTAAACAAAGTGGACCGATAT
> CGGATCTTTATGTATCAAGAATGAACGTCAGCAAATACATACGATGTAGGTTTAGGTACA
> CCGCATGGATCTCCTCGCAGTCATGATTGAAACTCATCGGACTTTATTAGCCAATATTGC
> CAGCGTCTTATTATCCATTCTTCGGATAATCACTCTGCCGTGTTAAAGTCAGCACACCAA
> GGAAAGCCACCACTTACAAAGGTAAAGCACCATACTAGCTCAATGGGAGCCCATTGGCTG
> AAATTCACCTTAAGCATGACTCTAGATAAACCGATTGCCTTCATTTAGGTCAGTTAAGGA
> AAAGACAAGAAACTGCACTCTCATTCACGAACCCCAAGACGGGCCTTCAGTCCAACAGTT
> GAACTATGGTCTGAATAGGTATGCACTAATACACATTAGTAACACGGCTTATAGACGTGA
> TGGAACGTTGGGGCATTTATCAATCGACACCAAATATTCAATGCGCACATGCTGTTAATA
> GTTGCATAGTCTTGACCAAACTAAACTGTATAGTTGCACATGACTCACAAGAACAATTAG
> GCACATCCATATTTTCGATTTCTTTCAGTCTCACGAGCAGGAGAGGCTTGAACCAGTTAA
> CGCGTCTTGCACATACCGATTTAGAGCGGTAGTACCAATAACGCTTTGCAATCGCTAGTG
> ATGGTTGTGGACTGTAGATATATGATTTGTAAATTATCTTGTGACTTGTGTTATTCTTAG
> CTCATTGTATATTAGTCTAGTGTCGTTAACATTACGAATAGGGCTCTCGACGCGACCTAA
> TAGTATAAGAAAGGCTCCACGCCTTAAGGCTGTTGTGGAAGAGAACATCAGTCTAGATCA
> GGTCATATAAACTCTTACTATCACTATTTCGATAGATAAGTCTAAAATGCACTCCAATCT
> AATTCTTGATTATAGCTTATATAAAGGCTCGGGTTAGCTTAAGCCTGACATGTAATATGG
> AATTACACTGTCTATAACTGGTCACCAGCAGTTGAGGTTTGAGATTTCGTGAACGTGACT
> TTAATAGCGTAGTGTGATCCTCTCTTAGGCTCGATCAGAATAATAGAGCTTTACTGTTCC
> GTGGAATACGATTGTGTTATGTACGAGCATTACGTAACAAATCAAGTATTGTAGTTATTA
> CTATGAATATTTTACCAGCATATGTAACGAAAAACGGGTGACCTGTTACTGACATGCAAG
> AGGGATTGCACACGAATCTAACATCTGCAGAATTCTAGACAAAACGCCTTGATCAGCCTA
> AAGATTTAAAAGCGCTCCAACTTGTATGACTAGAGAATGGTAAAAATGCTCGGGGAACCT
> CTTGGAAATAGCTGACTATCACTAACGAAGGGTGATGTTAATAATATAAGTTCAATAAAT
> AACAACAACCATATTCACCGGAAAATCATTAGATTCTTAGACAATTCGCAGAATCACATT
> CATGTGGGTTCTAATTCATAAGTAATCGGATTAGTGCTATTATTCCCATGGCTGACGAGT
> CGTCACTTGCTATGCCATAATGGAAAAGGATTGAGAAGCTTCGAATAGTTCTGACTCAAA
> ATCCGCACGGGGTTTTTCTGCAGTGACGCCATGCGAGATTGTACGGATGCTAACGAGGCA
> TGATCGCTTACAGATGATGGCCGTAAACGATAGTCACCATGTAATGGTATTAGTGTAGCT
> CTATATGAGGGATAGCATGGTGTCCCTACTACGCCTTATAACAGGTATGCACGGCCGTAT
> TCTGCGAAAGGTACTTATAACGTTTTGTCCTACAAAAGCTTCTCGGACTTCAGAGTTAGC
> TGTAGTACTGTGATACATAGTTTTATAAACGTGAGTCCATTCGTCTAGCGGTTCTATTTC
> ATCCTCAATGACCGAACTTCTCGTACTCTTATTCTTGTTCTCCGAGGGATATAACCAGAG
> TCATAAAGTGAAGCATACAACACTACACACTCCCTGTTCTCACTGATAAAAAGACAGCAT
> TATAACGGCTAACACATACACCGAAAATATCAGACTAACTGCTACTCTCTAATAATTAGA
> TAATACTCCCTTAATTCATTAATCATATTTAGCGTTTCTGATGAAAGGCGCCATATTAGT
> CATTAGTGTCCGTAGTGAATTGCACCGGAGCAGTCAACCGGAATATAAATATACATCGGT
> TATAGATCATGAGATTATTCATTGTTGATCTATATATATGAGAACGAACTAGAAAAACAT
> CATATCACAACGGGTCTTTTTTGATTGTCCATACCACGATACTACTATGATTTAATTGGA
> TATTTGCATATCTAATGAAAGTATCTGGTATAAAGTCGTACGCCGCTCTAACATTAGGCT
> GTAACAATTTTCGCTAACAAAATAGAAGACCCCTTGGAGAATAGTCCTACGTACATGCAA
> TGTCCTCTATCCTCATTGGCGCAAGCATCATTAAGTGAGGGATTTACATACTTAGGAAAG
> CTTGTGAAATAATTAGACTTCACGCTGGATAAGAAGGCCTGATGCTATTTGTTCGTTGTA
> CAGTTACGATGTGATGGCACCAAAAATTTCTCAGACTCGTGCAGCAAGACTTTTTACCGC
> AGACACCACCAGATGACGCGGTAGAGATATCCATACGCCGGATTCCAGTGAAGTATGAAA
> GAAATTCTTATCTACACTGACAAGAGTGATCCGACTTTAAGTTCCTTCCCACACTCACGC
> TTCGTGCACGTCCTTTGGAATAAAGTAACTTTACAACATAGATAAGGTGTGTTCTAAATT
> CAGCGACTTTATATACGTTATAGACAAGCTTCGGCCGAAAACGGAGACTTCATCGGACTA
> TTTTACTTGGATGATGACATTAGTTTCACTGAGAAAGTAGTTAGGACATCAGACCCAAAA
> CACAAACATCTAATCTAATGGATGTTAAACAAATTCGGACACGAAAGAAAGTCACGCTCG
> CCCAGACTCATCCCACCCCCACGTTGGCAACAAAAGGCCTCTATCTACGCGTTCTAACTC
> TAGCTATGGTAGACCAACGCAAGCCGATCATTTTCTGACTTTACAACCCTATCTGTTTAA
> TAGGATAGGTAATCAAAGTCGATAACTAGAAGGAATTGTTCGATCCAGGTGGGATGTCGG
> CACTACAGAAAAAGACGATATGAGTCATCTTATCCACATCACTTGTCGCGAGAGTTAAGT
> TAGTCAATTAGCTCACACTATTTATTACTTGTGGAGAATACCTTTATGTTCTACTTACTA
> ACATTATTGCAGCCTTTGCTGTGTAGCTTAATAGTATATTAATATTAATTACCGCACTCT
> CCCGCTTTACTAAACACAAGTGCTAGTCACTTTTCTTGCTACAAAGCATCTCATACGATC
> GGTTAAAGCAGGATAGCTATTCATATCTTGCCAAGTTTCAGTTTTTAATCTTTATGGTTG
> ACGAAAGCTGGATAATAGTTTCTTAACGACTGATTATATTCTATCTTAATGTTAGCACGA
> AATAACCTGAAGTCTATAAGTGAATGTTGCAAATTGGGAAACGATCTTCGTTGCTCATTA
> CGAATTTAAAATGTCGACCTATGAGATAGGACAGGACTCTATCATGTTAGGGTAGTAAGA
> ATCATTATCTGTACCCTTCGGTGTAGGCCTGTATTAGTAGATCAATTCAACCGTTAAGGT
> TGCCACTAAAATCAGTTGCTAACTTAAAGGATGTTGTAAACTTTTTTTTGACGATTTCAA
> AATATCGTTTACTGTGTACGCCTCTACCTTTACTAGTGGTCTTAAATTACCCCCCGACTT
> AAGAACCCTAAGAATAACGTCATCTCTTACATCTACAAGCGTGACTGTAACTATTCCTAT
> CGATACAATTGGTCGAAAATGTAGGAGAAATCCTCACAGCCCTTTGCTATCGACGATTAG
> GCTAGACCAGTATTGCTAATATCTTTAGCCCCTAAAATTCAACTTTTATGGACTATACGT
> ATTATCGTTACTAGTCTATCCGTAGTGACCGATTATTTCACAGGTGTCTGGAATTATTAT
> TACTCTGGTGTGACTTCTAGCGTTAGCAAGGAATCGGTAATAACCTGAATATCGATAAGA
> TATTTATGCAAATCGACCACTTTTGTCGTATAGATACGCACTGTGAAGTGAGACTGCCAA
> TTCTAGTTTTAAACTTCATGGGATATCGACTAGCGCCACGTTGGAATATGAAGCTGGTGA
> AAGACCGTTACTCTAATTTGCAGATTAATGATCCAAGTTATATGTAATAGTTAAGTCCTT
> ACAGGGAAAGTCTTTTCTTTTTGTCGGCGATCCATCCAAGCCTGGCTACTGTCCAATATG
> CGACATTAATGTATAACATGATAAGACGCTAGGAGCTAGAAGCAATAACATAGTGGCGGT
> CTATTAGCACCAGTTAAACCGCAGAGCTAGTTTACAGGGTCCTCTCGGAGATCTATACCG
> CATATAGATAATGGAAACCGATTAATAATAACGATTCTATTCTTTGCATTCAACGAGACC
> TAAAGCTATCCGTTCATGTTTGTCTCGTCCATTGAGTGTCGGAAAAAGTAGAATAAGCCC
> CTTTTAGGTTAGGATCTTTGAGAACTGGTTACCGACGTTCCTCTTGCGTACTAGAAACGT
> GCGGGTTTTAACAATGCCTATTTCTCTTTGATTTACACCATGTTCGCACCCCCTTGGGCA
> ATCCTATTGTTTCGAATCGTTCTTATATTAACAACTAGGGTTTTAGTAATTTCTTATTGC
> CTTGCCCCTACCGCTCACCCTTTAGGAAACGGATCTCTATACTGAGTTGCTGGTCTACAA
> GCGTATTAACGATTGTACATGGAAATTCCAATCGTATCTCAATAAGTCTCTCCCTGTAAC
> CCTTCCCTGCTTTGAAGAAATAGGAATGTAAGTCACAACTGCAAGTTTGAAGAAAGGCCG
> CTTAGTAGTAACCAAATCGGGTACGTAGAATAAACGTATCCCCTGCGCAAGAGAGCCAGT
> CTTAATTAGCGCACGAGTCGCACAGGATCTACAAAAGAGCCGGATCAATAACTATAAGAT
> GCCACGAGTTACCCAATATCATTGATTACCTAGGAAAAGTTAGTCTCGTTGAGTGTCTGA
> ATAGACGGAAGGAAGTCGTGTGTTGTAACATGCCTCGAGGACTTCAATTGGTATCCTTCG
> ATACGCTCCCAGGGTACCGGGTTATACAATTCAGACAACATGAGAATTAATATATCTTTA
> GTAAAAGTAAAAGGGTGGATTAGTAATTGTGGTGAATTTGGATAATGTTCCTCCTGCAGT
> TATACCATGTGATACGATTTACACGAAACATCTCTGAGGTGTACCTATACTAAGCTTCTT
> TCTCTTGCAAAATACATAGAAAAGAAACAACACATTGTGAAGTGCGTTATTACCGAGAAA
> GTCACTTGTATATCAATAGAGGTATTCCACACAGCGGACCAAAAATCATACATCTTGATG
> CAGCACCTCGTTACCATCTAGATAACTCTGTTGCCTCGTTCCAGGATACTAGTGAATTTT
> AGTCCTATCTTTTCATTACCGCTAAGTGTTTCTATTTATTTTAAAATTTAAGGTCGGATA
> CGGTCGATTAACTTTTTTTTGTTTGCTTCCTTGCCTATAATGAGGGGTGTGCTGTGAATG
> TGTGGTGCACATGAGGTAGGCGCATTCCACCGCACCGACTTAAATTTCGTTTTTGTTAAC
> GATAGTTTTGATTATTCCAACGTTATAGACAACCCGATCCACCCTGACTACAACTCTACC
> ATATGTCTTATTTTTAATTATAATAATAACATAATGGAAGCAAGAACGCTACCAGTTAGT
> ATAGCCTCCTGTTGTTCCCGCAACCAACTAAAGTAAGCATTAACGAGTGCTTGCATCCCA
> TGCTAAACCATATCACGTTCGTTTTCCCACGCCCGTAAATAAGATTTACCAGCCCTCAAT
> GGTCGACAATACTAACATTTCAATGTTAGTCCATTGATCACTTATTTTACTCCGCTTAGG
> CCCGTATATATATGGAGGTCGCTTTTCATAGATCCAGAACCCTACATTCCTTTAGTAGTA
> ACTCGTCGACAGGAGTACGCTTAAGGTACCGCCACAAAAAGATCATCTTCTTACTTATTC
> ATTTATCATGTAGAGGGCGAAATATTACCCCCCCCGCCTCATGATCTTGCGCACACTTAA
> CGACTATCCGCTAACAAACGTGTTATTTGGATGTAAGCAAGTGCCAGTCAATGATATGAC
> AGGTCCGCATAAAGAACCATCGAGACGTCTTTTAGTTGGCGATAGACACTTAGTTAACTC
> GTACAGATGACAATAGTTCATTTGACGCTACATTGACCCGAAATAGCCTATAAGGCACGA
> CAAAGCGACTTGTAGAGTTCGTCGATCCTACTCCCTCAGGACAATAAAACGGAATTACTT
> AGGATCTGCTGATGTGACCTACGCGGGCTCGTCTGGGGTGAGGGCTTCTTAAGCACATCG
> TACTTGTTCGCCGTACCTAGAGCCAGAATACACACGGTAGTTTAGTCAACATATAATTAC
> CGATGTACCTGGTTTACGATGTGTCAATTTGGCGACAGATGCGGAATCGACAAGACCAAC
> AATCTGTCTTGAAATTGTGAATGATGTTTAGCACTTAAGGACCCATATTGGATAAAGCCT
> TAATTTGGTTTTAGAAGTGTCAGCACATGCATACGCCACGACATAAAACATGCCCAGAGT
> ACGACCTAGTTTCACTTTAGGTCACAAAATTTGTTAGGAACCTGTTCAACCTGATCTTAA
> TACGCAGTGTACGAATGCTCAGACATAACCAGATTTTCGGTAATCGGGATCTTAAACGAC
> TTTAGCATAATTCTGTCAACATCGAGCGGTTACCCCATGGACCCAAACGGGTAAGTGCCG
> TTAGGCAGAGTAATAGTACATGTTACCGATTTATTCAAACGTAATGCACCGAGTTTGGCA
> CGAGCGCTCGAATGTTTATTGTCTCTTCGGTAAACCAAGCTAGTTATGACAGGCTTATCA
> TTAATACGTAGGGGAGGTCCTATATCTACCCAGCTGTTACCCGAATTTCCGCGAGATGTC
> CTATCCGGTCATGAAAATAACAGGTGTGTCGATTAGCACGGCCAAAAATTTGATGAGTCC
> TTTGACAAGCTTTTCGAAGAAAAACGTCCACCTCCAGATATGAGCGGTTTCAGTGAATAA
> TCCTTATTGATTGATAGCGATCGTGTCCGCTGAAGAGGTTCTGGGTACCTTGGAGTCTTC
> TAAAGTTATACTTACGAGAGATTTGACTTTCATGCAGTTCAACTGCAGTTGTCAATTCTT
> CCACCGGATAATTGCCGCCTACAACGTCGTTACCAATAGGAACTATTATGTTCCAAGTGC
> CGTTAATTTACAGTTCTCGCAGAGATATCCAGTTATATTGTCGGACAAATATAGGCAGCT
> AACAGCAAAGTAAGTTTGTTAATTAACGCTTGTAATGTGCAAAAATTATACTATGAAGTT
> GTCAATTTGGTTTTGTTTAAAGAAAAACCGAGACACTCCATTGCAATTCTCAGCGGATGT
> ACGCAGTAATTTCCAGTGGAGGAGGCATTTGATGATCTATTACATTCAGGTTACCATCGC
> CTTAAAATCAACCGCAATCCCGCCCTCCGTGGATATGGCAGCATTTATTCGTCCATTGGG
> TGTGCCAACTACGTTCCCTACCCCTCGATTACCCTTTCCCCTGTCCCTTTACCCTCTGAG
> GTGTGATAGGGGACGTCAGGCGGTTCCTGCGATATTGACAGAACTCCCAGTGTATTAAAA
> CAGAAATAACTTCAAATCTGTTCATATACATATCAAGTGGTTTAAATTGATTACCATGTT
> TTTAAAGTCAAAAAGTGCACTCCTCACTTAATGAACGTGTCTGGTCCTCCCGTTAAGAAG
> TGTCGTTTCAATTTATGGAGACTGAATTAAGTCGTATAACTGTAATTTGCTCAACTCTCA
> CTGTGCTTTGATCAAAAACCGTAATTCTTTAAGTCGCTTACCCTCACACACCGCGATGGA
> TTTGGAGTGCGTTACACCGCGATCTGCAATATATAACTATTCCTGCTATGGGGCAATTGG
> AAAGATCTCGTTCAATACTACACAAAGTAAGTTTGTTTTGCAAACTATTGAATGTCAAAA
> CATCTTCATGTTATGATAGTCTCCACAAGCCAGAAAAAGGGCTCTTAGTAAACTGCACTT
> TATTGAGTACGTAGCCTTTTGTTCCCGTCGACTCGATCTTTTATCATGTAAGAAATAATA
> AATTCAAGGTCCTTAGCGCATGGAATGCGCCTTATGTTAGTTGAAAGGACTTAAAGTGGT
> ATATCCTTAGATTAATAATGGTAGAAAGACGATATAGACTCCACGGTCCCAGTCGCTAGG
> CACTAGCATAACGGGCGCTATACGGTTATGTGTTCCCGGTGTTCGTGCAATCAAATTCCG
> CGTTATGTAAGAAAGAATTGAACCAATATTAATAGGGGCCGGTCTATTATGATTCATTCC
> TCGAGCCCTCACCTTGAGTATGCCTTCTAGGACAGAAGCATTCTGATATAAAAACAGGAG
> ATATAAAATAATTAACAATGAGGTTTGAATCAAAATTATGTTCCTGTCAATAGCAGTGTC
> ATTTCCTGGCAAATATCCATAGTTTAAGCCGTAAATCTTATTAAAAGAAGGGCTGGAATA
> CAGGCCTCCAGATATAGATACAAAGTTTGTCCAAACCTTAGCGTGTCCAGTCGAAAGAAT
> GAATTATGTTTGTCTAAATTTTCCTCCCTCTCGCAGACAAGATTGAGGTCTTTTGTTTGC
> ACATACATGCCCCATACACGATGGGCTATCAAGATATGGTTAAGCTTTAATTCTGCGATC
> TTGTTTATCTGAATAGTTGGATGAACGTGGACTACAGCAAAAGGAACGAGCGTGGTTCGC
> AGAGAACGACAGTATTTCGGGAGATCGCAAAAAGTGCAGTTTAACCTATAACCCATATTG
> TGGGGCCTGAAGAATGTAGTCTACACGCCCCACTCTCTGCCTATTCTGTAATTCCTAACG
> ATTTTCATGCAAGCCTCTCTAAGCTCCTACTTATATTGTTAACTTGAAAAATGAAAAGGA
> CTCCTGTATTTTTCTGTTCTTACAGATATTGGAGTTCGCCTCCTCTTGCGTTTCTAGGTA
> CCCAGTCCTACCAGATTACGTAACGTGCTTGTCCCTTTTTCGTATAAGCTTAATAGATGA
> CCCTAAAGATCGGCAACATCCGATAAGTCGCTCCATTATGTCAGGTCAAAATTTGTTTAA
> GTATAAACGCAAGACAGCTTTATCACCACATCACGACGCTACCAGTAGTCGAGCAACCAT
> TGCTACCCGTAATGGAAGCAGTGTTTTGTCTTGTATAAAAAGGCTGATTTTTGTTACGAT
> GGAGAAATGAAATTTAAGCGTTAGCCTCATTGATATGGAATTTTGTAAATGGGGTATTCA
> GATCATCAGGATAGTCTCCACAGTTAAGAGTTGATTAAGTAGCTATAGCTTATTCTATCT
> AGGAAAATCAGAGACACAATCTTCAGCGAATCTCACAATCATAATTGCCGTTTTCATACT
> GCTCTCTCCAATGAAACCTCCTTGGACTGCAGTACCCCCTGCGGTTGCTAACTTAATGAG
> GATTCTCCTTCTTGTTGCTAATAGCCAATATTATTGAAAAGTCATTTTTATATCCTCCTT
> CTTGTATTATGCACAAAATCGGCACTACAATGGGTTATTGTCTACAGAGTACGATTATAA
> CGATTTGTGCATCGCACCATCATTTGACCACCTCAAATAATCAACGGTCTTATAAGACCA
> CCAACTCACTCTAATTTTTGAGAGGAAGTTGCTGAGGGTATGAATGTCAGCAAACCTTAA
> GTGTTGGGGAATCACTAACCTAGACCAATCGCCTATATTGAAAAAAAATGTATGATAAGG
> ACCCGCAGTCCAATTTGCCGCTGAGCATTACGAGGTGTTCGCCAACACTATGCTAGTAAA
> AGGATCCGATAAGAATTCATCATGTTTTCTAGTTATATGACCTTTCGAATAAAACGCATT
> GCCTGAATTCAGTATGTGTAGGCAATATTTATCTTTTCACTTCCTACATTGGTCAGACCA
> TTATTCGACACGTGGCGTCATTTTGTCATACCGGGTAATGTTGGAAACAAAACGTACTGA
> TAAAATACTGAGTTGTAAACTCTAATCAGATAACGCGCTTGGATATTAAGATTCACACAG
> GGGTTTCGGCTGTAAAAAAACTTGTGGAGCTGTTCTGGGACAGATAAGTTGTACCTCGTA
> CTTAGCTAATTAATGAACCAACTGATTACGATAGAACAATTCTGAGGCCGCCAGGACAGC
> CAAATTTTAATCTTATAAAGCTGGAAACAGCCGGTATTAGCTTCTCGCATACTTTGCCTG
> CATTGGTACCTTACAGATATCAGCGTAGTCATATACACCTCGGTCTCAGCTAAGCTTGTA
> TCTCTTAGAGTAGTTCAAAGATAGTGGACAATACCTGTGGAATCGATTGCAGATATGGAT
> TTATTTAACTACTGAGTCTCATTCACAAGCTAAGCAAGGAGCACGTTTTGGTGCCGGCAT
> ACCGATTTGCTATCATGTCAGCAAATTTGCGTTGTATTCCTAGTTGCACCCATTAAGGCC
> ACACTCCGAACCTAATTATTACATCGCAAAGACATGTACGAAGGACCCGATGTCGAATAG
> AAGGGAGGACTGTTCATTGGAAGCTAGACCAGAGGAATCGCAAAGATGCAACTCTTACAA
> TAAAAATCTAATTTCAGTCAACACGCAATTTCTATAAGGTTTCCGATAATAATGAACCGT
> CTTCCACAGGGGAATTTGCCATGCTCGTAAAAGTAGTTAATCCAAGTAGAAGAAATTTTG
> ATAATGTTTTAAGTTGGCACGAAGGAATTCAGAGAGATCTTACCTAACAAAGGCATTAGT
> AGATGTTCCTTGGTTCACACTCGGTCAATCAGAGCACATACTACGGGCGATACCGGGAAT
> GACACAACATCAATGAGATTGTTAAGTGAGGTAATTGACTTTAGAGGACTCGATCAGTAT
> ACTGTCACTATGAACATCGTATTAATTGTTATCCGATATATACACCACCGATTTGCTTGT
> GCAAGGTTACAGACCCATTCGATAAATACAAACACGGAGCGATATTATTTAAGGAGTGCT
> GTCTTCAAAAGAATTATTCCCACACCGACATAAGAACTTCGCTCCGTCATTCCAGATTTA
> AATAACATAACGTAACGCTTTGCTGATAACATAACATAACCGAGAATTTGCTTAGGAAAT
> TTGGAGCAATATTGCATTGTTTCTCAGTCATCACAAGGCCCGCCAAAGAACTCTGAGAAT
> CAGGATTCAACATGATTGGTAAGACTCTATATATATAACTTAATTCTTGTGTCCGGAGAT
> AGAAAGAGGACGAGAGATACTACGAAAGAAAGTGTACTTCGATGTATCAATTCAGACGCC
> TTCTCTATCATCAACATTATAGGTCTCGTATATGCTCGGCGCGATCTGCTTCTCTCCGCC
> AATAGCCCCATAGTGTATTTCAAGCGCAGTAACAGTGAAATCGTTACGAAGGTAGGGATG
> TTGCTTATAATTGTCGTAACTTATCGCTTATGTATCTTTCAAGAATGAACGGCAGCATAT
> ACATACGTTCTACCTTTAGCTACAAAGCATCCATATACTCCCTCTCATGATTGAAACTCT
> TCCCTATTTTGTAGCCAATAGTGAAAGCGTATTAGTATAAATTCGTCGGTTTTTCACTCG
> CAACTGTTATACTCTGCAAACAAACGAAAGCCTCATAGTACAAACCTAAAGCTACATACT
> TCATCATTGGCAGACCAGTGGCGGTATTTCTACGGAAGCATCACTATAGATATAAAGTTT
> CCCTTCATGTACGTCTGTTAACCATATCACAAGAAACTGCTATCTCTGTCACGTAACAAT
> TCACGCGCCTTATCGCCAAATGTTCATATATGCGCGGTATACGTATGAACGAATACTAAT
> TAGTATAACGGAGGATTCACGGGAGGGATACTTGGGGCATTTATAAATCGTCTAAAAATT
> TTCTATCAGCACTTGCGGGTTATAGTGGATTACTAGGCAACATAATATTCTGTATTGGTC
> CAAATGACGCTATAGATAAATTAGCAAAATACATTGTTTCCATTTATGTAAGTCGAAACT
> CCAGGACTCCCGGGAACCAGTTAAACCGTCTGGAAAAGACACATTGTGAGCGGGACTTCA
> ATGATAGCTTTCAATGAGCTTCTCATGCTTGGGGTCTGTACATATATGTTGGCGAAATTA
> TCGTCTGTATTCTGTTATGCTTTGATCATGGGTTATTAGTATAGTGTCCGGTTAAGTACC
> AATACCGCTAGAGACCCGACCTAAGTCGATAACTAACGATCATCGACGTAAGGATCGTCT
> CGATCAGTACTTCAGTCTAGATCTGGGAATAGTAACTCGTTAGTGAACTATGTCGTGTCA
> TAACTCTAAAATGCAATCAAATCTTATTATTGAGTATTGATTATATAAAGCATCCGCTTA
> GCTTTACCCTCAAATGTTATATGCAATTTAAAGCGCTTGATATCGTCTACTCAAGTTCAG
> GTTTCACATGGCCGCAACGTGACGTTATTAGAGGTGGGTCATCATCTCTGAGGCTAGTGA
> TGTTGAATACTCATTGAATGGGAAGTGGAATACCATGCTCGTAGGTAACAGCATGACCTA
> TAAAATATACTATGGGTGTGTGGTAGATCAATATTGTTCAAGCATATCGTAACAATAACG
> GCTGAAATGTTACTGACATGAAAGAGGGAGTCCAAACCATTCTAACAGCTGATCAAGTCG
> TCTAAAAACGCCTGGTTCAGCCTTAAGAGTTATAAGCCAGACAAATTGTATCAATAGAGA
> ATCCGTAAATTCCTCGGCCAACCTCTTGCAAAGACATCACTATCAATATACTACCGTGAT
> CTTAATTAGTGAACTTATATAAATATCTACAACCAGATTCAACGGAAAAGCTTTAGTGGA
> TTAGAAATTGCCAAGAATCACATTCATGTGGGTTCGAATGCTTTAGTAATACCATTTCGC
> CGAGTAGTCACTTCGCTGAACTGTCGTAAATTGCTATGACATAATCGAAAAGGATTGTCA
> AGAGTCGATTACTGCGGACTAATAATCCCCACGGGGGTGGTCTCATGTCTCCCCAGGCGA
> GTGGGGACGGTTGATAAACACGCTGCATCGCGGACTGATGTTCCCAGTATTACATAGTCA
> CATTGGATTGCGAGTAGTCTACCTATTTATGAGCGAGAGATGCCTCTAACTACTTCGACT
> TTTAAAACCTTTCCACGCCAGTATTCGGCGAAAGGGAAGTATTAAGGGTTGTCATAATTA
> AGCTGATACCACTTCAGACTTTGCTCTACTTCTGTCTTTCATTGGTTTAGTAAAGTCTGT
> CCATTCGTCGAGACCGTCTTTTGCAGCCTCATTCTACCAACTGCTCCGACTCTTAGTCTG
> CTTCTCCCAGCGTTATAACAAGAGGCATTTTGTCATCCTTAAAACAATAATAAAGAACTC
> GGAGCACTGATATAATGACTGAATTAGAACCGCTTAAAAATACAACGAATAGATAAGACT
> ATCGGATAAGATCTAATATGTAGTGATTAAGCCCTTTATTAATTAATAATAGTTACCCTT
> TCTGATGTAACGCGACATATTACGATTTAGTGGCACGTCTGAATTGCAAAGCAGATCTCT
> ACCCGATTTTTATTATAAATCCCGTATACATCTTGACTTGAGTAATTGTTCATCTTTTTA
> TATCTCTTCGTACTACAAATAATTAATATCTCAACCCGTATTGTGTGATTCTAATTACCA
> ACAGAATACGAGGAGGTTTTTGCTTAGGGCCATATATAATGAATCTATCTCGTTTATTCG
> CGGAACCCGAGATAACATTACGATGTAACTATTTTAGAGAACTTAATACAAGAAACATTG
> CTGATTACTCATAACTAAATGCTTGGTAATATATCCTCAGTGCCCCTACCATCTTTTACG
> CAGGGATGTAATTACTTAGGATTCATTGTGTAAGAATTACAATGAACGATGGATATGAAG
> GCATGTTGCGAGGTGTTCCTTGGTATGTGAAGTTCGCAGGGCAACAAAAATTTCGCAGAA
> TAGGCCTCAAAGTATTGGTAAAGAAGACAACTAATCATCACGAGCTTCTGATATCAATAC
> GAACGAGTCCTGTGATGGATGAAAGAAAGTCGTATCGAAAATGTCAAGAGTCTGCCCAAT
> GTAACTTACTTCAAAAAATAACGCTTCCGCCAAGTACGTTCGAATAAACGTAATTTTAAA
> AATACATAAGGGGTGTTAGAAAGTAAGCGACGGGATATAAGTTAGACTCAAGATTCCGCC
> GTAAAACGAGACTGATTCCGAAGATTGTTCGTGGATCTGGTCATGACTTTCACTGAGTAA
> GGAGTTTCGACATATGTCAATAAACACAAAAATAGAAGCTATTCGATCTGAAAAATATTA
> GGACAAGAAACTATCTCACGCTAGCCCAGAATATTCACTCACCCACGGGCGATACTAAAG
> CACTATATAGTCGCGTGATTACTATACATATGGTACACATAAGAATCACGATCAGGTTCT
> CAATTTTCAACAATATATGTTTATTTGCATAGGTAATATTAGGCCTTTAAGAGAAGGATG
> GGTGAGATACTCCGGGGATGGCGGCAATAAAGAAAAACACGATATGAGTAATAGGATCCT
> AATATCTTGGCGAGAGACTTAAGGTACGAATTTTGCGCAATCTATTTTTTACTTGGCCAG
> AATTCATGTATGGTATAAGTACGAACTTTTTTGATCACTTTCATGGCTACCTGATTAGGA
> TAGTTTGAGGAATTTCCCAAATATACCGATTTAATATACACTAGGGCTTGTCACTTTGAG
> TCAGAAAAAGAATATAATTACTTAGGGTAATGCTGCATACATATTCTTATATTGCAAAGG
> TTCTCTGGGTAATCTTGAGCCTTCACGATACCTGGTGAAGTGTTTAGTAACGAATCATTA
> GATTAGATCTGATTCTGTGCAAGAAATATCCTCAACTATTTAACTCAATGTGGCTAATTG
> CCATTCGATATTCGTTGCTAAGGACGAATGTTTTATCTCGAAATTTGTCAGACGACACGT
> CTATATAATGGTTGCGGAGGAAGAATCAGGTGATGGTCCCTTACCTCTACCACTCTATTA
> CTAGAGCAATTAAAACGTTAAGCTTGCCAATATAATAAGGTCATAACTTTATGGTTGTTG
> TTAACTTGTTTGGCTAGATTTAAATATATAGTTTAAGGTCGAACCCGCGACCGTTACTAC
> TGCTCTTAAATTTCCCAACCTATTATCATCCCTTAGAATTACGGCATCTCTTTCTGCTAA
> AAGCCTCAAGGGATATTGTCCTTGAGATACAAGTGGTCGAAAATGTAGCAGAATTAATAT
> AACAAATTTCCTTTCGAACTTTACCATTCAACACTATGGCGAAGTGCTGGACCCAATAAA
> ATTCAAATTGGATGGTCTATTCGTTGTTTAGTTTCTACGCTATCCCGTGTCAAACATGTT
> TTCACAGCGCTATCGTTTTATTTTTAATCTCGGCGCAATGATACCCGGAGAAAGGAAGCC
> CGTAGATCATGAATATCGAGTAGTTTTTGATCCAAATCCAAAACTTGGGTACGAGACATA
> AGCTCGGTGATCGCTCACGGACTAGTCTACTGTTAAACTTAATGGGATAGACACTAGCCC
> AAAGTTCCAATAGCTACATGCGCAAAGTAAGGTTAGCGATTTTGCTGTGTAATCAGACAA
> GTGATATGTAATACTTATGTCAGGAAACCCAATGTAGGGGCTGGTTCGCCGCCTTCCATA
> CTACACTGGCTACTGTAAAATATGAGACATTAAGCTATTAAATCAGATGACGCTAGGAGC
> GACATGCATGAAAAGAGTGCCGGGATATTAGCACCTGGTAAACAGAACACATAGTTGTAA
> GGGTAAGCTCCGAGTTCGTGACAGCATATTGATTAGCGAAACAGATTTAGAATAAACAGG
> ATATGCTTTCCATTCAACCTGTCATTATGCTATCAGTTCATGTTTGGATAGGAAAGTGAC
> TCTCGGAATAACTAGAATATGAACCTTTTACGTTAGGAGATGTCTCAACGGGTTAAACAC
> CTTCCTCGTCAGTAATAGATTCCTCCGGGTTTTAAAATGGAATTTTTCTCTTTCATTTTA
> ACCAGGTGAGCACACCCTGCCGCAATACGAGGGTGGCCAATACTGCTTATAGTAAAATAT
> ACGGTTGTACGTATGTCTTTTTCCCGGCAAAAGTCCGCTAACAAGGTAGCAAACCCATCT
> AGATACTCACGTGCTGGTCTACAACAGTAGTAACGAGTCTACATCCAAATTCAAATCGTA
> TCTAATTATCTCGCGCCATGGATACAGTAACTGCGTTGTAGAAATACGAATCTAACTATC
> ATCGCCAAGTGGCAAGAAAGCCAGATTACTTGTAACCTAATAGGGGTAGTTGTAGAAAAC
> TATACACTGAGAAAGACACCCACTATTATTTTGCCAACCACTCCCAATGGTTCTTAAAAA
> GTCAAGCATATTTTACTATAAGAGGAATCCTCTTACCCATTAGAATGGATTACATAGCAA
> AACGTAGTATCGGTGACGCTATGTATAGACGCATGGAAGTACGCGGTGGTTTCATCCAGC
> CTGGACTTCAATGCGTTTCCTTCGATAAGAGCACAGCCTACACGGGTATACATTGCAGAC
> AACATCACAAGTTATATATCGTTAGTAAATCGATAAGGCGCCATTACTAATTCTGGGGAA
> TTTGGTTAATCTTACGCCGCCTCGTATACAATGTCAGTCGATTTTCTACAAACATATAGC
> TCGTCTTCAGATACTAAGATGCTGGCTCGTCAAAAAGAAATACATATCTAACAAAAATGT
> CTCTACGGCGTGTTTTCAGACAATCTAACGTCTATATCTATTCAGGTATTACACACTGCC
> GTCATATAATAATACTTCTTGATCAAGCACCTAGTTAAAAGCGTCTTAAAGCTGGGCAAT
> AGTTCAACCAGTATACGGTTGTGTACTAATATATTTTATTTACCGCGAAGTCTGTATATG
> TTTGTTAATAGTTATGCTACGATAAGGTAGATGAAATTTGGTGTGTGTGATTCAGTCCAT
> ATATTCAGGGGTGGGATGTGAATGTGGCCTGCAATGGACGTAGCAGAATTCCTACGCACA
> CACTTAAATGTACTTTTTGGTAACGATACTGTGCATTTTGCAAACGTTTGTCACAACACG
> TTCAACCATCTCGTCAACTCTAAATTAGGTAGTTTGTGTAAGTTTAAGAAGAACTTAATG
> GAAGCATGAACGAGACATGTTACTAGTGCATCCTGTTGTTCAAGAAACCTAAGAAAGTAA
> GCAGTAAACTGTCCGTGCATCCAATCATAAACATTAGAAACTTCCGTTTAAATACCAAGT
> AAATAAGTTTTTCCTCCAATCTATGCTCGACAATAAGAAAATTTAAATGTTAGTAAATTC
> TTATCTTATTTGTATCCGCTGTGCAACGTATATAGATGGACCTACCTTTGCATAGATCAA
> GATCCATACATGCCTTTACGTCTAAATCGGCGACACCACTACCATGAACGTACCGACAAA
> TAAACATAATATTCTTACGGATGCATTTATAAGCTACACCGAGATAGATTAACACCACCG
> ACGAATGATATTCCGCTCACTGAACCACTAGACCCTTACAATCCTGTGATGTGCAGCTAA
> CCATGTGCCAGGAAAGGTTATGAAAGGTCCGAAGAAACAACATGAGAGAAGTATGTGTGT
> TGCCCAGAGTATCTTTGTTAACGCCGTCAGATCAAAAGACGTCATTTGACCATACTGTGT
> CCACAAATAGACTATAACGCAACACAAACACTAGGCTACACGTAGTCGAGACTTCTAACG
> AAGCACAAGATTTAGCTATTTCTGAGGATCGGCTCTGCTCACAGTACAGGGATCGTAGCG
> GGTCTGGCATTAGTATCAAAATACTACGTGTTCCACGTACCTTGAGCCAGAATAAACAAG
> CTAGTGGACTCAACATTTTTTTACACATGGAACTCGTTTACGAGCTGTAAATTTGGCGAA
> TGATCAGGAATCGACATCTCAAAATTTCTGGCTTCAATTGGGGATTGATCTTTACCTATG
> AAGGAACCATTTTCGTTAATGACTTAATTTCCGTTTTGAAGTGGCAGCAAATCAATAACC
> CTAGACATATTACAGCAACAGAGTAAGAACTAGTTTCACTGTAGGGCAATAAAGGTGGGA
> CGTAACTGTTCAACAGCATCTTTATTAGCTGTCTACCTATCAGAACAAATAACAACTGTT
> TACCGATTACGGTGATTATAAGACTGTTGATTAATGATCTAATATGCGAGACGGTAACAC
> AGGCTACAATAACCCTAAGTGCCCTGAGCAAGAGTATTAGGAATTCGTACACATGGATGA
> TATCGGAATCCTCACACTTTGCCACGTGCGAGCGATGGGGTAGTGTAGCTTAGCTAAAAC
> ATGATAGTGATGACAGCATTATCATTTTTACCTACGCGACGGACTATTTCGTACCAGAGG
> TTAACCGAATTGCCCAGAGATGTCAGATACGGTCATCAAAATATCACGTCTGGACTTGAG
> AAACCAAAATTAGGTCATCAGTCCTTTCACTAGCTGTTCGTAGAAATACCGCATACGACA
> CATTGCTGAGGTTGCAGGCAATAAGCATGTGTGAGTGTTTCCCATAGGGTACCATCAAGA
> CGTTCTGGCGAAATGGGAGTAGTCTAAAGGTATTATTAACAGAGAGTGCACGTTATGCCA
> CTTCTACTCCACTGGGAAATTATTACTAACCATTTGTGAAGACTTCATAGTCGGGAACTA
> GACGTTAGATTAGGTGACTACTGCCGTGAATTGACAGTTCTCGCACACATAGACACTTAT
> TTTCTCGGTCTATTAGAGCATGCTAACAGATATGTTACGTTGTGAATTTAAGCTTCTATT
> GTCATAATATTATACTTGGTACTGGGCTATTTCCTTGTCTGGAAACAAAAAACGTCACAA
> GCAATTCCAATTCTCAGACCTTCTTCGAACTAATGTCAAGTGGAGGAGGAATGGCTGGAG
> CTTTTACATTCAGCTGAAAATCGAATTATATTCTTAACAATTCCCCCCCTCCGTCCATAT
> GGCTGAATTTATTACTACTTTGGGTCTGCAATATAACGTCCCGTCCCATCGATTACAATG
> GAACAGGGCCAGTTACCCTCGCTGCGGTGATAGGGGACGTCTCGACGTTCCTGAGATAGT
> GACACAAATCCCAGGGTATGAAAACTGTTATTTAGTCTAAGATGTGCATATACATATCTA
> CTGGGGGATTTTGTTGAAAATGGTTTGAAACGAATTAACTGAACTAATCAAGTAATGAAA
> GTCGATGCTCATCCAGGGATGATCTGTAGTGTCATGTTATCGACAAGCATTTTAGGAGTA
> TAACGCGTTGTTGATCTACTCTCTCTCGGAGGTCTGAAAATTACCTAATTAGGGAAGGAC
> ATTACCATATAAAAACCCCTTGCATTGCGTGTGACTTTAACCCCGATCTCAAATATATAA
> ATTTTACTCCTAGCCGGAATTGGGATAGATCTCGTTAAAGACTTATCAAAGGAACTTTGG
> TTTGCTAACTTGTGAATCTCTAAAAAGAGGCTTGTGATGATTGGCTAATAAAGCCTGTAA
> TAGCGATCTTAGTTAACTCCAATTGATGGAGTAACTACCAGGGTGGTAACCGAGTCTCCA
> TCGTTTATCATGTATGAAAGAAGTATTTCATGGTCCGTACCCCAGGGAATGCGAAGTATC
> TTTGGGGTAAGGACTGATACTGCGATTTCCTTAGATTTATAATGCTTGTAACTCCATAGT
> GACTCCAACGGACAAGTCCCTTGGCACTAGCATATACGGCGATTTACCGTTTTGGCTTCC
> CCGTCTTAGTGCAAGCAAATTCCGAGGTAGCTTACATTGAATTGAACCAATATGTTTAGC
> GCACCGTATATTAGCATGCATTCATAGAGACAGCACCGTCACTATGAATGCTTGCAAAGA
> TGCTTGCTCAGATAAATAATCGTGATATAAAAGAATTAAAAATGAGGTGTGAATAAAATT
> TAGGGTCATCTCATGAGATGGGGCAGTTCCTGGAAAATATCAATACGTTTAGCCGTAATT
> ATTATTAAATCAAGGGCGCCAATACACGCCTACACATATTGATAAAAAGGTTCTCCTAAC
> AGGAGACTGTAATGGCGATACTTTGTTTTATGTTTGTCTAAATTTTACTACATATCGCTG
> ACTACATTCTGGTATTTGGTTGCCTAATAAATCAAAAATAAACCATGCGCGTGAAAGTTA
> TCGTTAAGCTTTTATTATCAGATATGCGTGTTCTGTATTCGTGGATCAAACTGGACTTAT
> GAATAACGAACGAGAGTCGTGCCCTGAGAACGACTCTATTGAGGGACAGCCAATAAACGG
> AAGTTGAAACTTGAAACCATTGTGGCGGGCCTGAAGAATGGTCTATACAAGACCCACGCT
> ATGCAGAGTCGGGAATTACGATCGATTTGAATGAAACCCTATAGAACCGCCTACTTAGTG
> GCTTAACTGCAAAAAGCTATAGGAATCATCTATTTGTCTCTGATGACACATATTCCACTT
> CGCAGCCTAGTGCCTGGAGACCTAAAAACTCATTAAAGATGACGTTTCGTGCTGGGACCT
> GGTTCGTAGTAGAGTTTTAGATCACCATAAACTTACGCATCATCAGTTAACGCCATCAAG
> GATGGAACCGCTAAAGTGCTTGAACGTTATACGAAACAATCCTGTAGCAAATAAGCACGA
> CCCGACCAGTACTCGTCCAAAAATTGATTCCACGAATGGTAGATCTGTTTTCGATTCTTT
> TAAATGGAGCTTTTTTGTTAAGATCGTGAAAGGATAGTTAAGCGTTAGCATCATTCTTTT
> GCTATGTTGTATTTGGGGTAGTCAGATCTGAAGGTTAGTCGAAACAGTTAAGACGTCATT
> ATGTAGCTATAGCTGATGAGATAGACCAAAATAAGACAATAAATCTGAACACAATCTAAA
> AATCATATTTCCACTGTTAAGACTCATAGATCCAATGTTACCTCCTGGGACTCAAGTAAA
> AACGCCCGTTGAGAACTTTTTGAGCTTGCGCATGCGTGGGCCGAATAGACAAGAGTATGG
> TTAAGTAATTTTGTTAGACTCCTTCTTGGATTAGGCTAATTAGCGCCAAGAAAAGGCGTT
> AGGCTATAAAGAGTACGAGTAGAACGATTGGGCAATCGATAAATATTTGCACCAAATCAT
> TGTAGATACGCGATTTTATCACCACCTTCTCAATCTAATTTGTGACACGAAGTTCCTCAG
> GGGAGGAAGGTCTGCAAACCTTTAGTGTTCGGCTATCTATAAACTAGTACTTTACCATAG
> ATTCATATTAAATGTTTGATAACCACCCCCAGTACAATTTGCAGCTGAGCATTTCGAGGT
> GGTCCCATACTCTATGCGTCGAAAACCATAACTGTACATTTAAGATGGTGGTCTAGTTAT
> AGGTACGGTCGAATATAACGCAGGGCCTGTATTAAGGAGCTCGTCGCAAGAGTGAGCTTG
> TCACTTCCTACATTGCGCAGAACATTATTAGTAACGGGGCGTAAGGTTCTCTTACCGGGT
> TATGTGGGATTAATTTCCTACGGATTAATTTCTCAGTGCTAAAAGCTTAGAACATAAAGC
> CCTTCCAGATTAACATTAAAACTCGCCTTGCGGCTGTTAAATTAATGGTCCAGCTCGTAT
> GGGAAAGATAAGTTGTACCTACTTCTTAGCTTTTTAATGTACAAAATGATTAAGATAGAA
> AAAGTAGGAGGCCCCAAGCACAGCAATAGTGTAATCTTATAATCAGGGAAAAAGCCCCGA
> TGACATGATCGCTTACTGTGACTCCATTGGGTCCTTTCTCAGATAAGAGTAGTAATAGAC
> ACATACGGATCAGATAACAGTCTATATATGACTGTAGTTCAAAGTTAGTCGACATGACAT
> GTGGAAGAGTGTCCAGATATGCATGTATTTATCTTCTGACTATAATTATAAACCTAAGAA
> TCGAGATCGTTTTGGTGCCCGCATACACTTTTCAGATATTCGAAGCTAATTTGCGTTCGA
> GGACTAGGTGAACAAAGTAACCCCAAACTAAGAACATAAGTATTTCATCGCATAGAAATC
> GTACATGCAACCGTTGTAGAAGAGTACGGAGGTAGGTTAATGCGATGCTTGAAATGTGCA
> ATCGCAAAGATCCTAATATTAAAAGAAATATATATTTTAACTATACTAGCTTTGTCTAGT
> AGCTTTCAGAGATTTATGTTCACTCTGAATCACCGGTATTTCCCAGGCTAGTAAAAGGAC
> GTAATACAACGACATGATATGTTGATAATGTGTGATGTGGGCACCTTGGAATGCACACAG
> AGCTTTACTAAATTTGGCATTTGTACAGCGTACTTGCTGATAACGCGGTCAATATCAGAA
> ATTACTACGGGCCATACCGCGTAGCACAATACATAAATGTGTTGGTGAAGTGTCGTAATG
> GTCTTGACAGCAATACTTAAGTTTAATGTCACTTTGAAATTACTTTTAATTGGTATCACA
> TAGATAAAAAACCCATTGCCTGGTCCAACCGTAAAGACCAATTAGAGAAATAATTACACC
> CTGAGATATTATTTTTGCACTGCGCTATTAAATTGTTTGTTGCCAAAAACCAATTTTGAA
> CTTAGCGCCCTCTTTACACAGTGAAATTACAGAACCTAAAGCTTTGCTGATAACATTTAA
> GAAACGAGTATTTGATTAGCTAATTTGCAGCTATATGCAATTGTTTATAACTATTAACAT
> CGCCAGAAAAAGATAGCTGACAATCACGTGTCAACTTCTTGGGTAACACGAGAGAGATAT
> TACGTAATTCTTGGGTCCGCTCTTAGAAACACCACGAGACTGAAGACGTATGAATCTGTA
> ATTCCATGTATATATTATGACGAATTAGATAGCAGCAACTTTATACCTATCGTAGATGCT
> CGCCGCGATATGCTTAGATAACCAATTAGCAACAGACGGGATTGATAGAGAAGGATATGG
> GAATGCCTGAAGATCCTACCGATGTGGCTTATAATTGGCGTAACTTTTAGCTTATGTTGC
> TTGAAAGTTTCTAAGGATCATTTTTAATTAGTTCTACCTGGAGCGTAAAAGATGCCTGAT
> AATACATCTATTCAGGCAATATATTCCCTATGTTGGACACAATAGTGAAACAGTATTAGT
> TGAATGTAGTACCTGTTTAAATAGCAACTGTTATTCTATCATATAAAACGTATCCATCAT
> AGTAAAAACCGTAACCTAATTAAGTCATATTGCCCAGAAATGTGCCGCTATTGCTAAGGA
> TCAATCAATATACAGATTAAGTTTCAATGCAGGGACGTATGGTAACCATATCAAAACTAA
> CTCATATCTATGGAAACTAAAAATTCAACCCAAGGATCGCCTAATCTGCATAGTTCCGAG
> CTATACCGTTCATCGTTGTATAAGGACGATATCCGAGGATTCAAGGCAGCCATACGTCCG
> GAAGTTATATATACTCTAAATTTTTTATTGCACAAATGCAGCGGTTTAGGGCATTACTAG
> GCTACTTTAGTTTATCGAGTCGTCCAAAGCACGATATAGATATTTGACCATATGAAAGTG
> GGGCCTTTTATGTATCGCGAAACTCAACCACTCCAGGCAAAAACTTTTACCCGCTGCATA
> TGTAACATGGTGAGCCCGACGTAAATGTTACAGTTCAATGAGCTTCTCATCCTTCGCGTC
> GGGACTTATTGCTTGGCGAATTTAGAGTCTCTATGCTCGGAGGATTTCATAATGCGTGAG
> TTCTAGACTCGACGGTTAAGGACCTTTACCCCTAGACTACACACATTAGTCGAGTACTTA
> CCAGAATACAAGGAACGATCGGCTCCATCTCTAATTCACTCTTCATATCCGATTTGTAAA
> GAGTTAGTGATATTGGGAGTGTCATAACTATATATTGAAAGCAAATATTATTATGCTGTA
> TTCAGGATAGAATCCAGCCGCTTACCTGTTCCATCAATTGTTTGTTCCTTGGTAAAGCGA
> GTGTTAGCCGATAATCAACTTCACCGTTCTCAGGGCCGCTAACGGTAGTTTTTACACGTG
> GGTCAGAAGATAGGTCCATACTGATCTTGTTTACTCAGGGTAGGGGAACTGCAATTCCAG
> GCTCGTAGCGAACTCCAGGACCTTTATATTATACTATGCGTGTGTGGTAGAGCTATTTTG
> TTAAACAAGTTCGTAACATTATACCCGCTAATGTTAATCTCTTCAATGTGGCAGTCATAT
> CCATTCTATAAGCTGATCTAGTCGTCTATTAAAGCATGCTTCACACGTTACAGGGTTATG
> CCAGAATTAGGGTATCTATAGTCAAGCCGTTTATTCCGCCGCCATAAGATTCCTAAGACA
> TCACTTTAAATATACTACCCGCAGCGTAAGTAGTGAACTTATATAAAGATATTCTAAAAG
> TTTATAACCAATTGATTTAGTGGAGTACTAATTGCCAAGAAGATATGTCTGCGCGCGGCG
> TTTGATTTACTATGACCTTTTCGCAGTGTAGGAAATTCCATCTACTCGACTATATTCCGT
> TCACAGAATCCAATTCCTTGCTCAACAGTCCTTTTCTGAGGAAGAATATTCACAACGCCC
> GTGGTCGCATGGCTACACTGCACACTGGCGTACGTGGATATACACCATGCATAGAGGAAT
> CATGTTCCAACTATTACTGTGGATAATTCGATGCCGAGTTCTCTTCATATTTAGGAGCCT
> GACATGCCGCGAACTTAGTCGAATTTTATATCCGTTCCAACCCACTAGTAGGCCAATCCG
> TAGTAGTTAGGGTTCTCATAATTAACAGGAGACCTATTAACTCTTTCATCTTCTTATCTC
> TTTCATTCGTGTAGTTTACTCTGTAATGTACGCGTGACCGTAGTTTGATGACTCATTCTA
> ACATAGGATACGAATCTGAGTCGGCTGATCACACCGTGTTTTAAACTGGATGTTTGGCAT
> CATTTAAACAATAATATAGAAATCGGAGAACGCAGTTTTTCTCTCAATTTGAAACCAGTA
> AAAATACAAACTTTTGAGATCTCTATAGGATAAGAGATAAGTTGTACTGTTTAAGCAATG
> TATGAAGTAAGATTTGGTTCACGTTCGCAGGTAACCAGAAATATTACGATGGTGGCGAAC
> GTCTCTAGTCAAAACCACATCGCTTAACCATGTGTTTGTGAAAGACCGGAGACTTATTCA
> CTTGAGGATGTCTGCATCTTTTGATATCTCTTCCTAAGACATTTAATTATTATCTAATAC
> CCTAGGGTGTGATTCTAATTTAAAACTGAAGTAGTGGTGGGTTTTGCTTTGGGCCTTTTA
> GAAGCTTTCTTGATCCTTGATTCGACGAACAACAGATTAAAGTTCCAGGGTTATAGTTGA
> CAGAACTTATGACATCAAAAATGCCTGATTTCGAAGAACGAATGCATTGCTAAGATTGAA
> TATGTCCCCATACAATCTGTTACGCTCGCTGGGAATGTATTACCTTTCAGGCTCTTAGAA
> GTACAATGATACATCCAGATCTAGCAAGCTGCAGTGGTCTTCCTGCGTATGTGAAGTGCG
> CAGCCATAAAATTATTTCGATGAATACGCCTCATAGTATTGGTAAACATCAAAAATAATC
> TTCTCGACCTTCTCTGTGAATTACCAACCTGTACTCTCATGGTTCATACTAAGTAGGATC
> GAATAGCTAAACTCTCTGCACAAGGGTACGTAATTAAAAAAATAACCCTGACGCATACTA
> AGTGCCTTTAAACGTTAGTTTAAAAAGTCATTTCCGCTCTGAGTAAGTAAGAGTCGGGAT
> ATTACTTAGACTAAACATTACCAACTAAAACGAGAAGGATTACCAAGAGTGTTAGTCCAT
> CTGCTCATGACGGGAAAGCACTTAGGTCTGTCGTAATATCTCAATATAATATATATTAGA
> TGATTTTCCAGCTGATAATTATTACGACAACATTCTTTCTCAACATACAAAAGTATATTC
> AATAAAACTCCGGCCATAATTTTCCAATAGATAGTACACTGAGTTATAGACATTTCGGAC
> AAATAACAATCAACATAAGGTGAGCAATTTTATAAAAGTGAGCTTTTTGTCCATAGGTTA
> GATTAGGACTTTTAGTGTTCCATGGCTGACATAATCCGGGGATGGCCCAAATAAACAATA
> ACTACTGAGCAGTATTAGGTTCCTAAGATCGGCGAGACAGTCTTAACGGTCGATTGTTCA
> GATATCTATGTTTTTCTGCGCCAGAAGTAATGGTTGGTATAAGTTAGATATTTTTGGATC
> ACTTGCATCGCGACCTGTTGACGAGAGGTTGTGGTATTTAACAAATAGAACCAGTTAATA
> TAAAATTCGCAGTGTAACTTTGAGTCAGAAAATCATTATATTTACTTAGCGTAATGATCC
> ATACAGAGTATTAGATTCCAATCGTGCTCTGGGTTATCGGGTGCCGTCAACTTACCTGCT
> GATGTCTTTAGGAAAGAAGCTGTTGAGGAGTTAGGATGCTGTGATAGATAGTTAAGCAAC
> GATTGAACGCTATCTGCATTTTGCCCATTACAGAGGAGTTCCTATGGAACATGGTTTTAG
> CTACAAATTTCTCAGACCAAACCTATATAGAATCGTTCCGGTCGATCTATCAGGTGATCG
> TAAAGTACCTCTTCCAAGCTTTGTCTTGTGAAAGTATTAACGTTTCCTGGACAATATTAT
> ATCGGCATTAAGGTATCCTTCTGGTTAAAGTGGTTGGCTACAGTGAAATATTTAGTTGAA
> GCTCGTACAAGAGAACGTGTCTTCGCCGATTAAATTTACAAAACTAGTATCATAACTTAG
> AATTTACGAATATATGTATGAGTAATCACGCTAGGGTTAGTGTAAGTGACAGTAAAGTGG
> TACAATATGTAGCTCTATTAATATATCAAATGTCATTTCCAACTGGTCCAGTCAACTCTT
> GGCAGTAGTGATGGACAAAATTAATTGCTAAGGGGTTGCTAGTGTACTTGTTGAGGGTCG
> ACGCTTTAACGTCGCAAACTTGTGGTATCACCGCTATCCTTTTATGTGGTATAGCGGCGC
> AAGGATTCACGGAGAAACCAAGCCCGTAGTTAATCAATTGACTGTTCTTTTGGAGCCTTT
> GCCTAATATTGGGGACGTGTCAGAACATAGCTCTTCGCTCTAGGAATAGTAGACGGTTAA
> ACGGATTGCGATTGACTATTGACCAAACTGCCAAGAGCTACAGCCGCTTACTAACGTTAG
> CGATTTGCATCTGGATTCAGAATACTGTGTTCTAAGACTTTTCTCAGGAAACCCATTCTA
> GGGGAGGGTTCGCCCACTTAAATAATACACGGCATAATCTAAATTATCAGTCATTAAGCG
> TTTTAATCTGATCAAGAGTCCTCAGTCTTCATTGAAATGACTCCCCCGAGTTGTCAACAT
> CGTATAAACAACTCATTCGGGTAACCCGAAGAGACCTCTTAGTGTCAGCTGTGTCATTAG
> CCTATAACATTTAGTATAAACAGGATATGATTTCATTGAATACTCTAAGTTTGCTAGAAG
> GTAATGGTGCGATAGGAAAGGCACTCTACCTATAACGACTAGATCAAAATGGGTCCTGTC
> GAGAGGTCTCAAAGGCGTAAACTCCTGACGAGTCACTAAGAGATTCCGCACCGGGTTATA
> ATGCAAGTGGGCGCTTTCAGTTTAAAATGCTGACAAAACACGGCCCAAATACGAGGCTGG
> ACTATACGGCGTTTAGGTAAATATTCCCGTGTACGTATGTATGTTTCAAGGCAAAAGTAA
> CAGATAAAGGTACCAAAACCTTATAGATTATCACGGGCTCCGCTTAAACACTTGTATACA
> GTCTTAATCCATAGTAATAGACTTTATAATGTTCTCGAGCAATCGATAAAGGAAAGCAGT
> TGTACAAATACCATTCGTACGATATTCGCAATCGGGCATCAAACCAACATTACGTCGTAA
> ATTATACCCGTAGTTCTTGATAACTTGAAAATGACAAACACACAAACGAGGATTTTCCCA
> AACTCGACAAATCGTTATTAAAAACTCAACCTTATTTTAAGTTATCAGCAATCCTCGGAC
> AATTGAGAAGGCAGGAAATAGCAATACGGTCTATACGTCACGCGAGCTTGAGAACCTTCG
> TACTACGCGCGGCGTTATTCAAGACTCCAAGTATTTGCCGTGCATGACTTAACAGAAATC
> CCGAAACCCGTATTCATTGATCACTTAATCACTTGGTATAGTGCGTTACGATATCGATAA
> GCCGCCATGACGTTTTCGGCGCTATGTCCTTAATCGGAAGAAGCATCGGATTAATTCTCT
> GTACATGTTATACAAAAAGATAGCTCCGCGTAAGTTTAGATCATGAGGGATAGTCAAAAA
> GTATTTCATTTCTTTAAAATATGTCGCTACGCCGTGTTTTAACACTTTCTATCGTCTTTT
> TATATTCTCGGATTAAAAAATCACCTAATATTAGAAGAATGAGGCATCAAGAAAATAGTG
> AAAAGAGTCTTTAAGATGGGCAAGACTTAAACCAGTATACGCTTGTGTACTAAGAGATTT
> TATTTTCACAGTTCTCTGGAGAGGGTTGTTTATAGTTATCCGACCATTACCTAGATGTTA
> TGGGGGGGCTGTCATGAAGGCCATAGTTTCTCCCCGCGGAGCGCTATGGGGCCGGAAATG
> CACCGACCACAATTAATACCCTAACAATTTAATGTACGTGTTCGTAACGATTCTGTGCTT
> TTTGAAAACCTTTGTCAAATAAACTTCAAACATCTAGTATAATATTAATGTGGGAGTTGG
> TGGTAGGTTTTGTAGTAATGAAGCGTTCATTCTAACAGTAATGTGACTTGTCAAGCAGCG
> GCTTAAAGATACATAAGATTCGTTGATGTTTACTCTCAGTCATTAAAATCAGAATCATTT
> GATACGTCCGGTGAAATACCAACGTAAGTTGTTGTTAATCCAAGATAGGCTACAAAAGTA
> GATATTGTATTGCGGACGAAATTCTTATCTTATTGGTAGCACATGTCCAACCTTGTTAGA
> TCCACCTACAGTGGAATAGTTAATGTTACATTAAGGCCGTTTCGTCTTTATACGACTAAC
> CTCGAACAGGAACCTTACGAAAAATTAACTGATTATTAGGAAGGAGGCTTTTTGAAGCTT
> CACCGAGATTGTTGTACAAAAACGAAGATTCATAGTCAGATCTATGAACCAATTGACCAG
> TACAATACTGTGTTGTCCTGCTTACAATCGCACACGATTGGTGTTCTAAGGTCACATGTA
> ACTACATGACTCTACGATGGGTCGTCCACAGTCTATATTTCGTATAGACGTAACAGCTAA
> TGACGTAATTGGTCCATTCTGGCTAAACAAATTCACTTGAACCAAACACATTCACTAGGC
> TACACGGACGCCAGAATTATAAAGAACCAAAAGATTTACCTTTTTCTGACGATAGCATCT
> GCTCAAAGTACACGCAGAGGAGCCCCTCTGCCATTAGTTTCATAATACGACGGCTTCCAC
> GTTCAGTGTCCAACATTTAAATACCTAGTGGACTAAAATTTTTTGGAAACAGCGAAAGCC
> GTTTAGTGCGGGATTTGGCCACAATCATCACGATTACTAATCTAAAAATTTCTCGATTCT
> ATTGCGCATTCATCGGTACATATGAACCTAAAAGTGTCCTTTTTGACTTATTTTCCGTGT
> TCAACTCGCAGAAAATCAATAACAATACAATTATTTAAGCAAAACACTTAGAAAGAGGTG
> CTATGGACCGAAATTAAGGTCGGACCTAAATCTTATTAAGCTTATTTTGTACATCGCTTC
> CTAGCAGAACAAATATCAACTGGTGACCGTTTACGCTGATTTTAAGAATGTTGATGTTTG
> AGCTAATATGCCACACCGTAAAAAAGCCTAAATTAACCCTATCTCCCCGGAGCAACAGGA
> TTTCGAATTCGGACACATGGTGGATTTACGAATCATAACACTGTCCAAACTCCCAGCGAT
> GGGGTTGTCTAGATGACCGAATACATCATACTGTTCTCACCAGTTTAATGTTTTACGACC
> CCTCGGAAGTGTTCGTAAATCAGCTTTAACCAATTGACCACTGTTCTAAGTTAACCTAAT
> CATTAGATCACCTCGGGACTGGACAAACCAAATTTAGGTCATCTCTACTGTCTCTACAGG
> TGACTTCTAATAACGAATAAGAAACATTGCTCACCGTGAAGGCAATAAGCATGTGTGAGG
> CTTTCACATAGGCTAACATCTAGTCGTTAGCCCGAAATGCCAGTAGTCGATTGGTTTTAT
> TTACACTCAGTGCTAGGTATGCAACGGATTATCCACTGCGAATGTATTACTAACCATTTG
> TCAACAATTAATACGACGGAAATTGTCCTTAGTTTAGCGGAATTCTCCAGTGTTTGGTAA
> CTTATACATCTCAGAGAAACGTTGTTGCTACCTATTTTAGTGCATCCGTAAACATATCTT
> ACGTTCGGAATTTAACCGTCGATTGTCATTATTGTTTACGTGCTACTGCGATTGTGCCGT
> GTCTGGTATCTTAATAAGTCACAAGAATTGCATATGATATCACCTGCTTACATCTATTGG
> AATCTCCACCTCCAATGGCTGCAGATTTTAAAGTCAGCTGAAAATACAATTATTTGATTA
> ACATTTAAACACCTCAGTCCATATGGATCATGTTTTGACGAATGTGCCGCTCAAATATAA
> CGTAAAGTACAATACTGGAAAATGGAAAAGCGAAAGTTAAAATCGCTCCGCTCTTACCCC
> AACGCTCCACGTTACTCACTTTGGGACACATAGAACAGGGGTTGTAATCTCTTTTTTAGT
> ATAAGATCTGCAGAGTAATTGATTCTCCGGGTTTTTCTGGTAATGGGGTTGTATCGATTT
> ATCGCAAATAAGCAAGGAATGTAACGCGATCCGCAGAAACGGTTGATCTCGACTGGAATG
> GTAGCCACAAGCATTTTTCGACTAGATCGCGTTGTTCATCTACGAGATCGCGCAGGTCTG
> ATAATTAACTTTTTAGGGAACGACAGTAAAATATATAAACCCCTTCCATGGCGTCTCACT
> GTATAACACTGCTCAAAGATAGTTAGTGGACTCAGTGCCGCAATTGCGTTAGATATACTT
> ATAGACTTATAAAAGGTTCTTTCGGGTCATAAATTGTCAAGCTATAAAATGAGGATTCGG
> TGCTGTCGATAATATACACTCTAATACCCAGAGTACTTTTCGCCAAGGGATGCACGTACT
> ACAAGGGTCGTAAACGACTATACATAGTTTAGAATGTTTCTTAGATGTATGTAATCCTCC
> GGACACATGGCAATCCCAAGGTGCGTTCGGCTTTCCTAGGTTACGCCGTTTTAATTACAT
> GTTGATGCCGTGTAACTACATAGTCTATAAAACCGAAATGTACCGTCCCAATAGAAGATA
> CCCAGATTGACCCGTTTCGCTGCCCCCGCGTACTCATAGCTTATTAACACGTTGCGTACA
> TTCATGTGATAAAAGTGGTTTAGCCCACCGTATTGGAGCATGAATTAAGAGAGAAAGATA
> AGTCACGTGCAATGAGTCCTAAGTTCATGGATCAGAGAATTAATCCTGTTTTAAATGTTG
> GATATTTCAGCGGGCATTAAAATTTAGCGTAATCGATTGAGATCGCGAAGGTAATCGAAT
> AGAGCAAGTCGTTTTCAACTTTTGAGTATGTATTCATGCCAGCCTTTAAACCAAGACACT
> TTGTGTGTAAATCGGTCTAATAAAAGGTGACTGGAATCGACATTCTTTCTTGTTTCGGGC
> TAGATTGGGTAAGAAAGATACATGACTACAGTCTCCTAGGGGGTGGCATATGAAATCAAA
> AATAATACTGCCCAGTGATAGTTATCCTGATGAGGGTTGGATCACTTAGGCGGGTGAGCT
> ATTCGTCCTGCAAACTCCAATTATCAATTTCCTACGACACGCGGGACCTGTCTAACAATC
> TTGTGACCCACAGCCATTAAACGCAACTGGATAATTGTAACAAGTGTCGCCCCCAGGATG
> ATTCGTCGATTAAACACAAAAGATATCAAGTGTCGCGAATTAAGATACAGGGGAATCAAA
> CAAGATAGTACCGAATACGTTGTGGCTTTTCGGCAAATAGCTATACCAATCATCGAGTGG
> GATCGGATGAAACTGATTCCTCTGACAAGAAGAGGGACGGGAGACCGTAAAACGCATTAA
> TCATGACCGTTCCTCCGGGGAACTGGGTACTAGTTGAGTTTTTGATCTAAAGATACTGAC
> GATTCATAACTTATCGCCATAAAGGATCGAACCGATAAAGGGCGGGATCGTTATTACATA
> CAATCATGTAGCAAATATGAACCAACAGTACTCGACTCCTCATAAAAGGCAGTAAACGAT
> TCGTACATCTCGTTTCGAGGCTTTTAAATCGAGCTTTTGTCGGTACATCCTCATTGCTTT
> GTTTAGCGGTTGCATAAGGCTGTTCCTAGGTGCGATTTCCCCGAGGAACTGATGATCCTG
> ACTAGAATCTGTGTTGACGTCATGATCTTCATTTACATGATGAGATAGACCATAATAACA
> CAATAATTAGGAACACATGCTAAATTGAATATTGCAACTGGTAAGAATCATAGATCAAAT
> CTTTCATAATGCCAATCATGGAAAAAAGCACGTGCAGTTATGTTGGTGCTGGCGAATGCG
> GCGGCAGTATTCAATAGTGTTTGCTTTTCTAAGGGTGTTAGAAGACTGCTTCGATTAGCA
> TAATTTGACCATAGTAATGGCCTTAGGCTAGAATCACGAACAGGAGATACTTTGCGCATT
> CGATAATGATTGGCAAATAATCATTGTAGATTAGCGATTTTATCTCAAACTTATAAAGAG
> ATGTTGTCACACGAACGTCCTCTGCCGTGCTAGGTCTCAAATCAGTTACTCGTCCCCTTT
> ATAGAAACTTCTAATTGACAAGTGTGGCATATTAATGCGTTGTTTTCCAACCCAACGACT
> ATTGGCAGATGAGAAGGTACTCCTCGGACAATTATAGAGCAGTCGTATTCCTTAACTGTT
> CTTTGATGATGCTGGTATACTTTTAGGTACGGGACATGATATACAAGGGCATCTTTTAAG
> GAGCTCGTCCAAAGAGTGAGATTGTATATTAATAAATTCCGAACTAAAGGTTGACTAAAC
> GCCACGATGGTGCTCTGAAACGCTTATCTGCCTTTATTTTCCGTCGGAGTAATTTCTCTC
> GGCTATTAGATTTGAACATATACACAGGCCAGATGATCTGGAAAAATCCCCTGGCGCAGC
> TTATATTAATGGTCCACAGCGTATCGCAATCATTAGGTCTAAATACGTAGTACATTTTTA
> ATCTTAATAAGCATTAACAGACAAAATGGAGGACCCACAATCCAAACAAATTGGGTTAGA
> TTAGATTCAGCCTAAAAGACCCGATGTCAGGAGCCATGAATGTCACGCAAGGGCGTCATG
> TATCTGATAACACTTCGAATAGAAAAAGACGGATCAGATTACAGGCGTGATATGACTCTA
> CGGAAATGTTAGTCCAAATGAAAGCTCCATGACTGGCCTCATATGCTTGTATTTATATTA
> TGACGAGAATTATAAACAGAACATTCGTCATCCTTGGGCTCAACCAAGTAACTGTTCAGA
> TATTCGAACATAATTTCACTTCGTGGAAGTCGTCATAAAAGTATCCAAAAAAGAACATCA
> TAAGGATGTAATACCTTTGAATTCGTACATCCAACACTTGTAGTTGAGTTCCGAGCTAGC
> GTATTGCCATGATTCAAATCTGCATTCCCTAACTGCATAAGATTTATAGATATATATTTG
> GGAACTATTATACATTTGTCTAGTTCCGTTAACTGATTTAGCTTAACTATGAATAACCCG
> TAGTTCCCAGGAGACTAAAAGGACGGAAGAAATCGACTTGATTTGTGCATTATGTGGGTT
> CGGCCATACTTCCATTGAACTCAGTGCTTTACGAAATTTCCAATTTCTACTGCGTAAGGC
> CGGATAAAGACCTCATTATCTGATATTTCTAACCGACTTAAACCCTAGCTAAATAAATAA
> TGGTCTTGGTGATCTCTCCTAATGCTAGTGTCACCAAGACTTAACTTGAATGGAACGTTG
> AAATTACTTTTTATGCGGATCACATAGATAAAAAAAACTGTGCAGGCGCAAACCGTAAAG
> AAAATTTAGAGTATGTATTACTCCCTCACAGTGTATTGTTCCACTCAGCTATTATATTCT
> TTGTTGACATATAACAATTTTCAAATGAGAGACCTATTGAATCTGGGAAATTAAAGTAAC
> GTTAGATGGCAGGAGTAAATTTATGAAAACACTAGGGCATTACCTAATGGGCACCTAGAT
> GCAAGGCGGTATAACTATTATAATCCACAGAAAAAGATAGAGCACTTTAACCTGGCTTAT
> GCTTGCGGATCAAGAGAGAGTTAGTAAGTAAGTAGTCGCTACCCTCTGTGTAACACCAAC
> ACACTGTAGACGTATCAATCGCGAAGGACATCTTTATATGATCTAGAATGAGATTGAAGA
> TAATTTTGACCTATAGTAGTTCATCGCACAGTTATCCGTAGATAACCAATTTGAAAATGA
> CGCGTGGGATAGACATCGATATCGCAATGACGGAACTTCCTTCCCATCGGCAGTTTATTT
> CGACTAAATGTGACATGAGCGTGAGTGATTCTTGCTTACGATCATTTTTAAGTACTGAGA
> ACGGGTCAGTATAACATGAATGATAAGAAATAGATGCAGGCTTTAGATTACCTAGGTTGG
> TCAATTTACGCAATCACTAGGTCGTGAATGGACGACCTGTTTATAGAGCAAATCTTATTC
> GATCATATAAATACTTTCAATAATAGGTAATTAAGTTTCATAATTAAGTAAGATTGCCAT
> CAAATGTCCAGCTTTGGATAAGCTTCATGATATAGACTGTTTAACTGTAAAGGAAGCGTA
> CGATCGGAACATTTTCTATACTATAGCATATAGATCGAAACTTAAAATTATACACAAGGA
> TCCAATAATCTGCTTAGTTCACAGCTAGTCCGTTCATAGTTGTATATGGTCGTTATACCA
> GCTGTATACGCTGCCATAAGGCCCCATGGGAGATTGACTATAATTTGTTGATTGAACAAA
> TGCACCGGTTGACGGCATTTATACCATAATTTAGTTTAGCGAGTCCGAATAAGCTAGATA
> TACTTATTGGACAATATGAATGTCGGGAATTTGATGGATCGACAAACTCATCCTATCAAG
> CCTAAAACGGTTAAACGAGGCATATCTAAATGGGTCTCACCCTCGTAAATCTTACAGTGC
> ATTGACAGTCGATTCATGCCCCTAGCGTATGAGTGCTTGCAGATTGGAGACTCGCTAGGA
> GCGGTGGAGGTCATATGCCCTGTGGTCTAGTCGCGACCCTTATCGTAATTGTCCCAGACA
> CTAAACAAATTTGTAGTGTACTTAACAGAATACAAGGATCCAGAGGAGACTTATCTTATG
> ATCTAGTCTGATCCGATGTGTATAGAGGTACTGATATTGCGACTGTCTTTAAGAGTTATG
> CATAGAAATGAGTTGTAGGCTGTAGTCAGGAGTGAATCCAGAACAGTTCAGGTTAAATCT
> ATGCGTTGTGCATTGGTAAAGACAGTGTTAGACGATAATCATCTGCTCCGGGATCTGCCA
> AGATTACGCTAGGGTTGTCACGTCCCGATGAAGAGAGCTCCATACTCATCTTCTTGTATC
> AGGCTAGCCCAACGCCATGTAATGCAGCGTTCCGAACTCATGGTACTTTATTTTATTCTT
> TCCCTCGGTCCTACAGATATTTGCTTAATCATGTGAGTTAAATTATACCAGCTAATCGTA
> AGCTATTCAATCTCCCTGGAATATAAATGATTTAACATCATATTCTACTATATTTTACAA
> GGCTGATCAAGTTACTCGGTTTTCACACAATTAGGCGTGATAGACTCTAGACCTTTTTGA
> AGACCACATAAGAGTCCTTTGACATAAAGTGAAATTTAATACCCGCTGAGTATGTAGTGA
> AAGTATATTAAGTTATTATTAATCTGGATAACCATTTCATGGTCTGGAGTACTATTGCAA
> AACTTGATATGGATGCGCCCGGACTTTGATGTACGTTGAACTGGTACCAGTGGACGAAAT
> GACAGCTAATCGACGATATGCAGTGCAATGATGACTTTTCCTGGCTAAACAGGACTTTTA
> TCACCTAGATTTTTAAAATACCCCCGCCGAGCATCGCTACAATCCACTCTCGCCTACCTG
> CATATAATCCATCCAGACAGGTATCAGCTGAAAACTTTTACTGTCGATAATGCGTTGCAC
> TGGTCGAGTAATAGTTTGCTCCCTCACATCCCGAGAAAGTAGTACAAGTTTTTATACGTT
> CATACCAACTAGTACCACTATCCCTAGGAGTTACCGTGCTAATAATTTTCAGGAGAAATA
> GGATCTCGTTCAGCGTCGTATCTATTTATGTCGGGTTCTTTACGATCGAATGGACGACTC
> ACACGAGTGGCATCAAGAATTATAAATTAGCAGAACAAGAGGTGGAGGATGAGAAAACAC
> TGTTTTAATCTCCATGTTTCGCTTAATTTATTATAGTATATACAAATAGCACATAGCTGT
> TTTTCTATCAATGTGAAAACAGTTATATTTATAACTTTTCAGATCTATTTACCAGTACAG
> AGATGTTGGTCTGTTGTACAAAGGTAGGATGGTTGATGTCGTTCAAGGTAGCAGCTTTCC
> ACAATTAGTTACATGGTCGCGAAACTAGCTTGGCATAACAACATCGATTAAACATGTGTT
> TGTGTAAGACAGGTGACTGATGCTATGGACGATGGCGGATTAGTGTGTGAGATATTACTT
> AGAATTTTTATGATGTTATATTAAACGAGGCGGGCTGGCGAATTTAATAATCTAGTAGTC
> CTGCGTTTGCATGTCGGAATGTTAGTTGCTTTAGTGAGACTTGATTCCACGTACAACAGA
> GTTAAGTTACAGCGTTATTGTTGACACTTATTTTGTCTTCTAAAAGGCATCTTGTAGAAG
> AAAGTATGCATTGCGAAGATTGAAGATGGCCAAATTAATGATGGTAACATCCCTGGGTAT
> GTAGTACCTTTAAGGCTCTTACTAGTTATAGGATACATCCAGTTCTTCCAAGCTGCACTG
> CTCGTAATGCCTATCGGTACTGCCCACCCATAATTTTTTGTACATCAATACCAATAATTC
> TATGCCTTAACATCTATAATAATATGATACACAGTATCTGTGAATTTACAAACTCGAATC
> GCATCCTGCATTCTTACGACGTTACTATAGCTATTCTCGATCAAATAGCGTAAGTAATTA
> AATATATAAACATGACCCATACGAAGGGCCTTGATTCCTTAGTGTAATATGTCAGTTCCC
> CGCTGAGTATCGAACACTACCCTGAGTACGGACTATAAACAGTAACAACTTTTAACACAA
> GCATGAACTACTGGCGTAGGCCAGATCCTATGCTCGGGAAAGCACTTTCCTCTGTCCTAA
> GATCTAAATTTTATATTTATGACTTGATTTTACTGAGGATTATTTGGACCAATACTTTCT
> TTCGATACAGACAAATCTAGATGAAATAAAAATACCCACATTATTTTCAAAGAGTTAGTA
> CACGGAGTTAGAGAAAGTTCCGTCTAATTACATTAAACTTATCCTGAGATAGGTTATTAA
> AGTGAGCGTGTTGTCAATTCCGTTGATTTCCAATGTTAGTCTTCCATCGCGCACTGAATA
> CCCCCAGCGACCATATAATCTTTAAATACTGAGCTCGATGACCTGAATATGATAGGCCAC
> ACTCTATGTACCGTACATTGGTCACATATATAGGTTGGTAGGCCAATCATGTAAGGGTTC
> CGAGAACTTACTTATGGTGGCATAAATGGAAGCGCGTCATCTTGACCAGTGGTTCTCCTT
> GTTAACAAATAGAAACAGGGTAGATTAAATTCCCAGTCTATAGGGCACTCAGAAAATCAT
> GAGATGTAATGACCGTAATCATCATGTAAGTGGATGAGAGTCAAATCCGGATATCCGGTT
> GAGGCTCCAGGCTACTTAAAGCCTCTTCTCGTTAGGTAACAAGCTGTTCAGGAGTGAGGT
> TGCTCTCATACTTAGTTAAGAAAAGAGTGTAAGATTTCTGCATTTGGCAATTTACTGAGG
> ACGGCATATGGTACTTGCGTTTTGATACAAAGTTCTCTCACCTAACCTAGATTGATGCGT
> TCCCCTCGTTCTATATCCTCAGCCTAAAGGACCGATTCCAAGAGTGGTATTCTCATAGGA
> TTAACGGTTCCGGCAAAAGTTTTTATCCGCATTAAGGTTTCCTTCTGCTTATAGGGGTGC
> GCTACAGGGATTTTGTGACTTGAACCGACTAAAACACTAACGGTAGTAGCAGAGGTTATG
> TAAAAAAATAGGTTCTTAAATTACTTTTTACCATGAGAGGTATCAGTAATCAAGCTACCC
> TTAGTGTAAGTGACAGTAATGGCCGACAATATCTACCTCTTTGAAGATATAAAATGTAAG
> TTACAAATGGTACAGTATAATAGTGGCAGTACTCATCCTCAAAAGTTTTGGATTAGGGCT
> GCCTAGTGTACGTCGTGACGGTAGACGATTGAAAGTCGATAAATTCTGGGATATCCCATA
> TACTTTTTGGTGGTATAGACCACCTAGCATTAAACCTCATACCATCAAACTAGTTAAGCT
> TTTGACTCTTCTTTGGCAGAATTTGACTAATAGGCGCGACCTCTCAGTACATACCTCTTC
> CATATACCAATTCGAGTAGCTTTTTAGGATTCCCTGTCAATAGTCACAATACTGCCTTGT
> CATTAAGCCGCTTTCTAACGGTACAGTTGTGCATCTCGTTGAACAATACGCTGTGCTAAG
> TATTTTCGAACCAAAAAAATTCGACGCCAGGGTTAGAACAATTAAATAATTCAAGCCATT
> AGCGAATTGAGCACTATGGTACAGTTTTAAGATCTTCTACAGTCCTCACTCTTCATTGTT
> ATCTCTCAACCCAGTTGTCAAAATCGGTTAAACATATAAGTCGGCTAACCCGAACAGACC
> TCTTAGTCTAACATGTGTCAGTACACTATAACATGTTCTTGTTAATCCAGTGCAGTGCAT
> TGATTAATCTAAGTTTCAGTGAACGTAAGCGGGCCAGACGAAACGCTATATACCTTTTTA
> GACTAGATCAAAATGGGTCCGGTCCACAGCGATCTTACCCGGAAAATAAGGAAGACGAAC
> TAAGTCATTAAGAACCCGGTGATATTCCAAGTGGGAGAGGGATGGTTATAATCCGGACAT
> AAAAAGGCACATTGAACACCCTGCACTATACGCAGGTGTCGTAATTAGTACCGGCGTCCT
> AGCTAGGTTGAAACCCAAAAGTAACAGATAAACCGTCATTTACATGAGACTTTATCTACG
> CAGCCGAGTAATAACTTGGTTACAGTAGTATTACATAGGAATTGACGTTAGAATGTTAGA
> CAGAAAGCCTTAAACGAAAGCACTTCTTCTTAGTACATGAGTTAGATATTACAATTCGGC
> CTTCTTTCCAACATGTAGTCGTTAATTTGACCCCTACGTCTTGTTTAATTGAAAATCACA
> ATCACTAAATAGAGGTTTGTCACATACTAGAAATATCCTGATTATTATCTCAACATTATT
> TTAAGTGATCTCCAATACTAGGTAAATTGTGATGCCAGGAAATACCAATTCCGTCGAGAC
> CTCTACAGAGCTTGACTACATTCCTACTAAGACCGCCGTTATGAAAGACTCCTAGGATTT
> CCCGTGAATGACTGAACAGAAATCAAGTAAACCCGTGTATTTCATCTATTAATATCTTCG
> TTTAGTGACGGACGTTTTAGTTATCCACCATGGAAGTTTGAGCCCCTAGGGCCTGATGCG
> GAACAACAATACGTGTAATGCGATCTACTGGTTATAAAAAAAGAGAGATCCGAGTAAGTG
> TAGATCATGAGCCATACTAATATTGTATGTCTTTTATTTATTATATCTAGCTTCCCACGG
> TGGTAACTCTTTCTATAGGAGTGTGATAGTATCCGTGGAATAAATCAACTAATTTTAGAT
> GAATGAGGCTTCATCATAAGACTGTAATCAGTCTGTTACATCCCCAAGACGGAATACAGT
> AGTCCCTTCGGTACGAAGTGATGTGATTGTAACACTTCTAGCGAGTGCGTGGGGTTTTCT
> TTTCCGAACTGTACCTACTGGTTATGGGGGCGCTCGCATGAACGAAATTGTTGATCCCCG
> CCCAGCGCTATCGCCCCGCAAATCCTCCGACCACATGGAATAACATAACAAGGTTTTCGA
> AGGGGGCCTTAACATTAGCGCCTGGTTCAAATACTGTCTATATTAAACTGAATAAAGCTA
> CTATTAGAGTAATGTGCGAGGTGCGCGTTGGTGTTCTAGTTATGATGCCTTCATTCTAAC
> AGTAATCTGTATTCTCAAGAAGCGGCTTAAACATAAATAACTTTCGTTCATCGTTACTCT
> CACGCATTAAATTAAGATTAATGTGATACGTACCGGGAAATAAAAACGTTAGTTCTGGGT
> AATAAAAGATTGCCGACTATTGTAGTTATGGGATTGCGGACGAATGGCTTATAGGTGGGC
> TAGAACAGCTCAAAACGTGTGAGTTCCTCCTAAAGTGCATGTCTTAATCTTAAAGTATGC
> AAGGGTAGTCTTTAGACCACTATCATAGAAAAGCTTACGTAACAAAATTTATATGATTAG
> TAGGAACGTGCATGGTTGATCATTATAACACATTCTGGTAAAAAAAACAACATTCAGAGT
> AACATATAGCAAAATAGTCAACAGTTAAATACTCGCTTCGCATGCTTACATTCGCAAACG
> ATTGCTGTGCTATCCGAACATCTTTCTAAATCACTCTACGAGCGGTCGGCAAAAGTCTAT
> AGGTCGTATACAAGTATCTGATATTGTAGTATTGGCTACATTATGGCTAAACATATTCAA
> GTGTACCATAAAAATTAAATAGCCTACACGGACGACAGAATTAGAAACAACCAATAGATT
> TACATTTTTAGCTCCTGAGCAGATGAGAAAACTACACCCAGACGACACCCTCTCCAATGA
> CTTTAATAATAAGTACGCGGAAAACGTAAGTCTCAAACATTTAAATACATTCTCGTCGAT
> TATGTGTTGGAAAAAGCGTAAGACGGGTACTCAGCGATTGGGCCACAATCTTAACCATTA
> CTATTATAAATATTGAGCCAGGATTTTCCGCTTTCTTAGGGAAATAGCATCCTAAATGTG
> TCCTTTTTCAAGGTTTTGCCCGGTTCTACGCCATCAAATGAATTTACAATACTATTTTTT
> ATCAAAATCTCGTACAAAGTCGGGATAGGGACCCATATTAAGCGCGCTCCTAAATCTGAT
> TAACATTAGTTTGTACATCGCGTAATTGAACATATAATTTAATATGGTGAAAGTTTAACC
> TCAGTTTTACTATCTTCATGTTGCAGCTATTATCACTCAACGGAAAAAACCATAAATTTA
> ACATTTCGCAAAGGACAAACTCGATGTCCTATGACGTAAATGCCTGCATTTACGTTTAAT
> AACTCGGTCAATACTCACACACTTGCCCTTCGCGACATGACCGTATAATTCATTCTCTGC
> TAACCAGGTGATGGTTGTACGTACCCTCCCAAGTGTTAGTAAATCACCTGTAAACTTGGC
> AAAACTCTGCGAACTTAACCGAATCTTTTGATATACGAGCGACTGGACATAACAAATTTT
> CGTATTATCTAAGGGCTATTCAGGGGACTTCTTTTAAACAATAACAATAATTCATCACCG
> TGATCGATTTTACAAGGTCGCACGCTGTAACTGACCCGAACAGCTTCTACGTAGCCACTA
> AGCCCACTACGAGTTTCGGTGTAGGTACACTCTCTCCTACGTATCCATCGGATTAGAATA
> GCCCATTGGAGTAATAACCATTTGGCAACAAGTAATACGACCGTAATTCTACTTACTTTT
> GCGCAATTAGCAACGCTTGGGTATCGGATACATATCTGTCAAAAGTTGTTGAGACCTATT
> TTTCTCAATCAGTAATCATTTCGTTACGGCGCTTGTTTACAGTAGATGCTAATTATTGGT
> GAAGTCCTACTCCCATTGTGCAGTGGAGCGTTTATTTATAACTAAAAAGAATGGAATAGG
> ATATCAAATGATTACATATATGGGAATCTCCACCTCCATGCGATGCTCAGTTTAATGTAT
> CAGGTAAATACAAGGTTTTGATTAAAATTGAAAAAAAGAACGAATGAGCCATCATGTTTG
> GACGAATGTCCCGATCAAATAGTACCGAAACTAAAAGACTGGTAAATCCAAAACCCAAAC
> TGAAAAGACATCAGCGCTGACCCCTACGATACAACTTAATCACTTTGGCAAACATAGAAA
> TCGCGTTGTTTTATCTTTGTTACGATTTCATCGGATGTGTATTTGATTCTCCCGGTTTTG
> CTGCTAATGCGGGGCTATACATTTTTAGCATAGAAGATACGTAGCTAACGCCAGCAGAAG
> AAACCGTTCTTAGCGACGCGATTCGTAGCCACTAGATTTGTTCGACGTGATACCGTTGTT
> CAGATTAGAGATAGAGCACGGATCATATTTAAAGTTTTACGCAACGAAAGTTAAATATAT
> ATAAAAATGCATGGGACTCTCAAGGTATAAAACTGATAAAAGTGTGTTAGTGGAAGAAGT
> GACCCAATGCCCTTTCTTAGACTTATTCTAGTATAAATCCTTCTTGCGGGTCATATATTC
> GCTTGAGATATAATCAGGATTCGCTGCTGTCCAGAATATTCAATCTATTTCCCAGAGGTC
> TTTTAGCAAAGGCATGCACGTAATTCAAGGGGCCGAAAACACTATAATTACGGTTGATTC
> TTTCTTACATGTATGGATTCCTAAGGAAACATCCCTAGCACAACGTGCGGTCCCCTTTCC
> TAGGTTTCGCCCTGTGAATGTCTTGTTGTTGCAGTCTTTCTACAGTCTCTAGAATACCCA
> AATCTAAAGTCCAAAGTCATGATACCCACAGTGAAACGTTGCGATGAAACCGCGGACTCA
> TAGATTTGGAACACCTTCCGTTATTTCTTGGCATAATTGTGGTTGTCCCCAAACGATTGG
> TGCTTGAAGGAAGACACAAAGATAAGGATAGTGCAAGCAGTCCTATCTTCATGGAGAAGT
> GTATTAATCCTCTGTGAATTCTTGGTTATTGCTCCGGGCATGATTTTTGACCGGAATCGA
> TTCTCATCCCCAACGTAATCCATTTGTGAATGTAGGTTTCAACGTTTGAGGTGGTTTTCT
> TCCCACAATTGTAAACAAGAATCTGTGTCTGTAATTCCGGCTAATTTAACCTCAATCGAA
> TCCACATTCTTTCTTGGTGCGGGCGAGTTTGGGTAAGAAAGAGACATCTATAATGTATCC
> TAGGGGCTGCAATATGTATTCAAAATTAATACTGCACAGTCATACTTAGCCGGTTCAGGG
> TTGGAGAACTGAGGAGGGTGAGCTATTACGCCTGCTTAATCCTATTATCATTTTCCTTAC
> TCACGCCGGAAATCTCTTACTATCGTGGCACCCTCTCAAATTATACCCAACGGCTTAATT
> GTTAAAAGTCGCGCCCCAAGCATCATTCGTAGATTATACAAAATAGATAGCAAGTCTACC
> CTATGAACATACTGGGCATGCATTAAAGATAGTAAAGAAGAAGGTCTGCAGGTTAGCATA
> ATTGATTTTCCTAGAAGAGTGGGGGAGAGGAGCAATATGTGTACTCGGACAACAAGACGC
> AAGCCACTCCGTAAAACGAATTAATCTGCAACGTTACGCAGGCGAAAGGCGGACTACTTC
> AGGTTTTCTGATAAAGTTTATGAACATTATTAACTTTTACAAAGAATCCTGCCAAACCAT
> TAAGGCCGGGTTACTGTTTACATTCTATAAGGTAGATAATATCAAACTACACTAATCGAC
> TACTAATTAAAGGCAGTAAAACTTGCCTACATATCGTGGACAGGAGTTTTTTTCCACATT
> GGGTCGGTACTGACTCTTTCCTTTCGTTTCACGGTCAAGATGGATGTGCATAGGTGCGTT
> TGCCCCGTCGAACTGATGATCCTGTCGAGAATATCGGTTCTAGGCAGGATCTTCAGTGAC
> ATCTGGACATACTAAATAAGAACTATATAATGAGCATCAATTGAGATATTGATGATGGCA
> ACTGGGATCTAGAATAGAGAAAAGCTTTAAGAATCCCTATCATCGTAAAAAGAAACGGCA
> CTTATGTTGCTCCTGGACAAGCACGCCCAACTTGTCAATTCTCGTGGCTTTTCTAAGGGT
> GTTAGAAGAAGGATTCCATTACCATAATTTGACAATACTATTGCACGGTCCAGAGAATCT
> CGAACTGGACTTACTTGGCGAATGACATAATGATGGCATAATAAGATTTGTTGATTACAG
> AGGTGTTATAAAAATTAGATAGAGTTGGGGTCTATACAACGGCAGATCCCGTCCTTCCGA
> TCATTTAAGGTTCGCGGACCATTTATAGTTAATTCTAATTGAAAAGTCTGGATTTTTTAT
> GCGTGCTGTTAATAAACATCGAATTGGGCAACAGCTCATGGTACTCCGCCGACAATTATA
> GTGCAGTACTATTAATTAACTCTTCTTTGATCATGCTCCTATACGTTTTGCTAACCGACA
> TGTTTTACATGGCAAGCTTGGATCCACATACTACAATCTCGGTCAGTCTATATTAAGTAA
> GTCAGAACTAATGGTGGACTATACGCCACGATCCTGAGATGTAACCCTTTGCGGCCTTTA
> TTTTACGTACCTGTTTTTTATCTCGGAGATTAGAGTTCATCTGATACACAGGCAACTTGT
> TCTGGATAAATACCAGGCACCAGCGTATATTTATCCTCCTCAGCCGATCCCTATCATTTC
> GGCGTAAGAAGTAGGTCATTTTGAATCTTAATAAGCAGGTACAGACTAAATCGACCACCA
> AAAATCCTATCAATTTCGCTTAGAGGAGATTCAGCCTATAACAAAACTGCTCAGCAGACA
> TGAAGGGCAAGCATGGCCGTAATGTATCTGAGATCACTTCGAATTGAATAAGAACCAGAA
> CAGTTCACGCGTGATAGGTATCGTCGGATTTCTGTCGACTAATGTAAGCGCCATGACTGG
> CATCAGTGCATTCGTGGGATAGTAGCTAGAGATTGATAAACAGATCATTACTCATACGGG
> GCCGCAAACATGTAACTGGGCACTTATGCCATCATTTGTGCACTTACTCGAAGTCCGCAT
> AAAACTTTAAAATATAGAACTTAAGATGGAGGTATTACATTTCAATTCCTAAATCAAAAA
> CTTCTACTTGTCTTACCTCCTAGCGTATTGACATCAGTCTAATCTCAATGACATTTCTGA
> ATTAGAGGTATACTTTTTTAGTTGGGATAGATTATACATTTCGAGTGTTCAGGGAACTCT
> TTTAGCTTAAATATCAATAACCCCTAGTTAAAACCAGACTATTACGTCCGATGAATTACT
> ATTCTTTGGGGCTTTTTCTGGGTTCGCCCATACTTCCTTTGATATCTCTGATGTAAGATA
> TTTCCAAGGTCTTATGAGGAAGGCCGGATATAGACCTAATGATCTCATATGTAGTACCCA
> CTGTAACACTTCATATATAATGATTGCTCTTCCTGTTCTCTACGAATGCTAGTCTATCAT
> AGACTTATCGTGAAGCGATAGTTCATATGAAGTGTTTTGCCGATAAAATTCTGTAAAATA
> AATGTCAAGCCGCAATCCGGTAACTAAATGTACTCTTTGTATTTATAAATCACTGTGTTT
> TGTTCATCGCACAGATGATTTTCTTGGTGCAAATATAAATATTTTCATAGGACACAACGA
> TTGAATATCGGTTTGTAAACTTAAGTTACAGGGCAGCAGTTATTTTATCATAACTCTAGG
> GCAGGACATTTTGGCATCATTGTTCAAAGGCGGGAGAAATATGATATTCCAAACAAATAC
> ATACAGCTATTGATACTCGATTATGCTTGCCGTTCAACACTGTGTGTGTAAGGATGTAGG
> CGCTAACCTCTGTCTAACACCTACACTATCTAGAACTTTCATTAGCGTAGGAAAGCGTGA
> TTGGATCTACAATGAGAGTCATCATTATTGTGTACGATACGACTTCAGACAACACTGAGC
> AGGACAGAAAAATTGTCAAAATGAAGCCTGGCATACACATCCATATCCCTTTCAAGCTAC
> TTCAGTACCAGCGCCAGTTGATTGCCACGAAAGGTGACAGGAGCGTCAGTCATTCTTGCT
> TACCATCATTTGTATGTACGGAGTAAGGGTCAGTATTACATCAATCAGAAGAAATAGATG
> ATCGCTTTAGATGAAAGAGGGTCGTAAATTGTCGCATTAACGAGGTCGTGATTCGACGAA
> ATGTGGATAGACAAAAGCGGTTTAGATAATATATTTACTTTAAATAATACGTATTTAAGT
> TTAAGAATGTACTAAGATTCAAATCAAATCGCCACATTTGCATAACCTTAATGATAGTGT
> ATCTTTTACTGGAAAGCATCCCTACGAGCGGTTAATTTTATATTATTTAGAATAGAGAGC
> GATACGTTAAATTATAAACAACCTGACAATTAGAGCATGTCTGAACACCGTGTACCTGAA
> TACTTCTAGATCGTCCTTATAACACCTGGATACCCTCACTTAACGAACCATGGGTGTTTG
> ACTATTTTTTGTGGATTCATCATATCAACCCCTTGTCCCATGGTAGACCATAATGTTGTT
> GAGACTCGCCGAATATCATACATTGTCTTATTGCTAATTTTCAATGTCCCGAATGGGAGC
> GTTACACTTTATAATAATAGAAACCATTAATCGGTTTAAACAGCAATATCTAAATGGCTC
> TCAAACTAGGAATGCTTAAAGGGATTGCTCAGTAGATGCAGGACCCGACCCTATGTGTGC
> TGCCACTTTGGTCACGAGATAGCAGAGCTCCAGGTATGATGCCCTGTGGTAGAGTCGCGA
> ACCGTATCCTAATTGTAAAAGTCAATAAACTAAGTTCTACTCTTAGTTAAAGATTAAAAC
> CTTCCAGACGAGAATTATCTTAGGATCGAGTATGAGACCTTGTCGTTACACGTACTCATA
> GTGCCACGCTATGTTAGAGTTTTGCATAGAATTGAGGTGGTGCCTCGTGTCTCCTGTCTT
> TCATGAACAGGTCAGCTTAAAGATTTGCGTTGTGCATTCCTATACACACGCTGACAACAG
> AATATTAGGATCACGGATATGCCAACATTAAGCTACGGTGGTAAACGCCCGATCAAGAGA
> CCTAAAGAATCATATGCTTGTATAACCCTACCCCAAAGCATTGTAATGCAGACGTCCGTA
> ATAATCCTAAGTGATTTGATTAGTGCACTCGCGCCTTCTCATTGTGGCGGAATAATCTGA
> CTTAATTTTTAAAAGCTAAGCGGTAGATATGAATTCTCCATCGAATATAATTGAGTTATC
> AGCAGATTCGACGATATTTTACAAGCCGGATAAACGTTCTCCGTGTTCAATCTATTACCC
> GTGATAGTCTATTCAACGTTTGGAAGAACAATTAACAGGAATTTCTATGATAGTGATAGT
> TTATTAAAGCTGACGTTCTTCGCTTAGGTTTGTTTGTTATTATTAATCTGGATAAACTTT
> TCAGGGTCTCCAGGTATTTGGCAAATCTTCATATGGATGACCCCCCACTTGCAGGTTAGT
> TGAAATGGTACAACTCGTCCAAAGGAAAGATTATACAAGATAGGAACTGCAATCTTGAAT
> TTTCATGCCTATTCACGAATTGTAGCACCTAGTTGTTGAAAATACACACGCCGACAATCG
> ATAAAATCAAATAGCCCCTAACGGCTGTTAATACATCATGACACCTAGATGCTGAAAAAG
> TGTAATGTCCATATGGACTTGAACTCGTAGAGTAAGTGTGTCCTCACTCTCAGCAACACA
> TAGTACTACTAGGTGTTATAAGTGAATACAATCGTGGACCACTTTACCTACGTCTTTCCC
> GGAGATGTAGGTTAACCAGTAATAGGATATAGGTAAGAGTAGGAGAGAGGGATGTACGCG
> TCGTTAAGAGCGAATGGAAGACTCAAACGAGTGGCATCAAGATTGAGAAATTAGCAGAAC
> TAGAGCTCGAGCAGCAGAAATAACTCTGTTATTCTCCATCGTTCGATGAATGTATTATTG
> TAGTTACAAAGACCTCATACCTCTTTTTATATAATGGTCTTAACACTTTTATGTATAAAT
> TGTCTCTTATAGTTACCAGTACTGAGTTCTTCGTATCTTGTACAAAGCTTGCTTCGTTCA
> TGTCGGTAAAGGGAGCTCCTTTAAACAATGTGGTACAGCGTCCACATACTAGATTCGAAT
> ATCATATTACAGTAAAATTGGCGTTGTCTATCAAACGTGTATGATGCTAGGCTCCATCGA
> GGATGAGGGTGTGTGATATTAATTAGTATTTTTATGTTGTGATATTAAAAGACCCGCGCT
> GGAGAAGGTAATTATCTACTACTCCTCCCGGGGCAGGTCCCAATGTGTGTTCATTGAGTC
> AGACGTCTGTACACCTAAAAATCTGTTATCGTACACCGTTATTCGGGAAACTTAGTTTCT
> ATTATAAAAGCCATCTGGTACAAGTTACTTTGCATGCAGATCTGTCAAGATCGCAAAATT
> AATGAGCGGTACATACCTGCCTTTCTAGGTACTGGATGGAGAGTTCTTGGTATAGCATAA
> TGACTCTTCTTCCAACCTCAACTCCGAGGAAGCACGATCGCTACTGACATCAAATTATTT
> TTGGGACATCTAGACCAATAATTCGTGGCCGTAAAATCTATAATTTGATGATACTAAGGA
> GATCTGAATGTACATACTCGAAGCGCTTCCTGATTTATTTCGACGTGACTTTTCATATTA
> TAGATCAAATAGCCTTACGTAGGAAATATAGATACAGCAACAATACGAACGGAATTGTTT
> ACGTTCGGTATTATGTATGTTCACCGCGCACTTTCGTTCACTACCCTGTGTTCGGTCTAG
> ATTCTGGAAAAACTTTTAACTCTACCAGGAACTACTCGCGGACGCATGATCCGATGCTAG
> GCATAGCTCTTTCCTCGCTACTATGTTAGAAAGTTTATATTTATGTCTTCAGTTGAATCA
> GCTTTATGTGGAACTATAATTTAGTTAGATACAGACAAATCTAGATGAAAGAAAAATAAC
> CAATTTAGTTTCAAAGACTGTCTAAACGCACGTAGAGTAAGTGACGTATATTTACTTTAT
> AATGATCCGGAGATAGGGTATTAAACTCACAGGGTTCGAATGTCCGTTCATGTCCAATGT
> TACTCTTCATGCCCGCAATGTATAACCCCTGCCAAAATTGTATATTTTTATACTCTCATC
> GATGACCTGAATTTCATACGACACTATCTAGGTTACCTACTTTGGGAACATATAGTGCGG
> GGTAGCCCAATCTTCTAAGCGTGCCGAGTACGTACTTAGGGGGCCATATAGGCAAGCCAC
> TAAGCTGCTACTCTCCTTCTCCTTGGGAAAATAGACAAAAACGGTTGTTTATATTACAAG
> GCGATAGGGCACGAACTATTTAATGAGATGGAATGACACGTTTCATAATGTAACTCGAGG
> TCTGGAATTTCCGCATAGCCCGTTGAGCCTCAAGGATACTGTAAGCAGCTTCGAGGGACC
> TTACTACATCGTCTGCTCTGACCTTCAGCTCATACTTTGTTAACATTACAGTGTTACATT
> GAGCCAGTTGCAAATTTAATGAGGACGGAAGATCCTACTTCCGTTGTGAGAATAAGTGAT
> ATCTACTATAAGAGAGTGATGCCGTCACCTCCTTATTGATCCGCTGCCGAAACGAAAGAG
> TAATACAGTGCTAGTCTCATTCGATTAAACGTTAAGCCAATAGTTTTGATCCCATGTTAG
> CTTGCAGGCGCCGGTTACGCCGGCCATTCTCGGTTTTTGTGTCGGCTACAGACTAAAACA
> CTAACGCTAGTAGAACAGGTTTGGTAAATAAAGAGGTTATGAAAGTTCTTGGTACCATGA
> GAGCTATCAGTATTCAAGATACCCTTACGCGAACGCAATCTATTCGCCGACTTTTGCGTC
> ATCTTTGTTGAGTTATTAGCGAAGGGACTTAGGCTAAACTATTATAGTGCCACTTCTCAG
> CCTAAATTGTTTTGGATTTGCCCTGCCGACTCTACGGCGTGACCGTAGTACAGTGAAACT
> ACATTAATGCTCGGATATAACAGAGAATGGGTGGGGCTTGACACCACATACCAGTAAACC
> TCTTTCCTTCAAACGTCTGAAGATTGTGAATCTTCGGTGGCTGAATTTGAATTATAGGCC
> CGTACTCTATCTACATACAGATTACAGATACCAAGTCGAGTAGCGGTTTACGATGCCCTG
> TCAATAGTCAAAATACGCAATTCTCATTAAGAACATTTAGAACCGTTCACTTGGCCAGCG
> CCTTGATCAATTCGCTCTGCGTTCTAGGTTAGAACCTTTAAATTTCGTCCCCACCCGGAC
> AAAAAGGAATGAAGTATAGCCAGTAGAGAATTGTGCTCTATGGTTCAGTGGTATGATCTG
> ATACACTCCTAACTATGAATGCTTTTCTAGAAAACCACTGCTCATAATCCGTTTATAATA
> TATGTACCCTATCACGAACAGAAATATGACGCTAACATCTCTATGGTCAATTTAAATGGG
> TCTTGTTTATCCAGTGCAGGGAATGGATTAATAGATCGTTCAGTCAACGGATGCCGCCCT
> GTCCAATCCATAGAGAACTTGTTAGTATTGTGATTAAGCCCTAAGCTACTCACCGATATT
> ACCAGGTATATAAGCAACACGAAAGTAGTCTTGAAGAAAACCCGGTTATGCCAACGCCCA
> CAGGGATCGGGATAATCAGCAAATAAAAACCAACATTGTACTCCAGCCAATTGTACCAGG
> TGTCCTTATTTGTAAACGCGTACGTGCGAGCTGGAAACCAAAAACGAAAACATATTCCGT
> AATTTAAATGAGTCTGTAGATACGCAGAAGAGTATTAAAGTCGTTAATCGAGTATGAATT
> TCGAATTCACGTGAGTTGCTTAGACACAAAGCCTTAATCCTTAGAACGGCTTATTTGTAA
> TTGAGTTACAGATTACAATTCCCCATTCTTTCAATCAGGTACTCCTTAATTTGAACACTT
> CGGCTTCTTTAAGTCAAAAGCACTTTCTATAAATACAGGTTGGTAAAATAATACAAATTT
> CCTGAGGATTTTAGAAACATGATGGTTAGTGTTATCATAGAATACCTAAATGCTCATCCA
> TCCTAAGTCATTTTACCTAGTGACCGCTACACACCTTGTCTAAATTACTTCGTACACACC
> CCGGATGAAACAATACTACGATTGCAACTCAAGGACTGTAAACATATCAAGTAAAACCGT
> GTATGGCATCTATTATGATATTCCTTGTGTGACGGTAGTTTTACTGTTCAACAATGCTAC
> TTGGACCACCTTGCGAAGGTTGACCAACAACAATACCTGTAATGAGATCGACTGCGGATT
> ATTTATGTGACAGACGACTAACTGTACTTATGCACCCAGACGAATTTTCTTTGTATTTTA
> TTTATTATAGCGACATTACAACGCTGGGAACTATTTAGTTACGAGTGTGATTGTATACGT
> GGAATATAGAAAATAAGTTTTCTTCTATCAGCCTGAATCATAAGACGCTAATCACGATGT
> TTCAGCCCATTCAAGGAATAATCGAGTACCTTCGCGTAGTAGTGAGGGGTTGGTAACACT
> TAGAGCGACTCCCTGCGGTTTTCGGTTAACTACTGTAAAGTCTGCTTTGCGCCCCCCGCG
> AAGCAACGAAAGTCTTGATAAAACCCCTCACATTGCCCCAACCATTGCATACCTAAACTT
> GGAATTACATAAATAGGTTTGCGAAGGCGGCCGTTACTGTAGCGCATGGTGCAATTACGG
> GCTATATTAAACGGAATAAAGAGACTATTAGAGTTATCTCCGACGTGCGCGTTCCTGTTC
> TTCTTATCTTGCCTTAATTATTACACTATGCGCTAGTCGAAACAAGAGGCGGATACTTTA
> AGTACTTTAGTTCATCGTTAAGAGAACGAATGAAATGATCTTTATTGTCTTAACGAACCG
> GAAAGAAAAAACTTTCTTCTGGGTAATAAAACAGTCCAGAATATTGTTCTTATGCGATTG
> ACCTACTATGGATGTGAGGTGGGCGTCAACAGCTAAAAAAGTGTGTCTGCATAAGAAACG
> CCATGTCTGATTCTTAAAGTATGCAACGGTACTAGTTTGAACACTATAATAGTAATGCTT
> AAGTAACAATATTTTTATCATGAGGAGCTACCTCCATGGGTCATCAGTATAACACTTTCT
> GGTAAAAAAAACTACATGCTGTCGAACATATAGCTTAATAGTCTAAACTTATTTAAGCGC
> TGCGCATCAGTTAATTACAAATCCTTTCCGCTGATTTCCGAACATCTTTATTAAGCAATA
> TACCTGCCCTCCGAAAATCTATAGAGGGACGTTACAACTATATCATATTCTACGATGGCC
> TAATGTATCCATAAAATTTGTCTAGTCTTACATAATATTTAAATTCCAGTATACGAACAC
> TCTAGTAGAAACATAATATTCTGGGACATTGGGAGCTACTGACAAGATCAGATAACTAAT
> ACAACACCTCACCCGATCCATGGTCGTTAATATGTACTACCCGGAAAACGTAACTCTAAA
> TCTTGTATATTAAGTCGCCTAGATTATGGGTTCGTAAATCACTAAGAACGGTACTCACCC
> ATTGCCAAAATAGCTGAACCTTGAATATGATAATTTTTGAGACAGGATTGGCCCATTGAT
> GACCGTAATTGCTTAATTAATCGGGACGGTTGCAAGGTTGGGAACGGGTATTAGACATCA
> TATGAATGTTAAATTCTATGTGGTATCATAATATAGTACTTACTCCGCATAGCCTAACAT
> TGTTTCCGCCCTAAGTTAGCGGATTAACATGAGGGTCTAAAGACAGTAATTCATCTTATA
> TGTTATTATCGGCAAACTTGAACATCAGGTGTTCTAGCGTCATCTTGCAGAGATTTTCAA
> TCAACCGTTAAATCAATAATTTTTAAAGTTAGCAAACCTCATTATCCTTGTACTATGACC
> TATATGCCTCCTGTTACCTTGAATATATAGCGCAATACTCACACACTGCCCCGTCGAGTC
> AGGACAGTTTAATTCTGTAGCTGATATAATCGTGATGCTTGTAACTACACTACCAAGTCT
> GACGAAATAACCGGTTAAATTGGCAAAAATCTGCGAACTGAAAAGATGATTTTCTTATAC
> GACCCAATCCTCATTAATATTTTTCCGATGATCGAAGCGATAGTAAGCGGAAGTCTTTTT
> AACAATAACAATATGGCAGATACCGCATCCATTGTTCAAGCGCGCTCCCGGTAAATGACC
> AGAAATGATTCTACGGAGCCACTTTGCAATCGACGACTTTCCGTGTTGGTTATATATCGC
> ATACGGAGCAATACCAGTAGAATAGCACATTCGTGGAATAAAATGGTCGAATATAGTATT
> AACAACCTAATTCTAATTTCTGGTCAGCAATTAGAAACGCTTGCCTATAGGAGACATATA
> TCTCAATACGTCTGGAGAACTATTTGTCTCAATCACTTATATGTTAGGTACGGCGCTTGG
> TTAAACGAGTTGCGATTTTTTCGTGTACTCCGTAGCCCATTGGGAAGGCGAGCCTTTATT
> TTTTACTATATTCAATGCAATTGGAGATATAAGCAGGACATAGTTGCCAATCGACTAATC
> AATGCCATCATCAGTGGTATCGATCAGCTTTTGAAAAGGTTTGCAGTAAAATGGAAAAAA
> AGAACGAATGTGCCATATTCGGTGGAACTATCGCACGAGCAATGAGTAACGAAACTAAAT
> GACTGCTAAAGCCAAATCACAATCGGTAAAGACAGCACAGATGTCAACTAACAGAATACG
> GAAGATCTGTCGCTATATTTCAAATCCCGTGCTTTTATAGTTGGTACGATTTCAGAGCAT
> CTCTATGTCATTAGACCCCTTTGGCGGCTAATCCCCGGCTTTACATTGTTAGATTAGAAC
> ATACCTTGCTTTACACTGAAGATCAATACCTGCTTAGCCACGCCATGCCGTCAATATACA
> TGGGTTCCAAGTCTTACACGGCGGAAGATTACACATACACATCCGAGCTTTTGTAAAGTT
> GGACCCTTACAAACGTAAAGTTTTATAAAAAGGAATGCCACTAGATAGCTATAAAACTGA
> GAATTCTGTGTTAGGGGAAGAAGTCAACCTTTGCACTTTCTGAGACGGATTCTAGTATAT
> TTCCTTAGGGACGCGAATTTAGGCGATTCAGATTTTATCACCATGACCTCATGGCCAGTT
> TTTTAAAGATTTGTAACTCAGGTAGGTTAGAATACCCTGCCTACTAAGTAATCCCGACGA
> AAACAATAGAATGACGGGTGATGCGTTATTTCTTCGTTGGATTAAGAACCTAAAATCCCT
> TGAACTACCTGACGTACCCGTTCCTACCTTTAGCACTGTGAAGGTATGGGTGTTCCACTC
> GTTATAATGTCTATAGAATAACCTATTCGAAACTCCATAGTCATCTTTAACACTGGCTAA
> AGGTGACAGGAAAAACACGTAGAATTCATTTGGAAATACGTCAGTTATTTCTTGGCTTAA
> TTCTCCTGGTCAAAAAACGAGTCCTCATGCATGGAACTCTCTAACATAACGATAGTGATT
> GCACGAATATCTTCATCCAGATCTCTTTGTATAATCTGTGTTTTCTTGCTTATTGCTCAG
> CGATTGATTTGGGTCACGAAGAGATGCTCTGCCCCATCCGAAGACATTTGTCAATGTACG
> GTTAAAAGTTTCTCGTGCTTTGATTCAAACAATTGTATAAAACTATATGTGTCTCTATTT
> ACGGAGAATTTAACCTCTAGCCAATACAATTTATGGAGGGGTGAGGCAGAGTTTGGCGTA
> CAAACAGAAATCTATTATGGATAAGTGCCCCGCCAATATGTTTGAAATTTGTATAATCCA
> CACGCTTTCGGTGAAGGTTCACGCGTCGAGAAATGTGCACCCTCAGATTGTACGCCTGAT
> TTAGCATAGGAGAATTTTAATTACTAACCACCCAAATCTCTTACTATAGTCGCTCACTAT
> CAAATTTTTACCATAGGCTTAAGTCTTAAATCTCGCCAAAAAAGCTTCTTGCCTACAGTA
> TAATAAATACAGAGAAACTCGACCCTTGGTACTTAATCCCCTTGAATTAAACTGACTTAA
> CAAGTAGGTCGCCAGGTTACCATTTTTCATTTTCATTGAAGAGTCGCCCAGAGCTGCTAT
> ATGTGGAATAGCACAACAACACGCAAGCCTCTAACTATATAGATGTATTATGCTACGGTA
> CGAAGCCCAAAGCCCGAAGTCTTCACGGGGTCTGATAATCTTTAGCAACATTATGAACTG
> TTACAAAGATTCCTGCCTTAACATTTTCCCAGGCTTACTGTTTAATTTATTTAAGCGTCA
> TAAGTTCATAATAAACTAATAGTAGACGAATTTTTCGCAGTAATACTTGACTTCAGAGAC
> GGGACTCGAGTGGTTTGACACATGGGGGCCCTAATGAAGATTTCATTTCGGTTCACCGTC
> AAGATGCATCGGAAGTGCGGACTTGGACACGTCCATATCATCATAAGGTCGACTATATCG
> GTTCTACGATGCTTCGTAAGTGTCAGCTGCTCTGTCTAATTTTGTTATATATATTGACCT
> TAAATTGAGATATTGATGTTGGAATAGCGGATCTAGAAGACTGAATTGCGTTAAGAAGCA
> CTAGAATCGTAAAAACAAACGCATCTTAGCGTGCTCAGCCACAAGCACCACCAACTTGTA
> TATTCTCGTGCAGTTTAGATCGCGCTGTCTACAAGCAGGACTGGTCAATTTGGTCAAAAT
> TCTATTCCACGGTCCAGACTATCTACTAATCCTCTTAATGGCACAATGACAGTTTCTGGC
> CATAATTAGATGTCGTCTGTACACTGGTGTTATAATAATGAGATACACTTCGGCGCTATA
> CTTCCGAAGATCCCCTCATTCCGAGCATTTAAGGTTCGACGAACATTGAGACTTTAGTAT
> TAGTCTAAAGTCTCCATTTTGTTTCAGTGCTGTTAATAAAAATACAATTGGCCATCAGCT
> CATCGTACTACGACCAAAATTAGACTGAACGACTTTTAATGTTATCGTATTGCTTCATCC
> GCCGAGTAGGTGTCCTAACCGAATTGTTTTAAATCCCAAGAGTGGTTCCTCAGACTAAAT
> TCTCGCTCAGGCGATAGGAAGTATGGCACATCTAATGGTGCTCTTTAACCAAAGATCCGC
> AGATCTAAACCGTTGCGCAATTTATTTTAAGTACCTCTTTTGTAGATCCCAGTTTACAGG
> TCATATGTTTAAAACGAATCTGCTTATCCTTATAGAAAAGGCACAACAGTTTTGTTAGCC
> GAATAACACGTGCCATATATGTTCGGCGTAAGAAGTACGTAAGGTGGTTGAGTATTTACA
> TGGTACTGTATTATTCCTCCTAAAAAAATAATATCATTTTCCCGTTCAGGTCTTGAACAA
> TTTTTCAAAACTGCTATGCACAAAGGTAGCGCAACAATGCCCCGAAGCGATATCTGATAA
> CGTACTTGTCTATAAGTACCTGATCAGTTAACGAGTGTGAGCTAGAGTCGCATTTCTGTC
> GAATATTCTATCAGACTTCTCGCGAATATGTGCATGCGTGGGTGAGGAGCTAGTCTTGGA
> TATTAACTTCTTTACTAAGAAGGGCCCGAAAACATCTAAATCGGAACTGATGACATAATT
> TGGGAAAGGACTCCAACTACGATTAAATCGTTAAAATATAGTAATTATGTTCCTGCTATG
> ACATTTCTATGACTAATTCATTAAATGCGACTTCTCGTAACTCATACACGATGCAATTCA
> GGATATTATCATTGAAATTTATCAATTAGTGGTTTTCTTTGTGAGTGCCCTTAGAGTATT
> CATTGCGAGTCGTAACGGATCTCTTGGTCAGTATAGAGCATTATAACCTTGGGAAATCCA
> GAAGTTTTCCTACCTTGTATTACTATGCTTTGCGGATGTTGCGCGCTGACCCCATAAGTC
> ATTGCATATATCTCAGGTTAGTTAGGTACATGGTAGTATCACGAACGAACCTTTTACAAA
> GATTGTGATCATATGTAGTAAACAATGTAACAATTCATATTTTATGATTCCTCGGCCGCT
> TAGCTACGTTGCATAGGCTATAATACAATGATCGTCTTGCGATAGGGCTTTTGTAGTGGT
> TGGACGTGAAATGTCTGTTTAATAAATCGCAAGCAGAATTAACGTATCTAAATGGTCTCT
> TTCTTTGTATAAATAACTCTGGTGGCTGCATAGCACAGAGGTTTTTATGGCTGCAAATAT
> AAATAGGTTCTTAGCACACAAAGATGGAATATCCCTTTGTTATCTTAACTTACAGGCAAC
> CTCTTATGGTATCTTAACTCGTCCCAAGGTCAGTTGGCCATAAGTGTGCATTCCACCGAG
> TTAGATGATATTAAAAACTTTTTCTTACACATATTGATAAGCCATTATCATGCCCCTTAT
> ACTCTCTCTGTGTTACGTTCGACGCCAGAAAATATCTCTTTATAATAATCTAGCTACTAC
> TTGATTTACACTAGGAATGAGTGTGTGCATCTACAAGCTCTGTCATCATTATGGTGTAAG
> TGACGTCTGAAGACAAAACTGTGAAGGTCAGTTAAATGGTCAAAATCTACACTCGCTGTC
> ACTTACTGATACATTTCAACCTTATTAAGTAAATGAGCAACGTGTTGGACAAGTTAGCTC
> TAAGGTCCCTCAGGCTTTATTCATTAACATATGGTGGATGTAAGGACTAACCCTAACGAT
> TTATTCAAGCTGTACAATGACTTCATCCATTTACAGGAAAGTCCGGCCTAAATTGTCCAT
> TTAAAGTGCTACTCTTTCCTCCAAAGCGGGATACTCATTAGAGGTGTACTGAATTTTTTT
> AATTGAATGATGTCGTATTTAACTTTAAGTATGTTCGATGTTGCAAATATAATCGAAACA
> GTGCCAGTTCATGAATGATAGTCTATCTGTTTAGCGAATCCATCACTAAGTGACGTTAAT
> GTGATTTTATTTACATGTGAGAGCCATTAGTTATTGGATAAAAATCCTGACAATTTGAGC
> ATGTCGGAACTCAGTCTAACGGATGACGTCTAGTTCCTACTGTTAAATCATCGATTACAT
> CAATGTACCAAAATTCCCTCTGTCAAGAGTTTTGCGGGAGTCATAATAGCAACACCGTGT
> ACCATGGTAGTCAATTATGGTCTGGACACTCGAACAATTTCATACTGTGTATGTGGCCTA
> ATGTGCTTTCGACCCAAGGGCTGCCTTACAATTTAGATTAATAGAAACCATTAATAGGGT
> TAAACACCATGTTATTTATCCCGATAAAACTACGATTGAGGTATCGCATTGCTAAGGACA
> TGAAGCAAAAGACACTATGTGTCAGGCAACTTGGGTCAAGACAGTCCACACCTCCTGCGA
> TGTTGCACGCTCCTAGTCTAGACTAACGGTTCCTAATTGTAAAACTCTAGAATATATGGT
> CGACTCTTAGTTAATCTTGAATACCTTAATGACCACAATGATAGTTGCATAGAGGATGTG
> AACTTGTCGTTACTCGGTCGCTGAGGCACAAGCGATGTTACAGTTTTGAATTCATTTCAC
> GTGGTCCATCGTCGATCCTGTCTTGAATCAAAAGGTAACCGTAAAGATTTCAGGTCGCAA
> GGCCGTTTCACTCGCTGTCAACTGTTGATTAGCATAACCCATATCCAAACAGTAACATAC
> GCGGCTATACGAAAGATCTTCAGACCTAATGTAGCTGAGGCTTGTAGATCCCGTCACCTT
> AGAATTCGAATCCACACGTCACTTATAATCCTAAGGGTGTGGTGTAGTGAAAGACCGCCG
> TCTCATTGTGCCGGTTTATTCTGACGTTATTGTTAAAACAGTTGACGTACAGATGATTGA
> GAAATCCATTTGAATGCAGTTATAAGATGATTCGACGAGTTTTTAAAACCAGCATAAACG
> GTATCCCGGTGAAATCTTTTTCCACTCAGTCTAGATTCAAAGGTTGGAACAAAAATTATC
> ACGAATTTCTATGATACGCATTGTGTAGTAAACATCACGTTCGTCGCTTACGTGTGTTTC
> TGAGGAGTAATCTGCATTAAATTTGAAGGCTAGCCTCGTATTTGCCAATTATTCTTTTCG
> ATCACAAACCACGTGCTGCGTAGTTCTAATGGGACAACTCCTACTTAGCAAACAGTAGAC
> AAGTTTGGAACGCATATCTTCAATTTGAAGCCAGATTATCCAATGGTAGCACATACTTGT
> TGAAAATAAAAACCCCCACATGACAGTAAATAAAATAGCCAAGTAAGCATGTTTATAAAG
> CATGTATCCTAGATCAGCAATTAGTGGTATCTACATATGCACTGCAACTCGTACACGATG
> TCGGTCATAAATCTATGAAACACTTACTACGAATACGGGTTTGAACGGAATTAAATAGTC
> GAAAAATTTAAATTCGTCGGTAACGCAGATGTTGGTTATCCTCTAATTGGATATACGGAT
> CACTAGGAGAGAGGGATGGACGCGTCGGTTACAGAGTAGCCAACACTATAAAGACGCGCA
> GCAAGATGGAGTAATTTCCACTACTTCACCTCGACCAGCAGAAATAAAGCTGTTATTATA
> CATCGGGACATGAAGGTTTTATTCTTGTGTATTAGACATCTTACATCTGTTGATAGATTG
> GGCTTAAAACGTTTTTGTATTAATTGTATCTTAGAGTGTCATCTTCTCAGTTCTGCGTAG
> CTGCTTCAATGCGTGCTTCCTTCTTCTCCGTATACCGACATCAGTTAAAATTTGTCGTAC
> TGCCGACACTTACGAGATTCCAATTTAATATGACAGTTAAATGCGCGTGCGCTTTCAAAC
> CTCTATCAGGATAGGCTCCTTCGACCATGACGCGCTCTGAGAGGAAGTACTATTTGTTGG
> TGCTGAGATTTAAACTCCCCCCATCCACTTGGGATTTAGATTCTTCTAATCACGGGGAAG
> CTCCCAAGCGGTCTTCATGGAGTCTCAAGGCTGGACAACTTAAAATCTGTTATCGGAATC
> ACTTTGTCGGCTATATTAGGTGCTATTATTTATGCAAGATGCGACATCTTACTTTCATGG
> CAGTTCTGTCAACAGCCAAAAAGTAATCAGCCGTAAATAAATCCCTTGCGTGGTAATGGA
> TCCAGAGTTATTCGTATTCCTTTATGAATCTGATTAAATCAGCATAGCAGAGGAAGCACG
> TGACCTTAGCACATAAAAGTATTGTTGCGAATGATTGTACAAGATGTAGTGGCAGTTTAT
> GATATTAGTTGATCAGAATAACGAGATCGCATTGTAATTAATCGAAGACATGACTCATGT
> AGTTACACCTGACTTTTCAGTTTATACAGAATATTCCCTTACGTAGGTTTTTTTGTTAAA
> GCAAAATTTACTTCGCAAGTCTTTAAGGTCGGGTTTTTCTATCGGAACACAGCTCTTTAC
> TTATATAACCTCTCTTAGGTCTAGATTATGGTAATAAGTTTTAATATACCTGGAAATTAT
> CCCCGTCCAATCAGAAGATCATACCCATACATAGGTACTAGCGAATATGTGAGATTGTTT
> ATTGTTTTGTCTTCTGGGGAATCACCTTTTGGTCCTAATATTATGTAGTGACATTATCTA
> AATTATTCTGCATAGATTAATAACCAATGTTGGGTAATTCTCTGTCGAATACCTCGTTCT
> CTATCTGAACTATATGTTATTGATAATGTTACGCTCATTCGGGTTTATTCGCTCACGCTG
> CGAATGTAACTTCTGGTACAAGCGTTCGATGAATGCCACATATCTAGAACAAATGACAAA
> ATTGTTTATTTTTAGTAGCTCATAGTTGTCCTCAAGTTCTGACCACAATATATAGCTTAC
> CTAATGGCGGAACTTTGAGTGCGGGCTACCACAATATTCGATGCCTGAACTCTTCGTACT
> GAGCCGCCATGATAGGCATGACACTAAGATGCTACTCTCCGGCGCATTCGGTAATTTGTC
> TAAATCCGTTGTGTTTAGGAAAACGAGTTAGCGCTCGATCTTTTTATTCTGTGCGTAGGT
> AACGTTGATGAATGTATCTCCAGCTCTGGAATTGACGCAGAGAACGGTGACCCTCAACCA
> TAAGGTAACAAGATGCGAGGGTCCTTTATTCAGCGGCTCCTCGCTCCTGCAGCGAATTAT
> TTCGGAACATTACTGGCTTACATTGAGCAAGTTCCAAATGGAATCTCCTACCAAGTGCCT
> AATGCACGGGTCAGAATTTCGGAGATCTAATATAAGAGTGTCTTCACGGAAACTACTTAT
> TGATCCGATGACGAAACCTAACAGTAATTCACTCCGAGTATATTTCGTTTTAACCTTAAC
> CAAATTCTGTTGTTACCATGTTACCGTGAAGGAGCAGGTTTCCCCGCCCAGTATCCCTTT
> GTCTCTAGGCTTCAGACTTAATCTATTACGCGACTACAACTGCTTTGGGTATTTAAGTCG
> TGATGATAGGTATTGGGTAATTCTGTGCGAGCACTTTTAAACATTCACGGTCGCGTTCGC
> TATCGATTCCAACAATTTTGAGTAAGATTGCTTCTGTGATTTGCGAACGGAATTAGCCTA
> ATCGATTATAGTCCATCTTAGAAGCCTAATTTCTTTTCCATTTCCCCTGAAGACTCGAAG
> GCCGCTACCGACTACAGTCATACGACATTTATGAGCCGTGATAAAAGTGAAGGGGTCCGC
> CTTGACAACACATTCATGGAAAACTATTTAATTAAAAAGTCTGATGATTGTCTATAGTAG
> GGCCCTCAATTGCAATTTGAGCACACTAAGCGATCTTATGACAGATGACAGAGAAATTGT
> CGTCTACCGGTTTACCTGGAAATGTCTAGACTAAAATTTAGCAATTCTAAGTATCAACAT
> TTAGTTACCGTAACTGGGCAAGAGACTGCATCTATTACCGCTGAGTTCTAGGTGAGATAC
> TTTAAATGGAGTCCCCACCCGGACAAAAAGGAATGTTGTATACAATGTTCAGTTTGCTGA
> TATATCGTTCACGGGGTTGATCTGATTAACTAAGATATAGGATTGCTTTTCTAGAAAAAA
> TCGGCTATTAAGACCTGTATATTATATCGACCCGTTAAACTTCTCAAATAGGTCGATATA
> AGCTCGATCGTCAAGTTATATGCGTATTGTTTATCCTGTCCAGGCATGGCATTAAGAGTT
> CGTGAACTCATACGATCACCCACTGTACTTTACATAGAGAAATTGTTACTATTCTGATTA
> AGCCCTAACCTAATCTCCGAGATTACAACCTTTATAACCAACTACATAGTTCTATGGAAC
> AAAAACCGCTTTTGAATTCGCCCACACCCATCCGGTTTATCACCTATTTTATACCAAAAT
> TCTACTACAGCCAATTGTACCACCTGTACTTTTGTCTAAACGCGTAAGTGCGAGCGGGAA
> AACATTTTCGTAATCTGATTCACTAATTTTAATCACTCTGTAGATACCAACAACAGTTTT
> ATAGGCCTTAATCGAGTATGAATTTCCATTTCTACTGACTTGCTGAGACACATTCACTGT
> ATCCTTACAAAGGAGTATTTCTAATGCACTTACTGATGACATTTACCCATGATTTAATTA
> TGCTACGACGTAAGTTGTAAAAGTACGAGTCTTTTAGTCTTTAGATATTTATATATATAC
> TCCTGGCGAAATTAATACTAATTGAAGCTGGTTTTTAGATTAAGGTGGGGTACTGTTATA
> ATTGAAGACCTATTTGCTCTTCCATCCTTTGTAATTGTACCGAGTGTACGATACACTCAG
> TCTATAAAGGAATTAGTACAAACCACGGAGCATTCAAGAATACGATTGCAACGCATGCTA
> GCTTATCATATAAACTTTAAACCTCGATGGCATATATTATGATATGACGTGTCTCACCCT
> ACTTTGACTGTTAAAAAATGCTACTGGCACAACAGTCCCAAGCTTGACCTAATACATGAA
> CTCGATGCAGATCGTATCCGGTGTATTTATCTCTCAGAACACGATCTCTACTGATGCACC
> CAGTAGATTTTTCTTTCTATGTGAGGTTTTTTTGCGACAGTACAAAGCGGCGATATAGTG
> AGTTACGACTGTCAGTCGAGAACTGGTTTATAGAAAAGTTGTGTTCTTCTAGCACCATGA
> TTATTAACTAGCTTTTCACGAGGTTTATGACAATTCTAGCATTAATCGTCTAAAGGCCCG
> TACTTCTCTGCGCTGGCTAAAACTGAGACCCTCTCACGCCGCTTGTAGGTGAACTAATGG
> TAAGTATCCTGTGCCCCCACAGCCATGCATCCAATGTCTGGATAAAACACATCACATTGA
> CACAACATTTGCATAACTAATATTCCTAGTAAATATATTCCTTTGACTACCCCCACGTTA
> ATGTACACCATGCGGCATTTAAGCGCGATATTATAAGCATTTATCAGTCGATTACTGTTT
> GCTCACTCCGCAGACTTCCGCGTCTTCGTAGCTTCAATTAATGATTAATCTATGAGCTAG
> TCGAATCAACACCAGGTTTATGTATGTTATTTACGTAATACTGTAGAGATCCATTGTATT
> GATCTTTATGCTCTTTACGAACCGCTTTGTAATTACGTTCGTAGCCCGTAGAATTCAGTC
> AACAATATTCTTCTGTTGCCTTTCACCTACTTTCCAGGTGAGCTGCCAGTCATAACCGAA
> TTAAGTCTCTCTGAATAAGTAACGCATTCTATGATGATGAATCGTTCCAACCCGACGAGT
> TTCTACAATATAATACTAATCCTTAACTTAATATTTGTTTAGCTTGTCGTCCTAACTCAA
> TCCGTCTTCAGTATAAATATGGATGCGTATAATTAATACTGGATCTCGAAATGAGTCCTT
> AATAGTCTAAACGTATTGAAGACAGGCCAAGCAGGTAATGACATATACTTTCAGCGGATT
> TAACAAATTCGTTAGTATGCTAGATTACTCCCCGACCAAAATCTAGTGTCCGACGTTACT
> ACGTTATCAGTTTCTACGATGGCATAATGTAGCCAGATTATTTGTATAGTCTTAAATTAT
> ATTTATAGTCAAGTATACCTACAATCTAGGACTTTCTTAATATTCTGGGTAAGTGGGACA
> TAATCACATCAGCAGATATAGTATAAATCAACTCAAAAGAGAAATGCTCGTGATGTTGTA
> CTACCAGCAATAACGAACGATAAATATTGGTTTTTAAGTAGACTACTTTTTGGCGGCCTA
> TATCACTTTCAACGCTTATAACACTTGGCCAATATTGATGATAATTGAATTTGAGATTTT
> GGCACACACGATTGGCACATGGATGACCCTATGTCATTAATTTATCGCGAAGGGGGATAC
> GTTGGCAAACCGGATTACAAATAATTTCATTGTTATAGTATATGTGGTATCATTTTATAC
> TTATTACTACCCATTGCCTAAATTTGGTTCCCACCTAAGTTAGAGCATGATCATGACGGT
> CGTATGACACGAAGTCATCTTATTTGTTATTAGCCGCTAACTGGTAAAGCTCGGGTTATA
> GCGGATGCTTGATCAGTTGTGCAATATAACCTTTTATAAAGTATGGTTAAAGTTACAAAA
> CCTAATTATACTGCTAATTGGAACTATATGAAGCCTGTGAACTTGAAGATATAGCGAAAT
> AAGAAATCAATGCACCGGCGAGTATGCTAACTTGTATGATGTAGCTCAGATAATCGTCAT
> CCGGGGAACTAAAATAAATACGCGGACGTAATATCAGCTTAAATTGGAAAATAGATCAGT
> TCGGTAAACATGATGTTCTGATAAGACACTAGCCTATTTAATTTTGGTCCGATGATAGTA
> GCGATAGTATCCCCAAGGATTTGTAACATGTTATATATGGCAGATAACGCATACATTGTT
> CATGCGCGATCCAGGGAAATCTAAACTTATCAGTATAACGTCAAACTTTGCAATAGTAGA
> CTTTACCTCGTCGGTATATATCGAAGAACGTGCATTACCAGGTCAATACCACTTTCCTCG
> TAGTTAATGGGCCATTATACGATGTACAACCTTAGTAGAAGGTCGGGTCACCTAGGAGAA
> AACATTCCCTATACGTGTAATATATCTATATACGTCGGCACAAAGTGTGGTCTAATGAAC
> TTTTATGTGACGTACCCACCTTCGGTTAACGACTGGAGATGGTGTCCGGTACGAAGTAGA
> ACTGGCGCAACGCCAGACTTTAGGTTGTAAGATATTCATGCCAATTCCAGATATAAGCAG
> GAATGAGTGGCCATTAGAATAATAATTCACAGCATATCGGGTATCGATAACCTTTTGAAT
> TCCTGGGCAGGTTATGGCATAAAAAGAAACAATCTGAAAGATGCGGTCCTACTTGCGAAA
> CAGATTTGTCTTAAGATACGTAATCAAGCCTATTGACTTATCAATATCGGTATACACAGA
> ACACATCTAAAATTACAGAATAAGGTAGATATGTCCATATATTTCAAATACACTGCGTTG
> AGAGGGGGGTCGTGTTCTGACCATCTCTATGTCTGTAGAACCCTGGGGAGCATTTTCACC
> CCCTTTACTTGGTGACATTAGTTCATTCCTTCATTTACAATGAACATCAATACCTGATGA
> CACTAGCCTTGACGTCAATATTCATGGCGGACTACTCTGACACGGCGGATCAGTACACAG
> ACACATCCCAGCTTTTGGTTACTTGGTACATTACTATCGTTATGTGTTTTTAAAAGGAAT
> CCCAAGAGATACCGTTAAAAAGCAGATTTCTCTCTTTCGCCTACATCTCAAAATTGCAAA
> TGTATGAGTAGGTTTCTAGGTGATTTACGGAGGCACCCGAAGTTAGGAGATTCAGTGTTT
> TGATCCTGGACCTCAGCGACTCTTGTTTAAAGAGTTGTAAATCTCCTAGGTTACAATTCC
> CTGCATACGTAGTATTCCCGACCTTAACTAGAGTATGAACGGTCATGAGTGAGGTATTCG
> TGCCTTGAAGAACCTATAAGAAATTCAAATTACGCACGGAACAGTTAAGTCCTGTACAAA
> TGGCAAGGTATGCGTCTTCAACGAGTTAGTATCTAGATACAATTAACTATGAGAAACGAA
> ATACTAATCTGTAAATATCGCTAAACGGGACAGCAAAAACACCTAGAAGTCATGTCCAAA
> TAAGTAACGTATGGATTCCATTAATTCGCCGGCTAAAATAAAGTGTCCTCATGCATCGAT
> CTATATATCAGAACCATACGCATTCATCGAAGTTATGAAGCCTCATCTCTTTGTTGAAGA
> GCTGTTTTATTCCTTTTGGATAACCCATGCTTTTGGCTAACCATGACTGGATATGACACT
> TACGTTGAATTTTCTCATTCGACCGGTAAAACTTGCTCCTGCGTGGATTAAATCAATGCT
> TTAAAACTATATCGCGAGCGTTTTACCGAGAAGTTATCCGATAGACTTGAAAATGTAGGG
> AGGCGTCACCCACTCTTGCCCGTACTATCTCAAAGATAGTATCGAGAAGTCCCCAGCCAT
> GTGCTTTGATTTTTGTTGTATCAAAACGATGTAGGTCAACCTTAACCCGTCCTGATATCT
> CCACCCGCACAGTGGAAGAATCATTTAGAATTGGTGATTGTGAAGTAATATACAACCAAA
> GATATTTATAGACTCGATAAATATCAATGGTTTAAATTACCATTTAGGCTTTAATCGACA
> CAAAAATCATGATTGACGACTGGTTTATAAATTCAGTCAATCGAGAAACTTGCTTCTGAA
> TCCCCTTCATTTATACTGTCTTAACAACTACCGCGCAAGCTGACAATTTTTCAGTGTAAT
> TGATCACTCGCCCTGACCTCATTTATCTGGAATACCAATTAATCTACAAACCCTCTAACG
> TTTTACATGGTTTATCCTAACGGAACAACCACTTACCCCCTAGTCGGATCGGGGTATCAT
> TATCTGTAGCTAATGGATGATAGGTTAAAATGATTCATCACTTAACAGTTTCCCACCCTT
> ACGGTGTTATTTATTGAACCGTCATTTGTTAATAATAATATTAGACTAGAAGAAGTTTTC
> CATCGATTAATTCAAGTATGAGACGGCACTCCAGGGGTTTGAATCAGGCCCGACCTTATG
> AAGATGTCAGGGCGGTTAAACCTAATCTTCCAGCGGAAGTCCGCACTGGCAAAACTCCTT
> AGCTGCTGAAGCTAGACTTTATAGCGTATACCATCCTGAGGAACGCTAAGATCCTATGTA
> TAATGTTCTTATATTGTTTGACCTTATATGCAGTTTTTCATCTGGCAATAGCCCTTATAC
> ATGTCTCAATTCAGGTATCAAGCAATAGATTACTTTTTTCAAAACCATATTTGCGGCATA
> AGCCACATCCACCACCAACTTCTATAGTCGCGTGCAGGGGAGTTCCCGCGGTCTACAAGC
> AGGAATGGTCAAGTTGGTCAAATGTCGTTGCAAACGTAAACTCTTGATACTAATCCTATG
> TAGGCCACATGCAATGTTTCTGGCCATAAGTTCATGGCGTCTGGTAACTCCGGTGATAAT
> TAGGAGATTCACTGCGCCGATATAATTACGAACATAAACTCAGTAAGAGAATTGAACCGT
> AGACCAAAAGGGAGTCTTTAGGAGTAGGCTAATCTATCCATGTGGTTTCACGCAGGGGAA
> TAAAAATACTATTCCCAATAACATAATCCGAATAACAACAAATGTAGACTCAACGAATTT
> TAATGTTAGCGTATGGCTGCTGCAGCAGTGTACGTGTCAGTACACTATTCTGTGTAATCC
> AAAGAGGCGTTACTAAGACGAATTTCTACCTCAGGCGAGTGGATCTATCGAACATATTTT
> CCGCCTAGTTTACAAAACTTCAGCAGAGCTTAAAAGGTCAGCAAGGGTTGGGAACGACAT
> CGTTGGGAGATACCAGTGTTCAGGGATTATCTGTAAAACCAATCTGCTTAGCCTTTTTGA
> AAACCCAAAACAGGTGTGGTTGCAGAATAACACCTGAAATTTATGTTACCACTTTGTACG
> TCCTAAGGGGCTTGAGTATTTTCATGGTTATCTATTTTTACTCATAAAAAATGAATATAA
> TTGGCCAGGTCAGGTCTGGATCAATTTTTATAAAATCATATCATCAAAGCTAGCCATACA
> ATCCAACGAAGCGAGATCTGTTATAGTACTTGTCTATATCTAACTGATATCTTATCCACT
> CTGTGCTAGACTACCATTTAGGTAGAATATGCTATCACAATGCTAGCCAAGATCTCAATG
> ACTCGCTGACGTGATACTCTTGCTGTTTATCTTATTGAATATGAACCCCAAGAAAAAATC
> TATAGCGCATATGTGGACTTATGTTGGCAAAGGACTCCTTCGACCATTATTTAGTGAATA
> TTTACTTATTATCTTCCTCCGTTGAAATGTATTTGACGTATGAATTATAGGAGTAGGCTA
> GTAAATAAGTCACGTTGCAATGATCGATTTGAGAATTCAAAGTTATCAAGTTCTCGTTGT
> CTGTGTGTCTGCCCTTACTGGAGTAAGGGCCAGTCGGAACCCATATCTGGGTCAGGATAG
> TGATTGTTAAAAGTCGGAAATCAACTAGTTTTACTACCTTCTATTACTATGATGGCCCCA
> TGGTGAGCCCGGACCAATGAAGGAATGGCATATATAGCAGGGTACTTTGGGAATTCCGAG
> TAGCACGTACCAACCTGTTTCTAAGATTCTGAGATTTGGTAGTAAAAAAGCTAAAAAGTC
> ATATTGTATCTTGCAGAGGAAGCTTAGAGAACTTGCAGACGCTATAATTCTAGGTTACGC
> TTCACATACGGATTTGCTACGCGGTGCAACTGATATGTATCTTTTTTAAATCGCAACCAC
> ATTTAACCTTTATTATTGGTATATTGCGTGGTATAAAGATATCGCGTGGCGGAATAGATC
> ACTGCTGTGGAGGCCGGCTATGTTTTATTGGGGATTTCCTATCTAACAGGCTATATCCCT
> TTCGTTTCGTAACTTTATCCCAACATCTTATGGGTTATTTAATAGTCCCATCCTAAGTTG
> CCAATAAGTCTGAATTCCACCGTCTTAGTGGTGATGAAAATATTTTTATGTATCATATTG
> TTAAGCCAGTTGCAGGCAACTGATTCTCTCTCGCTCGTTCCTTCGACGACAGTAAAGAGC
> GATTTATAATAATATAGCTTCTAAGTGATTGACACTTCCTATGAGGCTGTCCTGATTATT
> GCTCTCGAATCATTAGGCTCTAACTGAACTCTGAACAAAAATAGGTCAACGTATGTTAAT
> TGCGATTTTTCTACACTCCCTGTATATGACTGTGAAATTGATACATTATGAACGAAATCA
> CAAACGTGTTGGAAAAGTTAGCGCTAAGCTCACGCACGCTTTAGGCAGTTAATGATGGGC
> GTTCGTAGCTCTAACCCTAACGTGTTATGCAAGATCTTCTATGACTGCATCCAGTGTCTG
> CTAAGTCCCGACTATTGTCTACATTTATACTCCTACGCTTGCCTACTAAGCGGCTTTCTA
> ATTACACCTGGACTGATGTGTTTTAAGTGATTGTTGTACTTTTTAACGTGATGTTGCTTA
> GATCTGGAAAATATTTGACAATAAGTGCCTGTTAATGATGCATTCTCTAGCTGGTTAGCC
> ATTCCTTCACTAACTGACCTTAATGTGATTTTAGTGTCATGTCTCTGACTTTAGGTTTTG
> GATTAAATTACTGAATTGTTGACCATGTCGCAAATAAGTCGAACGCATGTAGGCGTGTTC
> CGACTGTGTAATAATCGATTAAATAAATGTAACAAAATGCCCTCTGGCTAGTGTTTGGCG
> CCTGGCATATTTGCATAAACGGCTACAATGCTACTAAAGTTGGGTCGGGTCAATAGAACA
> TGTTAAGTATGTGTATGTGGCCTAATGTGATTGCGACCCTAGCCCTCACTGACTATTTAG
> ATGAATAGAATAAATTTTTACCGGTATACTCAATGTGAGTTATCCAGAGATAAAGACGTT
> TGAGGTATCCCATTGATATCGACATCAACCAAAAGTCACGAGCTCGCAGCAAAATTGCCT
> ATACACAGTCCACACCGCATCCGATCTTCAAAGCTCCGACTCGACACTAAAGGTGACGTA
> GGCTAAATCTATAGTATATTTCGTAGAAGCGTAGGTAATCTTGTATTACTGAATCAACAC
> AATGAGAGTTGCTTACTCGATCTGAAATGCGAGTTTCTACGTAGATGTCGCAATAGAGAG
> CTTACTCTGTGCATTTCTTTTCTCGGCCTCCAGACTCGATAATCGCTTGAATCTAAACCG
> ATCAGGATTGAGTGCACGGCGCAAGGACGTTTAAATAGAGGTAAAATGTTGATTACCATA
> AACCAGATCAATAAAGTTACAGTACCGGCTATAAGAAACATCTTCTCTAAGAATCTAGAT
> GAGGAGGCGAGATCCAGTCAAATTACAATTCGTATCAACAACTAACTTAGATTCATTAGG
> GTGTGCTGTACTCAAAGACAGAAGTATAAGTCGCCACGTTGATTCGCAAGGTATGGTGTA
> AACAGTTCACCTTCAGTGCATTGAGAAATACATGTGTATGCTCGGTTATCATGAGTACTA
> GAGTGGTTTATTCAAGCTGATTCGGTAGACCGGTGATATATTGGTACACTCAGTCTAGAT
> TAAAAGGGGGCATCTAAAATGTTCTCCAAGTGATATCATTCGCTTTCTGTAGTAAACATC
> AACTTCGTAGATTACCTGTCTTTCGGTGGTGTTTTAGCCTGTTAATTGGATGCCGAGAAT
> CCTAGTTGCATATTATTCTGTGCCTGCAAAAAAATAGGCATGCGTACTGCTAAGCCGAAA
> TAGACTACTTTGCAATCAGTAGAATACTGTCCATCGCATTGATTCAAGTGGAAGCAAGAT
> TATACTAGGCGACATAATTCTGGTGCTTATTTAAAAACAACTCATGACAGTATTGAATAG
> AGAAAAGTAAGCATCTGTATAATGAATCTATAATTGATCAGCAATTACTGGTAGCGACTG
> TTGCAATGCAAAGACGACACGATCTCGCTCATAAAGATATGAAAAAATTTCGTCGTATTC
> CGCGGTGAACGCATGTAATTACTCCTAATAGTGAAAGTACTCGGTAAACCAGTTCTTGGT
> TATCATCTAAGTCCTTAGACCGATCACGACGTCACAGCGTTCGAACCCTAGGGTACAGAC
> TTGCCTACTAGATAAACTCGCCATGATTCTTGCAGTTAGGTCATCTAATTCTCAGACTCA
> ACATCTTATAAAGCGCGGTTGAGAATGCGGGACATGTTGCGTGGTTTCTTGTGTATTTCA
> AATATGTCATAGGGGGAGTGATTCCGATTTAATCGTTTTGCTTGTTAGGGGATCTGAGTC
> TGTAATCGTATCTCTGCGGACTAGAGGCGTATTTCCGTCATTACTTCTGCGACCGATACC
> CTCATCAGTTAATATTGCTCCTAATGCCGACAATTAAGACAGTCCATTTTAATATGACTG
> GTTAATGCGCGGGCGCGTTCTAAACGCTAGCTGCAGAGCATACTGCCACCATCTCGCGCT
> CTCAGAGGTAGTTCTATGGGGTGCTGCGCTGTGGTAAACTCCACACAGCCACTTGCGTTG
> TAGAGTCGTAGAAGAAAGGCCAAGCGAAAATGCGCTCTTAAGGGACGCTCAACGCTGGAA
> TAATTATTATATCGTTTCCGAATAACGGTGGACCCTATATGTGGGGATATGAGTTTTCAA
> AGAGGCGAATTCTTAATTGCATGGAACTTCTCGATTCTGACAATATGTATTCTGACGTAA
> AGAAAGCACGTGCGTCCTAAGGGATCCACAGGTATTCCGATTCATGTATCAATATGAGGA
> ATTCAGAATAGAACACCTACAAAGTGACAGTAGCAAATAAATGTTTTGGTCCCTATGATT
> CTAAATGATGGAGTCCAACTTTATGAGTTTTGTTGAGCAGTATAACGAGAGCGCTTGCGT
> ATTAAGACTTGACATGAAGCATGTAGGTACTACTCTATTGTCAGTTTAGACAGATTAGTC
> ACGTACCTTCCTTTTTTTCTTTATCCTAAATGTACTTACCAAGGCTTGAAGGTCCCGTTT
> TTCGATCGGAAAACACCTAGTGACTTATAGTAAAGCTCGTACCTATAGTTTATCCTAATT
> AGTTTTAATATTAATGCTAATTAGACACGTACAATCAGAAGTGCAGACCCTTTCATAGGT
> AAGACAGAAGTTCTGAGTTTGTGGTGTGTGTGCTAGGATCGGCAATAACATGTTGGTCCT
> AATTGTATGGAGGGACTGTATCTATTTTAGTCTGCTTTGTTTTTGTAAAAATGTTGGGGA
> ATTCTCTCTAGTATACATAGGTCTCTATCGCAACGAGTTGTTATTGATTAGCTTAACCTC
> AGTCCCGTGGTTTCGCTCACCCGGCGAATCGAACGTATGGGAATAGCGGTAGAGGAATGA
> AACATATCTTGAAAAAATCAATAATGTCTTGAGTGTTAGTAGCTCATACTGCTAAGCTTG
> TGATGTCCAATATAGAGACCTTAACGAATGGCCGATATGTGTCTCCCGCCGTCCAAAATA
> TTCGTTCACGCAACTCTTACGTATGTGCCGCCATGATTCCCATCAAAATATCAGGCTAAT
> CTACGGAGAAGTCCGTTATTTCTCTTTATCCCTTCTGGTTTGGAAATCGACTTTCCCATA
> CATATTTTGATGCTCTGCGTAGCTAAACTTGATGAAGCGATCTCCTGCTATCCATTTGAA
> CATGAGAAACGTCTCCAGAAACCATTAGGTATCAAGAGGAGACCGTAATTTATTCAGACG
> ATCATAGCTCAGGAACAGATGTATGTCGGTTAATTAATCGCGTAAAGTCACAATGGGCCA
> AATGGTATCTCCTACCATCTGAAGTATGCACGGGGCACTATTTCGCAGATATAATTTAAG
> TCTCGCTGCAACGAAAAGAAGGAGTCTGAAGATCAAGTTTACTAACACGAATTAACGCAG
> ACGAGATTTCCTGGTTACCGGAACAATTTTCTGGTCTGAAAATCGTTCCGGGAAGCACCA
> CGTTTACACCCAAAGTATACCTGTGTCGCTACCCTTAACAAGTATTATATTTACCGTCGA
> CAAATCCTTTCCGTTTTTTAGTCCTGAGGTTTCGTATTCGGTAATTCTCTCCGTGATCGT
> TGATACAGTAAAGGTCGACTTAGATATAGTTGACAACTATTGTCACTAAGAGGGCTTCTG
> TGATTTGCCATCGCTATTAGCAGAATAGAGTTGACGCAATAGTAGATCAATATTTTCGGT
> GCCTGTTCCAAGCAAGTAGCGTACGACGCTACCGTCTAATCGCTTAAGAAATTTAGCAGC
> CCTGTTAAAACTCAAGGCCTCCGCAGTCTAAAAAAATTCATCGATAAAGATGTAATTATA
> AAGTAGGTTCATGCGCTAGAGGAGCGCCATCATGGGCTAGTTGTCCAAACTAAGAGATCG
> TATGTAACAGGAAAGAGTAATTGGACTCTACACCTTTTACTGCAAATCGATAGTCGATAT
> TTTACCAATTCGAAGTATCAAAAGGTAGTTAACGTATATGCCCATGAGACTGCATATTGT
> ACAGAGCACTTATACCGGACTTAATTTAAATGGACTAAAATAAACCAATTATAGCTTTCT
> TGGATTCAATCTTCACTTGGCTCATAGTGCCGTATCGCGGTTCAGATGATTATAGAAGAT
> AGAGGATGGATTTGATACAATAAATCGCAGATTTTGAACTGTTTATGAGATCGACAAGTT
> AAACTTATCTAAGAGCTAGAGTTATGCGCGATCGTAAAGTGTTATCCGGAGTCGGTAGAA
> TCTCATCCCATGCCTTGTAGAGTTCGGGATCGCTTACCTTCACCCAATCTAATTTACAGA
> CACTAAGTGTGACTAGTCTGATTTTCACCGAACCGAATATCACAGATTTAAACCTTTAGT
> ACCTTATACATACTTCTATGGTACATAAACCCCTGTGGAATTCGACATATCCCATACCGT
> TTTGAACATATGTTTTTAAAAATTGCTTATAAACAATAGTCTACATCCGCGACGTTTGTC
> GAAAACACTAAGTCACTCAGCCATTAAATTTTAGTTATCTGTTTAACGAATGGTAAGCTC
> TAGCGTCAGAACATCAACTCGTTTATACGACTGTATACACGTGCAATGTACTTGGATACG
> CTCTTGAGGACTATATTTCAAGGTTTACTTTCATAGCAGTAGTTCTAATGCACGTACTGT
> GGTAATTGAAAAAGGATTTAATTATCCGAAGACGTTTGGTCTAAAAGTACGAGGATGGTA
> CGATTTTCATATTTATATATTGACTCCTGCCGATATGTAGAATATTTGAAGCTCGTGTTT
> AGATTAAGCTGGCGTTCGCTGAGAATTGTAGAAATTTTGGCTATTCAATCCTTTGTAATT
> GGAAAGACTCTAACATAAACTAAGGCTAGTAAGGAAGTACTAAAAAAAACGGTGCATTAT
> AGAAGTCCTGGCAAACGCTTCCTAGCTTATATTTGAAACGTTAAAACGCGTGGCATGATT
> GGTTCATAGGAAGTCTCGCTACCTACTGTGAATGTTAATAAAGCCTACGGCCAAAAAAGT
> CCCAAGCTGCACCTTATTAATGAAATCGTTGCACAGAGTATCCCGTGTATTTTTCTCTAA
> GAACAAGTTAGCGTCTGATCATAAATCTACATTTTGAGTGCGATGGGAGGGTGTTGTGAC
> ACAGGAAATACAGCCGTTATAGGGACTGTACACGCGCTGTCGAGAACTCCTTTTTTGATA
> AGTTGGGGTCTTATTGCTCAATCATGATTTTCTACCTTTTATAGAGCGTTATCAAAATTC
> TACCTTGAATAGTCTAAAGGACACTACTTCGCTCCCCTGCCGTTATAGGACACACTCTCA
> CGCACCGTGGACCTGAAATAAGCGTAACTATCAGGTCACAAAAAACACATCCTTACATTC
> TAGGCAGAAAACAAATAACAGTCACAAAAAATTTGAATAAATAATATTCCTTGTTATGTT
> ATTCCGTGCACTACCACCAACTTTATCGACACAAGCCGCATTTGTACCGAGAGTTGTTTA
> GCTTTTTTCAGTAGTGTTCTCGTTGCGAACTACGCACACGGACGCGGAGTAGTTGCTTCA
> AGGATGGAGTTATAGTTGACCTACGAGATTCTTCACCACCTTTATGTTTGTTAGGGACGG
> ATGACGGTAGACATACATGCTTTTCATCTTGTTGCGATGTAACTAACCCTTTGTATTTAC
> GTTCGGAGCCCGTTGATTTATGTAAACTATTTGCGTAGGTGCACTGGCAACTAATTTCCA
> GCTGTCCGCCCAGTATTATCAGAATTTACGCGCTATCAAGAACTATACCATGCTAGCTTG
> AGGTTTCGTTCATTCCCGAAGACGGTCTAATAGTTAAGACTTATCAGGAACGTTATTTTT
> GGTGAGATGCTCCTCCTTAAGAATGCCCGATTAACGAGAAATATGGAGCCGTTTTTTTTA
> TTATGCATCTCCATATGTGTCATTTATTCGATTATAGGTTTGTACACAGCACAAGAACGT
> ATTGAAATTTAATGGAAGCGCAGTTAACTTATGAGTTAGTTTGATAGAGTACTCACAGAC
> CAATATAGAGTGTCCGAACTGTATAAGTGATAAGTTGATAACTGCCCAGTATCGTGACAG
> TTTATTTCGATTCGCTTAATTTATTTGGATAGTAAACTATAACTAATATATTCGTCTTTA
> TTAATTGTATGGGTAAGGCCGTCAGAATCTAATCAGAACATTTAGTATAAATCTACTATA
> AACAGAAATCCTACGGATGTTCTAATTAAACCTATTACGTTCGAGATTTATGCGTTTGTA
> ACTACAAGACTTTTGCGCGGCCTTTATAAATTTCAAACCGTAGAACACTGGCCAAATATT
> GAGCATAATGCTAGTTGAGTTTGTGGCTCAATCCAGTGCAAAATGCATCACACTATGTCA
> TTAAGTTTTCGCCAAGCGGGATTCCGGCCCAAACCCGATTACAATTATTTTCATGCTTAT
> TGTATTGCTGGGTTAATTTGATACGTATTTCTACCCTGTCACTAAATTTGGTTAACAAAT
> AAGTTTCACCTGGTTAAGCTCCGGAGTATGACACGTAGTAATATTAGTTCTGTTTAGACC
> CTAAAGGCTAAAGATCCGGGTAGTCACGATGAGGCATCACTGGTGATAGATAAACTTTTT
> TAAAGTTTGGTTAAACGGACATTACATAATTAGACTGCGAAGTGCTACGTTATCAAGCAT
> GGGTAATGCATGTTAGACCGAATTTAGATATATATGAAAACGACACTATCCTAACGTGTT
> TGATCTACAGCAGTTAATCCGCTTCCGGCGTAATAAAAGAAATTCGAGCTAGTTTGATAA
> CCGTTTATGCCATTATAGAGCACTTAGCTTAACTTCATGGTATGTGAACAAAATAGCATA
> TGTAATTTGGGGAACAGCAGACTTCACAGTGTATCACCTAGGAGTTGTTAATTGTTATTT
> ATCGAAGATAAACATTAAATTCTTATTCAGACATACAGCGATAGCTAAACTTATCAGTAG
> AACCTCAAAATTTCAAATACTACTCTGGAACGCGTCCGTATAGATACAAGTACCTGAATG
> AACTGGTCATGACAAATTGACTCCTTGTTAATCGGACATTATTCGTTGTACTAAAGTTGG
> AGAAGGTAGCCTAACATTGGACATTACAGGCCAGTTACCTCTATGAGAGCGATTTACCGC
> GCCACTAAGTGGGCGAGAATGATCGTTTATGGGACGGAACCACATTCCGTTATCCTCTGC
> ACATGGTGGACGCTTCGAAGTACAAATGGCCCAACCACACAAGGGAGGGTGTTAGATTTT
> ATTGCAATGTCCTCTGATAAGAACGTATGACTGCACTTGACAATAAGAATTCAAAGAAGA
> TCGCCTTTCCTTAACATTTTCTATTCCGGGGCTGGTTATGGCTTTATTTCTTACAATCTC
> AATGATGCCCGCCTACTTGACAAACACATTTGTCGTAACTTTAGTTTTCTAGCCTTTTCA
> ATTTTAAATTTACCTTTTCTAAGAAAACAGCTAAAATTAATGAATAACCTTCATAGCGAC
> ATTTATGTCTTTTAAACGCAGGTGTGAGGGCGGTACTGTTATCACATTAGCGTGCGATGG
> ACAAAAAGGGCCAGCAGTTGCAACCCAGTGAATGGGTGACATGTCTTATTTAAGTCAGTT
> ACAATCAACTTCTTTAAAGGAGGACAATACACTGGACCTCAATATTAAGGCCGGAATACG
> CTGTAAAGGACCATCTGTTCTATGTCAAATAACAGATGTTGGTTACGGCCTAAATTAATA
> TCCGTTTCTGTGTTTTATAGCAATCAAAAGACATACAGTGTTATAGCTCATTTATCTCGG
> TCGCCTTCATCGAAAAATTGCAAAGGTATCTCTACCTGGATTCGTGTTTGAAGGACCCAA
> CCCATGTTTCGACATGCACTGTTTTGATAATGCACAGCAGCGAATCTTGTGGATTGAGTG
> GTAAATCTCCTACGGGTCATTTCCATCAATACGTACTATTAAACAACTTTAATAGTCTAT
> CTACCCTCTTCACGGAGGTATGAGTGCCTTGAACTTACTATATGAAATTCATATTACGCA
> ACGAAAAGGGAAGTAAGGTACAAAGCGCTTCCTAGCCGGCTGCAACGAGTGAGTATCTAG
> AGTCTTGTAAATTTGACTATAGAATTTCTATGATGTAAATATCGATTAACCGCAAACCTT
> TAAAACCTACATGTATGGTCCTTATAACGAACGTAGGGATGCCATGTTGGAGAAGGCGAA
> AATTAACTCGCCGAATCATTCCTTCTATATTTATGTTACAGACGCATTCATCGAAGTTAG
> GATGAATCATATCTTGGTTGAAGAGCGCTTTGAGGCATGTGGCAGAACACATGCTTGTGC
> CTAAACTTCACTGGATATGAAAATTAACTTCAATGGTCTCTTTCGAACCGGATTACGGGC
> TACTCCGTGGAGGAAATAAAGGCTTTAATTCTTTAGCGCGAGCGTTGGAACCACTTGGTT
> TAAGATACACTTGAATATGGAGGCAGGCCGCACCCACTCGGGCCACTTATTTCTCTATGA
> GTGTAGCCAGAACTCCCAACAAATGTGCTTTCATTTTTCTTGTAGCAAATAGATGTAGCT
> CAACCGGATCCCGGCCTCATAGCTCAAACAGCTCAGTCGAACAAGCAGTTACAAGTCGTG
> ATTGGGAAGTTATATAAAACATATGAGAGTTATTGACGACATAAAGATATATGGTTTAAA
> TTACCAGGTTCGAGTTTTTCGACAAAAAATTCATGATGGAAGACTCGTGTATTTTTTATC
> TCATTAGACTAAAGTGCTTATGTAGCCCATGCATTGATTCTCTAGTATATTCTTCCGAGA
> AACCGGTAAAGTTGTAAGGGTAAGTCTTCACTACCAATCACATCATTTAGCTCCAAGACC
> TATTATTCTACATACAATATAACGTTTTACTTCGTTGATCATTACGGTACATCAAATTTC
> AAACTACTAGGATACGGCGATCAGTTTAGGTAGATAATGGTTCTTAGCGGAATATCTTTA
> ATCAATTAAATGGTTAAAACCATGAAGCGGGTATGTATTGATCACTATTTTGTGATTTAG
> TATAGTTGACTACTAGATGGTTTACATCGTTTAATGCAAGTATGACAACCCAATCCACGC
> GGTTGAATAAGCCCCCACCGTATCAAGAGGGAAGGGACCGTATAACGATTCTTCCAGCGC
> AAGTCACCACTGGCAAAACGAATTAGCTGATGAAGCTACTATTGTGACCGGATAACATCA
> TGACGATCGCTATCATCATATCTATAATGTTCTTAGAGTGTTGCTAATTATATGCTCTTT
> GGCTGCTGCCATTACACCTGATTCATCTATCTTTTCAGGGTTCTTCAAAGTCATGACTTT
> TTTAATAACCATAGGTGCGGCAGAAGCATATTCATAAAAAATAGTCGATTGTAGACGCAA
> GGGGACTTACCCAGCTATTATTCCTCCAATCCTAATGTTGGGATAATGTAGTTGAAAACC
> TAAACTATTGAGACTTAGAATATGTAGCCAAAATGCTATGTTGATGCAAATTTGTTCTTG
> GAGGATGGTAAATCCGCGGAGTTTTTGGTCTGTATCTGACCACAGAGAATTAACATCAGA
> AAAGAAGTAACTGATTTGTTCCGGACACCAAAAGGCTGTCTTTTCGAGTTGGATATTCGA
> GCAAGGGGGTTGAACGCAGCGGAAGTTTATGACTTGGCCAATTATCAGATTCCGTAGAAC
> AACTATTGGTGTATCATAGAAGTGGTAGCTTAGAGGAGGCATGATGAACAACTCTACCGC
> GAAGTTAACTATGCGGTGTATTAAATTCAGGCCTGAATAACAAGAATTTAGACATATCCA
> CTGTGCTTCTTTCCAAATTAGTTGCCGCCTAGTTTAAAATACTGAACAACTGCTTTAAAC
> GTCACAAAGGGTGGGGTACGTAAGAGGGGCGTCAGACAACTGGTATCGGATTATCTGTAT
> ATACAATATCCTGAGACTGTTTGAAAACCATAATAACGTGTGGTTCAACAATATCAACTC
> AAAGTGATGGGACCACTTTCTACGTCCGATCGGCCTTCAGGTTGTTCATCCTTATCTATT
> TTGACTAATAATTATTGAATTGATTTGGAAACGTATCCTATGGATAAAGTTTTATTAAAG
> CAGATCATATATGCTTCACATTCATTCAAAAGTTCAGTGAGATCTTATACGACTTCTATT
> TTTCTAAATCTTATCGGATACACGCTCTCATAGACGACATGTGAGCTACAATTTGATTTC
> ACAATGATAGACATGATCGCAAGCACTCCCTGTCGTCAGACTCTTCCTGTTTATATGATG
> GAAGATGTACCCAAACATTAATGCGTTAGACCATAGCTGCAATGATGTTCCCATACCAAG
> AATTCGAACATGTTTTACTGAATTGTTTCTTAGGTTCTTAATCCGTGCTATGGGATTGCA
> AGTATGATTTTTAGCACTAGGATAGGAAAGAAGTAACCTGCAAATGATCGAGTTGAGAAT
> GCTATGTTAGAATGTTCTCCGTGTATGTGGCTCGGACCTGACTGGTGTATGGCACTCGAG
> GAACCCTTAGAGGCGTAAGGTTACTCATTGTTAAAAGTCCCATTTAATCTACTTTTAAGA
> AATTCTTTGAATAGGATGGCACCATCGGCAGACAGGAAAAATGTAGGAATGCATTAGATA
> GATCCGTTCTTTGGGAATTCCGACTAGAAACTTCCAACATGTTTATAACTTGCTGAGATG
> TGCGTCGTAAATAGCTTTAAAGGAAGTTTGTTTCTTGCAGAGGAACAGGACAGAACTTCA
> AGTCCAGAGAATTATAGCTTACGATTCACTTTCGCATGTGCTACGCCGGCCAACTCTTAT
> CTATCTTTTTTTTAGACAATCAACATTTAAACTTTAGTTTGCCTATAGTGAGTGGGTGTA
> AGATATAGCCTCCAGGAAGACATAACTCCTGGGGAGGCAGCATTTGTGTTATTGCGGATG
> TCCTATATTACTGCCTTGAGAAAGTTCGTTTAGGTACGGTATCCAATAATCGTTTCGGTG
> ATGTTAGAGTAAAATCCTAAGTTCCCAAGATGTCTCAATTAAACCCTCTTACTGCTGTGG
> AATTTATTTGTATGTATCAGAGGCTGAAGAATGGTGCAGCAAACTGATTATATAGAGCGC
> GTTACTGCCTCCAAACTTAAGAGAGAGTTATAATTATAGAGAGTATTAGGGATTGAAAAG
> TCCTATCACGCTGTCCTGAGTATTCCTATCGATGATGTTGGCGCGAACTCTACTAGCATC
> TAATATAGCTCATCCTATCTTATTGGCGATTTTGATAAAAGACATGTATATGAATGTGAA
> ATTGATAAAGTAGGAACGAAATCACAATACGCTGCCAATACTTTCCGCTATCCTAAAGAT
> CCATGGAGGCAGGTAATGATGCGCGTGCGTACCTCGTTAAAGATAGTGTTATGATTGATC
> TTCTTTCTCTGAAGAAAGGGTATGCTTTCTCACCAAGATTGGCGAAATTGATACTCCGAA
> GATTGAATACTAACACCCTGTCTATTTTCACCGCGTCTCATGTGTTTGTAGGGATTCTTC
> TACGTTGGTTAGGGATCTTGCGTACTTCTGCAAATGATTTGACAATAAGGCCATCTTAAG
> GATGCTGTCTCGAGAGCGTTACCCTTTAATGAAAGTACTCAACGGTTGCGCTGTGTAGGG
> TCATCTCTCTCAATGTACGTTTTCCTGTATATTAATCTATTGTTCACATGCTAGCATATA
> ACTCGTAAGCATGTAGGAGTCTGAAGAAGCTGTAATAAGCCTGTAAAGAAATCTTACAAA
> ATGAACTATGGATACTCTTGGGCCCCTCGATTATTTCAATAAAACGCGAAAATCCGTCTA
> ATGTTGCGTAGCCTCAAGACAAATTGTGAAGTATCTCTAGCTGGAAGATTGTGATTGACA
> AAATTGCCCTCACTGAATATTTTCTTGTAGTCTTTAAAGGTTTACCGGTTTAATCAATGT
> GAGTTTGAAACAGATAAAGTACTTTCAGCTATACATTGCATATCCTATGCATCAAAAACT
> AAAGTGCTCGAACCAATATGGCCGATACTCACTCATCTAAGAATCCCATCTGCAAACAGA
> CGACTAGACAATTAACCTGAAGTTGGCGTTATCTATAGTTTAGTTCGGACTAGAGGTCGG
> TATATTCTATTAAGGAATCTAATCTAGCTGACGTCCTGACTCGAGCTCAAATGCGACGGT
> ATACCTACATGTCGAAATACACTGCGGTATCGGGGCATGTATTGGATACGCCTAAAGACG
> ACATAAGCGATTGATTATTATCCGATCACGTTTCTGTGCACCGAGCATGGAACTGTATAT
> ACAGCTATAATCTTCTTGACCTGAAACCTGTGAAATTATGGTAAAGTACAGCCGATAACA
> AACTGATTATCTAAGAATCTACATCACCAGGCGTCTTAAAGTAAAATTACAAGGCGTTGA
> ATATACGAAAGTTGATGAAGTTCGCTGGGCTCGTCGCAAACACACAACTAGATGTCGCAA
> CCTTGATGAGCTACGTTGGCGGTAATAAGTTCACCGTAAGTGCATTGAGAAAGACTTGTG
> TTTCATCGGTTATCATCTGGACTACTCTGGGGTATTCAACATGATTACGGAGAAAGCGGA
> TTTATTGGTAAACGATGTCTAGAGGATTACGGGCCTTATAATTGGTTATCCATGGGAGTT
> CTGTCGCTGTCGCTTCGTTAAAGATACGGACTACATGTCCTCGCGTGAGCTCGTGGTTGA
> GCCTGTTAATGGGATCCCGACAATACTAGTGCCATTTGAGGATGTGACTGAAAAAAAATA
> GGCATCACGACGGATTTGCCCTATTAGAAGAATTTCCTATAAGTTCAATACTGTCCATAG
> CATTGATGCTAGGGGATGAAACTGTATACTAGCCGTCATAAGTATGCGGCTTTTGTATAA
> AAAACTATTCAATCTTTTGAATAGACAAAAGTAACAATCGGTTGTATCATGCTATAAGTC
> AGCACATTTTACGCCTTGAGAATGTTCAAAGCAATAGACGACTCGTTCTCCCGAAGATAG
> ATATCATTATATTTAGTACTATTCCCCGGTGTTACCTTGTATTTACTACTAATAGTGAAA
> GTACGACGTAAACCACTTCGTCCGGTTAATATTTGTCCTGAGTACCATCTCGTCCTCACT
> CCCTGCCTACACGACGGTAATCACTTGAATAATAGATTTACTACCCATGATTCTGCCTCT
> TTGGTAATCTTATTATAAGACTAATCATCTTTTATACAGCGGTTGAGAATGACCCAATGC
> TTCCGTGGTGTAGTCTGTATTTCTAATATGTAAGAGCGGCAGTCATTCCGAGTTTATACG
> TGTGCGTGTTAGGCGAGATGAGTCGCTAATAGTATATCTGAGCACGACAGCCGTATTTCA
> CGCATGACGGATGAGAACGTTTAACTAATAACGGTATATTGCGACGTATCAAGAAAATTT
> ACTCAGGACATGTTATGATCTATCGTTTAGCACACGCAGAGTGATTTAAGAGTGCTCCAG
> TCCATAATGACACATGCTCCACAGCGCTCTCCTACGTATTGGGCGTCCTGAGCTCTGGTT
> TACTAAACAAAGACTATTCCGTTGTTGAGTAGTAGAAGAAACCCCATCCGAAATTGCGCT
> AGGAAGGCTCGATATACCAGCCTATAAGTTTTATATCGGTTACGTATAAAGGTCGACCAT
> ATAGGTCCGGAGTGGAGTTTTCAATCAGCCGTATTAGTTAGTGAATCCAACTTATCGATT
> CTGAAATTTTCGTTGCTCAACTTATGAAAGAAAGTCAGTCCGAAGCCTTAAACACGGAGT
> ACGTGTCATGTATCAAGAGCAGGAATTAACAATAGAACACCTTCAAACTCACAGTACATA
> TTAAATGTTGGGGGCCCTATGAGTCTAATTCTTGGACTCCAACGTTATGAGTGTTCTTCT
> GCTGTATATCCTCAGAGATTGCGTATTTAGACTTCAAAGCAAGATGGGAGGGACTAAGCT
> AGTGTAACTGGAGACTCATTTGTAAAGTTACTTCCTTTGTGTCTTTATCATTATTGTAAT
> TACATAGGCTGGTACGTACCCTTGTGAGTTAGGAAAACACATAGGGAATGATAGTAAAGC
> TAGTACCGAGTCTTGATCCTTATTACGGGTTAGAGTAATCCTTAGTAGACAACTAAAATC
> TCAACTGCAGTAAATTTAATACGGAAGACACTAGTGCTCACTTTCGGGTGTGGGTGCTAG
> GATCGCCTAGATCAGGGTGCGAATAAGTGTAGGGTCGCTATGTATATATTTGAGTCTCAT
> TTCTTTTTGTAAATATCGTCGGGATTTATAGCTACTATACATACGTCTAGTTAGCAAAGT
> GTTCGTATGCTTTAGCTGAACATATGTCCCCTGGTTTAGATAAACCGCACATGCGAACGG
> ATCCGAATTCCCGTAGAGGAATCAAACATAGATTCTTAAAAGCAATTATGTCGTGAGGGG
> GTGTAGAGAAGACTGCTAAGCTTCTGATCTAAAATATAGAGTCCGTAAAGTATGCACCAT
> ATGTCTCTCACCCCGTCAAATTGATGACTTCAAGCAAATAGTACGTAGGTCAACCAATCT
> TTCCATTCAATAGTTCAGCAGAATAGAACCAGAAGGACCTTTTTTCTATTTATAACGTCT
> CGTTTCGAAATACACTGTCACATACTTAGTGGGATGCTCTGCCTTCCTAAACTTCATCAT
> GCGTTAGACTCCTATCCATTGGAACATCTCAAACGGCTAAAGATTAATGTAGCGTTCAAC
> AGGACACCCTAAGGTAGTATGACGATAATAGATAAGCATCACATGTAGGTAGCTTATTTT
> ATCCAGGTATGGCACAATCGGCAATTGCCTAGATAATACAATCTGAAGTAGGAACCCCGA
> TCTATTTCCCACTGAGTAGTGTACTCTCGATGCAACCATAAGAAGGAGGCTGAACATCAA
> CTTTACTTTATCGTTTTATAGAAGTCGAGATGGACTGGTTAACGGATCAATTTTCGCGGC
> TGAAATTCGTTAACGCAACCACAACCGGTAAAACAAATCTATACATGGCGCGCTACCAGT
> AACTAGTTTTATAGTTACAGTCGTAATATCCGGGCCCTTTTTTTCTACGCTGCTTTCCTA
> GGCCGTAATGATCTCAGTCATAGTGGATTATGTAAAGCTACACTTACATATAGTGGACAA
> ATAGTGGCACTATGAGGCATTCTCTGTTTTCACTTACCTAGTTCAAGTTTACTGTTGTCG
> AAATAGTAGATCAAGTTTTTCGGGGAATGGTAAAAGCAACTAGACTACCAACATAAACTA
> GTATCGATTTACAATGTTTGCACAACTGTGATATCTCTACCCCGAACAAGTCTATAATAT
> GTAATCGTTTAAGATGGAAGGATTTACGAGCTTCAGGCGATAGACGACCCCAAGATTGGG
> ATTGTTGTCCAAAATTAGAGTGAGTATCTAACAGCTATCTGTAATTCGACTAGTAACCGG
> GTAATGCAAAGCGATTGTCGATTTTGTACATTGGAGATCGTTAATATGGGACTTAACCTA
> TAGCCCAATCACAAGGCTTATTGTAAAGAGCACGTAGTCCGCACTTAATTGTTTTGCACT
> AAAATAAACCTATTATTCCTTGCTTCGTTTAAATCGTCACTTGGAGCATAGTGACGTATA
> GCCGTTCTGAGCAGTATAGAAGATAGTGCATGCAGGTGAGACATTAAATAGCAGATTTTC
> AAAGGGTTATGTGTTCGAAAACTGAAAATTATATTAGACCTACAGTTATGAGACAGACGA
> TAGGGTTAGCACGAGGCGGTTGAATCGCATCCCTTGCATGGTTCACTTACGCATAGATTA
> ACTGCAAAAAATCTAATTGAAAGTCTCTAAGGCGGTAGAGGAGCATTTTCAAAGTACAGA
> ATATAACTCTGGTAAAAAGTTTGTTCATTATACTTACGTAGATCCTTATTAAAAACCTGT
> GCAATTACAAATATCAATGAACCTGTTGAACATATGTTTTTAATTATGGCTTATAAACAA
> TTGTCTTAATAAGCGAAGTTGCTAGTAAACACGTACGCACTCACCCTTTAATTTTTACTT
> ATATGTTTAAAGATGGGTTTGCTCTAGCGTCTGTAAATCAAATCGTGGTTACGACGGTAG
> ACTCGTGCTTGGGAATTGGATAAGCTATGCAGCTCTATATTTCAAGCTTTAATTTAATAC
> CACGAGGTAGTAGGATAGGTATCTGCTATTGGAAAATGGAGGGATTTATCCGTACAAGGT
> TCGGCTAAAACTACCACGAGGGTTCGATTTTCATATGGAGTGTTTGTATAAGCCACATTT
> GTTGTATTTGTCAACATCCTGGGGACTTTATGCTCCCCGTAGCTGAGAATTCTTCTAAGT
> TTGCAGATGAAAGAATTTCTATGGGGTAAGACTCTAACAGTATATAACGAGAGTATGCAA
> GGACTTATAAAAAACCTGATTTATTCAAGTACTGGCATAACATTCATAGATTATATTTGA
> TTAGTTTAAACGCGTGCCATGAGTGGTGCTGTGGAACGCGAGATACATAAGGGCTAGCTG
> AATATTGCATTAGGCCTAAAAAGGCAAAACCGGCTAATTATTATTCTAAGAGTTGCACTG
> ACTAGAACCTCTTTGGTTATATATCTAATACTTAGCGTAGGATCATAAATCTACTTGGGG
> AGTGAGTGCGCTCGGTGGTGTCACTATCGTAATACACCCCTTAGTGGCTCTGTACTCGCG
> ATCTCCTGAAAGCCTTGTGTCATTACTTCGCGTATGAGTCATAAAGCTTGATGTTATACA
> GTTGATACTCCGGTATCAAATTTATACCTTGTTTACTAGTAACCAAACGTATTAGATCCC
> ATCCCGTTATAGGACTCAATAGAAACCACAGGCGACCGCATATTAGCGTAACTAGAAGGT
> CAAAAAAAACAAATCATTAATTTCGAGCCTGAAAAAAAATAAAAGGCAAAATTAATTTCA
> AGTAAGATTATGACTTCTTATGTTTGTACGGGCACTTAAAACAACGGTAGCGTCACATGC
> ACCATTGGTACCCACTGTGGTTTACATTGTTTATCTACTGGTCTCGTTCAGAAATAACAA
> CAAGGAACCGGAGTAGGTCAGGAAAGGATGCAGTTATAGTTCACAGTCGACATTATTAAA
> AACCTTTATGTTTCTTAGGGAAGGATGACGGTTCACTTACATGCTTTGCTTATGGTTCCG
> ATGTTACTTAACATTTCTTTTTAAGGGAGGACCACCTTCTTTTATCGAATCTAGTGGAGT
> AGGTGCAATGGAAAATAATTGAATCCTCTCCGCAAACTATTATCACATTTTACGAGAGAG
> CAAGTTCTTTACAATGCGAGCTTGAGCTTTCGTGAATTACAGTACTCGGTCTAATAGTGT
> TGTAGTTTAAGGTACGTTATTGTGCGGGTGATGCTCCTAAGTAAGAATGCACGATGATCG
> TGTTATAGCGAGCAGTTTTTTTTATTATGCATCTACTTATCTGTAATTTTGTCGATTTTA
> CGTTTCTTCAAAGCAAATGATCGTTTGCAAATTTAATGGAACAGCAGTGAAATTATGAGG
> GTGGTTCATTGAGTAATAAAACAACATTTGAGACTCTCCCAACTGTATTACTGAGATGTG
> GAGTACTGCCAAGTTTCGTCAAACTTTTGGGCGATTCGAGGTATGTTGTGGGTTTCTAAT
> CGTGTAATAATATATTCCTCTTTATGATTTGGAGCCCTATCGCCCTCAGAAGCTAATATC
> ATCTTTTAGTTTAAATATAATATAAACTCAATTCCTACGCTTGTTCTTAGTAAACCTTTT
> ACGTTACAGATTGATGCGTGTGTATCGACAAGTCTGGTGCCACCAAGTTTTAAAGTTATA
> ACAGTAGATAAATGGCAAAATATTCAGCTTAAGGCTAGTGCTCTTGGTCCCTAAATACTG
> GCCAAAAGCCAGCTAAAGTTCTCATGAAGTTTGACACTACCGGCATTACGGCCCTTAAAC
> CAGGACAATGATTTGATTGCGTTTTCTAGTGCGCCGTGATTTTGAGACGTATTTAGAACA
> TGTCAATAAATGTCGTGAACAAAGTACGTTCACCTGGTTATGCTCCCGACTATCAATAGT
> TCGATTATGTGTGCGGTTGTCAACATTTAGCCTTAACATACGCGTAGTCACCATCAGGCA
> TATCTGCTCATAGATTAAATTTTTGAATCTTTGCGTTTTCGGACATTTAAGATTGAGAAT
> CCGAAGTCCTAAGTTTGCAAGAATCGCTAAGGCTTCTTTGTCACATTGTACATATATAGC
> AAAACGACACTATCATATAGTGTTGCATCGACAGCAGTTATTACGATGCACCCGTTAGTA
> TAGTAATTAGACCTACTTTGATAACCGTTTAGGCCATTTTAGAGCACTTAGCTTAACTTC
> TGGGGATCTGTACTAAATTGAATATGTTTTTGGCCGAACTGCTGACTTCACTGTCGATAA
> CATACGAGGGCGTTATTCTTATTGTTCCATCATAAACATGAATGGCGGATTCACACAGAA
> ACCCTTTGCTAAAATTTTCTGGAGTACCTAAATAGTTCAAAGACTACTAGGGAAAGACTA
> CGTTGAGAGACATGTAACTCATTGTAATCGTCTTGTAAAATGGAATCCTTCTTTTGCCCA
> CATTTTTACTTCTAATAAAGTTCGAGTACCTAGCCGAAAATTCGTCATTACAGGCAAGTG
> ACCTCTATGTGTGAGATTGTACGACCATCTAACTCGCCGAGATTCATAGTTGATCGCACC
> GTACAAAAGGCCCGTATACTATCCACTTCGTCGACGCGTACAACTTCAAATCGACATTAC
> AATCAAGGGTGGGGGTTACTGTGTATTGCATTGGAATCTGATTTCATCCTATGTCGGCAA
> TTGACAAGAAGAATGAAATCAAGATACCCGTGACTGATAAGTTTCTATTCCGCGCATCCT
> TTTGCCTTTTTTTCTTACTTGCGCAATCATGACCGCATTATTCACAAAATCATTTCTCGT
> TACTTTACTTTTCTAGAAGTTTCAATTTTAAATTTACCGTTTCTATCATAACAGCGAAAA
> GTAATCTATTACCTTCATAGCGAAATTTTTGTATTTGAAAAGCAGGGGTCACCGCCCTAC
> TCGGATCAAATGAGAGTGCGATCGTCAAAAAGCCCCACAAGTTGAAAACCAGGGTATGCC
> GGTAATGTCTTATGTAAGGAAGGTAATATCATATTATTTAAAGCAGCTAAATACAATGCA
> ACTATAGTGTATGCCCCGAATTCGATGTATACCACCATCTCGTATATGTATAATAACTCA
> TGTGCCTTTCGGCCTAAAGTAATTTACGTTTCTCTGTGTTTTTCCATGAAATACACATTC
> ACTGTTTTAGATCTTTTAGAGAGGTACAATTCTTAGATTAATGCAAAAGCGAGCTCTACC
> TGGAGTCCTCTGTGAAGGTCCCAAAACATCGGTCCACAGGATCTCGGTTGATAATCCAAA
> GAAGACAATCTTCTGGATTCACGGCGATATATACGACCGGTATTGTAAAGCAAGTAGTTC
> GTTTAAACAACTTTTATACTCTTGCTAACCGATGCACGCAGGTAGGACTCACTGCAACTT
> AATTTTTGAAAGTCATATTAAGATACCAAAACGGAAGTAAGCGTAATAGCCCTTCCGAGC
> ACGAGGAATACACGGTCTTGAGACAGTATTGTTAATTTGACTTTACAATTTCGATGATCT
> TAATATCCAGTTAACCCAATCATTTTAATACTACATGTATGGGCATTATAACGATACGTG
> CCAGGACATGTTGGAGAACCAGATATTTTACTCGAAGATGCATGACTTATATATTTATGT
> TAATGTAGAATTAATACATGTGAGCATCAATCTTAGAGTGCGTCTACAGAGCTTGGAGGA
> AGGTGGCAGAAAAAAGGCTGGGCCCGAAACTTCTATGCAGATCAAAATGAACTTCAATGG
> GAGATTGAGTAACCGATTAAGGCATAAGCAGGGCTGGAAATATTGGCGTGTATTATTGTG
> CGACAGAGTGGGAAACTCTTCGGTTAAGATTCAATTCAATATCGTCCCACCACGAAAAAA
> CTAGGGAAACTTATTTATATATCAGTCTTGACTCAACTAAAAACAATTCTGAGTGCTTTT
> TGCTTGTTGAATATACATGGACCGCTACAGGATAAACGAATCTTAGCTAATAAACATAAC
> TCCTACAAGATGGTTCAAGTCCTCATGCGGTAGGTAGATAATAAATTTCAGAGGTAGTCT
> CGACATAAAGTGATTTGCGGGTAATTAAAAGGTTCCAGGTTTGACACAATAAATTAAGGA
> TGCAACTATCGTGTTTTTTGTATCTAATTAGACTAAAGGCCTTATCTAGAAAATGCATGG
> TTTATCTAGTTTATTCTTAAGACAATCCGGTAATGGGGGATCGCGAAGTCTTATAGACAA
> ATCTAATCAGTGTGAGCCTTGTAATATTATTATAAATTAAATAGTTAGTTTTTATTCCTT
> GAGCAGTAACCTAAATAAAATTTAAAACTACGACGATACCCCGAGCTGTTTAGGGTCATT
> ATGCTGCTTACCGGTATTTCTTGAAGAAATGTTATCGGTAAATAAAGGTACCGCGTATGG
> TGTCTTCACGATGTTCTGATGTAGTTTAGTTGAAGTCTACTTGGTTTAAATACTTTTAGG
> AAACGATCTCAACCCTATAATCCCCGGGCAATATCCCCACAAAGTAGCTACAGGGAAGCG
> ACCGGATAAAGATTCTGAATCACCATCGAACAAAGCCCAAAAAGAATTAGATCATGAACA
> GACTATTGTGACAGGAGTACTGCAGCACGATCGCGATCAGAATAGCTAGTTGGGGATTAG
> TGTCTTGCTAATGTTTGGATCTGTGGATGATCCATTTTCAAATGAGTCTTCTATCTTTTC
> ACCGTTATTCAAAGTCTTGAAGTTTTTATTTACAATAGGTCACCAAGATCAATATTAATA
> AAAATTAGGAGATTGGAGACGCAACCGGACTTAAACACCGATTATTCATCCAATCCTAAT
> CTGCCGATATTGTAGTGGAATACCGAATCTAGTGAGAATTAGAATAGGTAGCCAAATTGC
> TATCTTGATCCAATGTTGTTATGCCACGATCGTATATAACCGCTGTTTTTCCTCTGTATA
> GGACCACAGTGTATTAACTTCTGAAAAGAAGGAACTCATGGGTTACCGACAAATAATGGC
> TCTAGGTTCGACTTCCATTTTAGAGAATGCGCCGGGAAACCAGCGGTTGTTTTTGAATTG
> GCAAATTATCAGATGAACTAGAAAAAATTTTCGTCTAGAATACTAGGGGTTGCTTTCACG
> TGCCATGATCAACAACTCGAACGCGAACTTAAATAGGAGCGGTATGAAATTCACGACTGA
> AGATCTACTATGGAGACAGATCCACTGTCCTTCGTTACATATTAGTTGAAGCATACTGTA
> AAATAATGAACATCTCAGTTAAACCGAACAAAGCCTGCCCTTAGTAAGACGGCCCTCTGA
> AATCGGGTATCCGATGTGCGGTATTTAATTTAGCAGGTGAATGTTTCTATTCAATAATAA
> CCGGGCCGTCAACTTGATATACTCAAAGTGATCGGAACAAGTTCTTACTACGATCCCCAT
> GCACGTTGTTAATCCGTAGATAGTTGGAATAAGAATTTTTGATGTGATTGGGAAACGGAT
> CCGAGGCTTAAAGGGTTATTTTAGAAGTTAATATATCAGTCAAATTATTGAAAAACTTCA
> CTCTGAGCTGATACGAATGCGAGTGTTATTAATCTTATCGGTTAATAGATCTCAGTCACG
> AAATGGGACCGACTAGTTCAGTTAAAAAGGATACAATTGAGAGAATGCACGCCAGCTACT
> CAGTATATGCATCTTTTTAGGATGCTAGATCTAACAAAACATTTATGAGTTTCACCTTAG
> CTCCTATGATCGGCCCATACCTAGAATTAGAAAATGTTTGACGGTTTTGTGTATTAGGTT
> CTGAATAACTGCTATGCGAGTGCTACTTTGATTTTTACCACTAGGAGACGTAAGAACTAA
> ACTGCATAGCATCCAGTTCACATTGATATGGGAGATTCGTATCCGTGGAGGGCGCTCGCA
> AATGTCTCGTCTATCCCAATCGACGATAACTTAGAGCCCTAACCTTTCTCATTCTGTTAA
> CGACCTTTGAATATACTGGTAAGTAAGGATTGGTAGTGCAGCGAAAAAGCGGCACAAAGC
> AAAAATGTTCCAAGGCATGTGTGAGATCCCTTATGTCCCAATGCACACGTGATACTTAAA
> TAATCTGTATAACTTGATCTGATGTCCGTCGTAAATTGCGTTATACGATGTGTCTTGATG
> GAACACCAACAGGACACTACGGCAACTACAGTGATGTATTCCTGACCAGTCAATGTACCA
> GGTCATTACACGGCAAAATCTTTTCGAGCGTTTTGTTTGACATTAAAATTGGTTACGTGA
> GTTTGCCTAGAGGGAGTCCGTGTTTCTTAGAGACGCCACCATGTCATATCTCCTGGCCAC
> CCACCATTTGTGTTTGTCCCGATGTCATATATTTCTCCATTGTGAAAGGGCCGTTAGGTT
> AGGTATCAAATAATAGGTGCCCTGAGGTTAGACGAAAATACTATCGGCAAATGATCGAGC
> ATTGAAAAACTCTGTCTCCTGTGCTATTTATTGGGATCTATAAGTGGCTGTACAATGGTC
> ATCCAAAAGGTTTATAGAGAGCGACTTACTGACTACAAACTTATCTCAGAGTGTTTTGTA
> GAGTCAGTAGTACGCAGGCTAAAGTAATTGCACGCTCGAATCAGTATTCATATAGATGAT
> GGTCCAGAGTTCTCTACTAGCATATATTATAGCTCATACTATCTTTTTGCCGATTTTGAT
> TAAAGAAATCTATATGAAGCTCAAAGGCATTAAGTAGCTTCGTTAGCAAATTACGCGGCC
> AATACTGTCACATATCAGAAACATACATGGACCATCGTTATCTTCCCCCTGACTACATAG
> TTAAAGATACTGGTATCATTCAGCTTATTTCTATCATGAATGGCTATCATTTCTAACCAA
> GTTTGGCGAAATGGTTACGAAGAACAGGCAATAATTTCACCCTGTATATTGTAACAGCGT
> ATCTTCTCTGGGTACGCTTTCTGCGAAGTGGGTTACGGTTCTTCAGTACTGATCCATTTG
> AGTTCACATTATCGCAATCTTAAGCTTGATGTCGAGTGAGCCGTACAATTTAATGAAAGT
> AATCAAAGGTTGCGCTGTGGTCGGTATTCTCTATCAATGTTCGGTGGCCTGTTTTTTAAG
> CTATTCGGCTCATGCGACCTTATATCGAGTTACCTGCTACCACTCGGAAGTAGCGCTTAT
> AAGACTGTAATGATTGCTTAATTAATGAAAGAGCGATTCTCGGGCCACAATCCATGTTGT
> CATTATAACCAGAAATGCCGTAGAATCGTCCCGACCCTATAGACTAATTGGGATGTATCG
> CGAGCTCCAAGTTGCGCATTGACAAAATTCAAATAAAGCTATAGGGTCTTGTTGTCTTTA
> ATGGTTGTAACCGTTTATAATTCGCACTGTGAAACAGATTTAGTACTGGCACCTTTACAT
> GGCAGATACTATGATTAATATACTAAAGTCAGACATCCAATAGGCAAGATAATATCGAAT
> ATAAGAATAACTGCTGAATACAGAACTATAGTATATTAACCTGAAGTTCGAGTTTTAGAG
> TCTTTTGTTCCGACTAGACGTCCGTTGATGCTTGTAAGGTAGATAATATTGCTCTCGTCA
> TGTCTACTGATCTTAGCACACGGTATAACTACAGCTCCAAATACACTGAGGTATAGCGCA
> ATGGATGGGATACGACGAATCAAGACTGAAGAGAGGCTTGATTATAAGTTAACCTTTCTG
> GCAAACCACATTCCAACTGGATATACAGCGATTATCGTCTGGTCATGTTAAATCTGAAAT
> TATCGTTAACTAAACCAGTGTACAAAATGATGATATAACTTTAGTCAGCTCCACCAGTCT
> GAAACTAAAAGGTAATGGACTTGAATATACGATAGTTCTTGAAGTTCCCGCGCCTCGTCG
> AATACAAACAACGAGATCGCCAAAACTTGTTGACATACGTTGCCGGTTTTATCTGCAACG
> TATCTCCTGGCACAATGAATTCGCTTGCATCGCTGATAAGCTCGACTACTCTCCGGTATT
> AATCATGTTTACCGTGAAACCGCATTGAGTCCGAAAAGATCTAGTCTGGATTACCCGCAT
> TATTATTGCTTATACTTCGGAGTGCTGTACATGTCGCGTCGTTTATGATACGGACGACAG
> GTACGCGAGGGAGCTCCTCGTTGACAATCTTTTGGGCATCAAGACAAGACGTCGGCAATT
> GGAGGATCTCAATCATATATAATACCCATCACGTAGCAGTTCAACTATTACAAGAATTTC
> ATTTATCGTCTATTATCTCATTACATGTGAGGATTGGCCTTCAATCTGGTTAATTCCCCT
> AATAAGTAGGCGCATTTTGTATTTAAAAATATTCAATCTTTTCATTTGTCAATACTTACA
> AGAGCTTGTTTCATGATATAAGTCTGAACATTTGTCGCCGTCACAATCTGCATAGCATTA
> GAACTATACTTCGACCGAAGATTCAGTGCATTATAGGTACTACTAGTAACCGCTCTTACC
> TTGTTTTGTCGACTAATTGGCTTACTAAGACCGAAAAATCTGCGTCCGGTTAAGAGTTCT
> AATGTCTACCTTATACTACTCTATCACTGACTAAAAGACCCTTATCAATTCAATTATACA
> TTTAATACAAATCATTATGCATCTTTGCTAATATTAGTATAAGAATAATCATATTTGTTA
> CACACCTGGTCAATCACCCAATGCTTCCCTGGTGGAGGCGCGATGTCTAAGATGTATGAC
> CCCCTCTCTTGCACAGGTTTTACGGGGGCGTGGTTCCCCAGAGGTCTAGCTAATAGTAGA
> TAGGACCAAGTCACCAGTATTTAACGAAGGAAGGAGCACAACCTTTAAATATGAACGGTT
> TAGTGCGAAGTATCAACAATATGTACTATCGAATTGGGTTGTGCTATCGTTTTGCACACC
> CACAGTGATTTAAGAGTCATCATGTCAAGAAGCAATAATGATACACAGAGATCTCCTTCG
> TAGTGCCCGGCAGCAGATCTGCTTTTAGAAAAAAAGAATATTCACTTGGTCAGTACTACA
> ACAAACCCAATCACAAATTCACCGAGGATCCCTACATATTCCAGCCTATTAGGTTTTGAG
> ACGTGAACTTGAAACCTCGAAAAGTTAGGTCCGCAGTGCTGTGTTAATTCAGCACTATGA
> GGTAGGCATTCCATATGAGCCATTATCAATTTTTCGTTGATCAACGTATCTTTCAAAGGC
> ACTAAGTTCCCTGAATATCCGAGGAAGTGTAAGCTTGCTTGAGCTCGATTGATCATTACA
> AATACTTAATACTCAAAGGACATATGATTTCGTGGCCGAACTATCAGGCGTATTCTGCGA
> CGCAAACGGGTGCTGTGGTCGGCTCATCTAGTTACTCTCACATTCCGTTGGTTCAATTCT
> ATGCAACATGCGTCGGAATAAGCTAGGCGATCTGGTCTATCATTTGTAAACGTACGTCCT
> TGGGGGCTGTTTCATTATTCTTAGTAAATTCCAGGGTACCGAAACGGGGGACTGACCTTA
> TATAAGACGGAAGGATACTAAAGAGACGTAAGAGTCTGGTGACTTTTTTCGGGGTAGAGT
> AAGCATTTGTAGAAAACTAATTGATCATCTGAAGTAAATGTATGTCCGAACTAACTACTG
> AGCTCTGGCGCGTCTCGCGCAGAGCATCCCATTGATAAGCGGCCGAATTAGTGGTGCCTC
> GCTATGTTTATTTTTGACTAGCATGTCTGTTTCTTAATTGCGTCCCCTTGTAGAGCGACT
> TTTAATACCTAGAGTGACATAAGTGTGCGGTGGCTGTTGATGAAAATATGGAAACTCGTG
> TACAGATACACCACTTGAGAAACGAGCCGAATTCACCTACACCTTGCAATAAGTGAGTCT
> TAAAAGAAATTTTGGAGGGTGGCGGTCTTCAGATGAAGCATAACATTCGGATCTAATATA
> GTGACTAAGGTAACTAGCCAACTTATCGCTCGAACCAACTAATATTGAGGACTTAAACCA
> AAGAGGAACTAGCTCAACAAAGCTGTAAATTATATAGTTAACCAGTAGAGAACCACAACG
> ACCTTTTGGCGAGTTTTAAAGGAGCGTGTCCTATTACAATGTAAAATACTTAGGGGCTGC
> ATAGCACGTCAGATAAGGCATCTTGAGTTAGAATCAGAGAATTGGCTAAATCTCAAAACG
> ATAAACATTAATGTTCCGTTAATCAGCACTAACTAAGGTAGGATCACCAGAAGACATAAG
> CATCACATCGAGCGACCTTATGGTATACAGGTATCGATAATTCCCAATTTGCCTTGAGAA
> TAAATTAGCAAGTTGCAAACCCGATCTTGGGACCTCTGAGTTGTGTTCTATCGAGGATAA
> CTTAACTAGCTCGCTGAACAGATACTTTAAGTTATCCTTGTATACAACTACACATGGAAG
> CCGTTAACCTTAAATTGGAGCCGCTCTAATGACGTAACGCTTCATAAACCGGTAAAACAA
> ATCGTGAAAGGGCGACAGACCAGTATATACTTTTATAGTTAAACTACTATTATAAGGGAA
> CTTTGGTTCGAAGCTGCTTTCCGAGGCCCTTATGATATAACTCATACGGCTTTATCTAAA
> CCTACACTTACAGTGACTGGAAAAATTGGCGATCGATCTCGCAGGATCGCTGGGCACTTA
> CCTTGGTCAACTTTACTGGTCTACAATTACGACATAAAGTTTGGACGGCAATCGGAAAAC
> AATCTACACTTACAACATAAACTAGTATACATTTACTATGGGTCAACAAATCTGTTATCG
> ATTCCACGAACAACGATATAATATGGAAGACTTTAAGAGGGTTGGATTTACGACCTTATG
> GCCATTCACCTCCCAAAGATTCCCATTCGGCTAAAAAAGTACACTGAGGTTCTATCTCCT
> ATCTCTAAGTCGAATAGTAAAAGGGTAATCAATAGACATTCTACATTTGGTTCATTGGAG
> ATCGTTATTATCCGTCGGTAACGATAGCACATTCTCAAGCATGATTCGTAACACATCGGA
> GTCACCTATGAAGGGTTTGCCTAGAAAATAAACCTATTTTTCCTTGCGTCGTGTAATTAG
> TATAGGGCAGATGACTGAAGGATACACCGGATCAGCTGTATACTTCTTACTCCTTCCAGG
> GCAGTCTTTTTAGACCACTTGTTCTAAGCGTGTGGTCTGACTAAACGGTTTAGGATATTT
> CTCATACACTGATCACACTGACGATTCGCTGTGAACGACGAGGGTGAATAGAATAAATTC
> AATGCTTCTCTGACCCATAGATGAACTGAAAAATAGAGAAGGGAATGTATCTTTCGCGGT
> AGTCGAGCTGGTTCAAACTTAACTAGAGAAATCTGGTAATAAGTGTCTTAATTATAATTT
> AGTAGAGCCTTATTTTAAACAGCTGCATTGACAAATATAAATGAAACGGTTGATAATTTG
> TGTTTAATTTTGGAGTAGAATCAATTCGCGTAATAACAGAACGGGCGACTTTAAAAGTAC
> GAAATAACCATTTAATTGGGACTTTTAGCTGGAAAGTTGGGTTTCATAGAGCCTCTGTAA
> TTATTATACTGGTTTACAAGCTTGAATACTGCTTGCGAATGCGATTAGCTAGGCACCTAT
> ATATTGATAGCTTGAAGGTATTACCACGTGGGAGTTGCATACGTAGCTCCTATTGCTAAA
> TGCTGGGTTTGTGCAGTACTACGTTCCGAGTTTACGAACTCCAGCGGTCCATTGTCATTG
> GGTGTGTTTGTATAAGCAACTTTGGTTCTATTTGGCTACATACGGGGGTCTGGTTCCTCC
> ACGTACAGCTGATGTCTTCTAAGTTTCCAGAGGAATGAAGTGCGATGGCGTAACTAGATT
> ACTGTATATATCCAGAGTTTCCTACGTCGTATATAATACCTCATTGATTCTTGTAATCCC
> ATTACATTCATTCAGGTGATGTCTTTAGTGTTTAAGACTGCCATGTGTCCTGCTGTCCAA
> CGAGACATAAAGTAGCGCTAGCGGATTATTGAAGTACCCATAATATCGAAATTCAGGATA
> AGTATTATTCTAAGACTGCATATCACTTGAACCTCGTGGGTGAGATATCTTATACTTACA
> CTAGCTGAATAAATCTACTGGGGGACGCACTGCCCTCCCTGGGCTCACTATCGTATTAAA
> CAACTGTGTCCCTAGCTAATACACATCGACTCTAAGAAGTGTGTCTTTTCTTCGCCGAGG
> AGTCATAATGCTGGATGTTAGACAGGTGATACTCACGGATCAAATGGAGTAATGGTTGAC
> TAGTATCCAAACGTAGGAGATCAAAGCCACTTTTACCTCTAAAGAGAAACAAAACGCGAC
> AGCTTAGTTGACTTTCGAGAACCGAAAAAAAATAAATGAATGAATTTCGACCATCTTTTA
> TAAGATATCGAAAAATTAATGGCATGTTAGTTGTGGAATTCGTTTCTGTGTAACGGAAAT
> TAAAAATAAGGTAGCCTAAAATCAACCATGGGTTCACACTGTGCTGTTCATGGTTTATCT
> ACTCGTATAGGGCACAAATAACAAAAACGAACACCACGACGTCAGGATACCTTCCTCGTT
> TACTGCACAGTCCACTTGATTATAATCATGGAGCGTTCGGAGCCTACCATCAACCTTCTA
> TTAATTCCTTGGATGAGGCTGCACAGCGTAATTAAAATTTCGTTGTTACGGACCACAAAC
> TTCTTGTATCGAATATTGTGGACGAGCTCAAATCCATAAGTAGGGAATCCGCTAAGAAAA
> CGATTTTAACTTGGTTACACAGAGCTTGTTAGTTACAATGAGACCTGCACCTTGACTGAA
> TTAAACTACTCCCGATTATTCTGTTCTAGTTGAAGGTTACTTATTGGGCCGGTCAGCCGA
> ATAAGTAAGAATCAACCATGATCCTGTTAGTGCCACAACGTGTTTTTAGTAGCCTGAGAC
> TTATCTCTAAGGTTGTACAGTTTACGTGGCTTCAAACAAATTCATACGTTGCTATTTGTA
> GCCAACACATCGGAAATTTGCACGGTCGTGCAGTCTCGTAGAAAACTAATTTTGACTCGC
> TAACTAAGCTATTACTGTGATCTGCAGTACTGCAAAGTTGACTCAATCTTTTGGGACTGT
> ACAGGTTTGGTGTGCCTGTCGAATAGTGTAAGTATTGAGTACTATGTAGGTTGTGGAGCC
> CGTTCCCCCTAAGTAGATATTATCATATGTGACGTGTATGATAAGATTTTATCATTGCAG
> AAGCTGCTGAGTAGTAATAATTGTAACTTACACTTTGTGCACTGTCGTTAGACAAGTATG
> GTCACACCAAGTTTGATAGGTATTAAACTACATAAATCCAAATTTTGTCTGCTGTAGCAT
> TCTGCTCTGGGGCCATATATAATGGCCATATGCCTGCTAAAGTTCGAAGGTTCGTTGACA
> CTTCCCCCATTAAGCAAATTAAACCTGGTATATGATGTGATGGCGGTTTCGTGTCCGCCC
> TGATGTTGTGTACTAGGTAGAAAATCTAAAGTTATGGCCGGAAATAAGTTCGGTCTCATC
> CTTATCCTAACCACTTTCTATACTTCGATGAGGTGGGCGCTGGTCAACAGTTACCATTAT
> CATACCCGGAGTCACCATCACCAATATCTGCGCATTGTTTTAAGGTTTGATTCGTGCCGG
> TTTCGCTATTTTAAGATGGTGAAGCACTAGGCATAAGTGTGAAACAAGCCCTTAGGATTC
> TGTGTAACTTTGTTCTTTTATAGCAAAACCAATAGATAAGTTAGGCTTGCTGCGTCACAT
> CTGTTGAACATGAACCACTTAGTTTTCTAAGTACACATACGTTCTTATAACGTTTGGAAA
> TTTGTCACATATTACCGTTTATGCTGCCGAGCTGTTATAAAGTCAAGTGGGTTGTGCCCG
> AACTGCTCTCTTAAATCTCGTTAAAATTCCTCGGCGTTATGCGTAGTGTGCCATCTGTTA
> CATGAATGGAGGATGAACAAAGAATCACTTTGATAATAGTTGATCGTCTAACTATTTAGG
> GAATTGACGAATAGCCAAACACGAACGTGTCTGAAATCTAACGCATTGTAATCCTATTGT
> AATAGGCAAGACGTCTGTTGCCCAATTGTGTACTGCTTATTAAGTTCCACTTCCGACCCG
> ATAAGTCCTATTTAAACCAAACTGTAATCTTTCTCTGAGATTGTACCACCATATTTCTCC
> CAGACATGCTTACGTGTGCGCTACGTAAATAAGGACCGGTTACTAGCAAATGCCGCCAAC
> AGTACATCGTCATATCCACATTAAAATAAACGCTCCGGCGTACTGTGGATGCAATTCGAA
> TCTCTGTTCATACTTGCTAGCAAATTCTATTGTTCTTGGAAATCATGATACAAGTGAATG
> ATAAGGGGCTTGTAAGCCCATCCGGTGCCATTTTTTTATTAATTGAGAAATCTGCACCCA
> ATTAGTCAAATTATATTTGCGAGTTAATTTACTTTGATTCAAGTGTCAAGGTGATATTGA
> CAGTTTATATCTTATATCAGTTTTGTTATCTTGTACATTATGTCACAAAGTGTGCGATTT
> GAAAACAACGGCTCTCCCACCGAATCGGATATAATGAGACTGACATCCTCTTAAACCCAA
> TCAACGGCAAAAAAACGCTATCCCGCTATGGTAGTATGTAAGGAACGGTATAGATTATGA
> TTGTAACCAGCTATAGTAAATGCAACGATTGTGGATGCCACCTAGTAGAGCTATACCAAC
> TTATCGTATATCTATATGAAATCAGCGGCCGTTACCCCTAAAGGTATTGACGTTGCGCGC
> TGTTTTTCATTGAAATACTCTGTAACGCTTTTTCATCTGGGAGAGACCGACAAGTATTAC
> ATTATGGCAATACCGAGATATTACGCGAGTACGCTGGGAACCTACATAAAATTCGGTCCA
> ATGGATATCGGGTCATAATCATAACATCACTATAGGCGCGTTTCTCGGCGTTTGATAAGT
> ACCCTATTGTAAAGCATGTACGTCGTTGAAAATAATGTTAGTCTCTTGATAAAAGATGCA
> CCCTCCGAGCACGCAATGCTTCTTAAGTTTTCAATGGATTTGTAACATAACTAATCCCTT
> CTAACCGTATTACACATTCAGTGCACCAGCATTACACGGTCTTGAGACTCTATTGGTTAG
> TGCACTTTACTTTGTAGATGAGCGTTTTAGACAGTTTAACATATCATTTTTATAAGTATT
> CGATCCGAATTTGTACCATACGTGCCTGGAAAGCTTGGACAACCAGATTTGTTAAGCCAA
> GATGCATGAATGAGAGAGTGATCTTAATGTACATGGAATACTTCGGACCTTCAATATGAG
> AGGCCGGCTTCACACAGGGCACCAAGCGCCATGATAAATGCATGGGCCAGATAATTATAT
> CCAGAGCTATATGAACTTATAGGCGAGATTGACTAAACCTTTTACCCAGAAGAACGCCTG
> CATTTATTCCAGTGTTTTAGTGTCACACTCACTGGCTAAATCTTCGGTTAACAGTAAAGG
> CTATTGCCTCCCTCCAACATAAATATAGCCAAACGTATTTATATTTCAGTCGTGAATCTT
> CGAAAAAAAATTCGCAGGGATGGGGGCGGCTTCATTTTACAGCGACAGATTAAGGATAAA
> CCAATATGTCAGAATAAACATATCGCCTAATTCATGGGTCTTGTACGCTGGCCCTTCGTA
> GTGTATAAATTTCACTCGTTGTCTACAAAGTTTGTGATTTCCGGGTATTGTAAAGCGTAC
> ACGGTTGACAATATTTTTTAAGCAGCCTACTATCCTGTTGTTTGTATATATTGACAATAT
> AGGCAGTAGCTTGAAAAGGATTGGTTTAGATACGTTATTAGTAACACAATAAGCTAATGG
> GCGATCGCGTTGGATGATAGAAAAATATAAGAAGTGTCAGACTTCTAATTTGATTATAAA
> TTAAAGAGTTACTGTGTATGCCTGCTGAAGTTACCTTATTAAAAGTTAAAAATTAGACCA
> TAACCACTGATGTTGAGCGTCAGTATCCTGCTGTCCGCTATTTATGGAAGATAGGTTATC
> GGGAAATAAAGCTACAGCCTTGCGTGGCTTAACGATGGTCGCATGTTGTTTACTTCTAGT
> CTTCTTCGGGGAATGACTTGTAGCATACGTTCTATACAATAGAATACCCGGGCTATATCA
> AAAATAACGTGATTCTGCCATCCCAAACGATAAACATTATGAATCACATTCGAAAATAGC
> CATTTTAGAATGTCATCAGCTTCAGTATAGTCTCAAACCAGTAATGAAGCTACTTACAGT
> TCAGAAGAGAGAGTTGCGGAGGTGTGGCGGCATAAGGTTTGCATAGGGGCATGAGCAATT
> GTAAAAGGAGTATGAGAGATTGGATCCCTTATTCATTGTCTGCAAGGTTGTATTTAAATG
> ACCTCACCAACATCAATATTAATAATAATTACGACTGTCGACAACAATCCCCTCGGAAAA
> ACCGAGTATTAATAATAGCCGATTCGGCCCATTTTCGACGGCAATTAAGAATAGAGTCTG
> TAGTTGAAGAGCTTCCAATATTCATAGCGGCAGCAAATGTTCGTATGCCACGAGCCTATA
> GAACAGCTCTTGTTCCTATGGATAGCAAAAATGTGTAGGTAATTATCATTACATCGAAAT
> CTTGGCTTAACGTATAATTTTCCATCTAGGGTACTCGTCCAGTTTACACAATGCGCCGGC
> ATACAACACCTTGTTTTTGTAGTCGAAAATGATATGATGAACTTCTTATAATTTGCCTCT
> AGATTACTACGCCTTCCGGTCACCTCCCAGCAGCATAAACTAGTAACAGAACTTAAATTG
> CAGCGCTTTGAAATTATCCAAGGAAGATATACTTTGGAGAAAGATAAAATCTCCTTAGTG
> ACTTATGTCGTGAACAAGTCGGTTATTTTATCAAAATATCAGTTTATCCGATAATTCCCG
> CCCCTTACTAAGACGGCACTATCTAATAGCCTATACCAGGTGAGCGTTTTAATTGAGCAG
> CTCAAGGGGTCTTTTAAATATTATACGCGCCGGCAACTTGTTATAAGCTTTGTCTGCCGA
> AATAGTTATTACTAAGTTCCCCAGGCTCCTGCGTATGAAGGTGAGTGGTGCAAGAAGTTT
> TTTTCTTGTGTTGGCCAAACCGATAAGAGCCTTATTCGGGGATTTTAGAACTGAAGATTT
> CAGTAAATGTATTGAAATACTTCACTCTCAGATGTGTCCTAGGCGAGTGTTAGTAAGATG
> AGACGTTAATACAGAGAAGTCTAGTAATGGCACAGAATTGTGCAGTGATATTGCAGTCAA
> TTCTGAGAATCAAAGAAAGCTACTAAGTAGAGGAATCGGGTTAGGTGCCTACTGCTTAAA
> AATATTTTTTGACTTTCAAATGAGCGCATAGGTTCGGACATTTACTACAAGTACTAATGC
> TTGGACGCTTTTGTGTAGTTGCTGAGGAAGAACTGATTTCCCAGGCCTACGTGCTTGGTT
> TCAACGACCAGACCTTAGATCTATAAGCAATTGCATACTGTGCTCATGCATTTCGGTCAT
> TCGGAGAACGCGAGCGCGCGACCAAAGGTAGCCTCGTTCCCAATAGACCTTAAATGTCAG
> CACGATCCTGTCTCATGCTGTTTACGACATTTGAATAGTAGGGGAAGTAAGGAGTGCTAG
> TCCAGCCAAAATGACGCACAAACCTAATTTCTTCCTTGCAATGTCTGACATCACGTAGGT
> CCCTTTGAACTAGTCATAAGTAATTAAGCGGTATTTCTGCAGCTCAGCTCACTAGTTTAT
> TCAGTTTTTCGATCTGGCGTGAGGCAACTCCAACAGCTATCTTAGGAATCTACACTGTTG
> GAGTCCTGTACAGGAAATGTACCAGGGCAGTACACCGCATAAGATGTGAGAGAGGGGGGT
> TTCACATTAATATTGGTTAAGTGAGTTGCACGAGACGCACGCCGTCTTTCTTTGACAAGA
> CACCTTGTATTATAGAAGCGCCTCCAACAATTGCTCGTTGGCCCCTGGTAATATATTTAT
> CCAGTCTCAAAGGGACGTGACGTTACCGATAAATTAAGACGTGACCTCAGGTTTGTCGAA
> ATTAAGTTCGGCAAATGTTCGAGAATGGAATAAAGAGGTAGCATCTGCTTTTGAGGGGGA
> GCTATATGTCCATGTTCAATCCTCATCAATAAGCTGTAGAGAGACAGACGTAAGGACTAA
> TATCTTTTCTCACACGGTGTTGTTGTGTCACTAGTACGCTGGCTATAGGAATTGATACAG
> CGAAGCTCTAGGCAGAGACATGATCGTCCACAGTTAGCTAAGACATTATATTTTACAGAT
> TAAGAGAGGTTGGCACATGGTCAGTATACAAAGCGATTGCTAGCGCTATGGCATTAAGGT
> CCTTACTTTGATAATTACCAGCCATATTAGGTAACAGTTAAGATACATACAGCCTCCATC
> CTTATCTGCCCACGGACGTAATAGTTAAACTTACGCGGTGCATTCAGAGGAGTGCTAGCA
> TGAATCCCGATCATTTAGAAACAACTGTCCAGTATGGCTGTAGAACTACAGGCAAGTAGT
> TAACAATCTAGATGGTATAAGCCTAGATTCGCGGGGTTCCCTTGCTGAGAACGGCCTTAC
> CCTTAGTCAGGAATGAGCCATTTCTGGGCAATTTATCCCAATCGGATCCTGCATCGAGAG
> TCACCCGGTAAATGGAATGATAGTTAGATAAGGTTCCCCTCGCGTCGCTATGAGATAGAT
> ATGGTACGTGGACTCTTTTGGAAGATTTTCGGATAATCAGACATTTGATAGACTTACATG
> CTACCACTAGCAACTACCGCTTTGATCAATCGTATCATTGAGTAATTTTGCAAAGAGCCA
> TTATCGGCCCAAAAGACATGTTGGCATTTTAAACAGTAATGAACTAGTTTCGTCACGACC
> ATATAGAATTATTCGGATCTAGAGAGTCAGCCAAGTTGCGCAGGCAATAAATTCAAAGAA
> AGCTATTGGGTATGCTTCTATTGATTCGGTGTAACCGTTTATAATGCGCTCGGTCAAAAT
> CTTTTTCTAAGGGATCCGTGAAATGCAAGTTAATATCATTAATTTTATATACTCAGACAT
> AAATTAGCCAAGAGTATATCGAATATAACAAGAACTGAGCATTTAACAACTAGACTATAG
> TTTACGCTACTTCCACTTTTAGTGTCTTGTGTGACCAATACACGTACGTTGAGGCGTGGA
> AGCTTGATAATATTCCTCTACGAATCTATACTCAGATTAGCACAAGCTAGAACGTAAGCT
> ACATATTAACTCACGTAGACCGCATGCGATGGCAGAACAAGAATCAAGACTGAAGACAGG
> CTTGATTTTAACTTAACCTTGATCGCATACCACATTCCAACGGGATTGAAACAGATTAGA
> GGCTGCTAATCTTAAATCTCATTTTATCCGTATCTTAACAACTGTAATTTATCAGGAGAT
> ATCTTGAGTCTGATAATCCACTATGAATCGATTTGGTATTGCACTTCATTATAACTTAGG
> TCTTCAACTTACAGCCCAGACTACATTTATAAATTCGTGATCGACAATAAGGCTGCACAT
> ACCGTGCAGCGTTTATCGGATAAGGATCTCATGGCTCTTTCAATGCGCTTGCATACCGGT
> TATGATCCTATTATCGCCCCGTTGAATAATCTTTAACGTCTAACACCTTTGTGGCCGAAT
> ACATCGAGTCTCGATTTACCCAATTATTTTTGCTGAGAATTCCCAGTGATGTACAGGGAC
> CGTCGTTTATCATAAGCAAGAAAGGTAAGAGACGGACATCCTCCGGCTCAATCGTTTGCC
> CTGAAACTCAAGAAGTCGCAATTTGGTCCAGCGCAATCATATTTAATTCCAAGAACGTAC
> CAGTTCAACTTTGACAAGTAGGGAATTGATCGTCTAGTAGCGAATTACATGTCAGCATTC
> CCCTTCAATATGGTGAATTCAACTATGTTCGAGCACCATGTTCTTTTTTATTATATGATA
> TAGTGTCTTGTCTATATTCGTTAATGAGCGTCTTGCTTGAGTGAACTATGATAATTGGTA
> CACGTCACTAGCTGAATACCATTTCAACTATACTGAGACAGATCTTTCTGTGATTTATAG
> GTACTACTTGGAAAACCGCTTACATTCGTTTGTAGAAGTTTTCGCTTTCGAAGAACGTTA
> AATATGAGGAACCTGAAGAGTTCGAAGCTCTAACTGATACTAAGATATAAATCACTAAAA
> CTACCGTATATAGGCAATTATTCTGTTTAGACAATGCTTTATGCATAGGTCCGATTAGTT
> GGATAACAATAATAATATGTGTTTAACACCGGCTCTTGCAAACTATCATGAACGCCTCGA
> CGAGCGTGGTATATGTGCTATCACACCCTCTCTGGAACAGGGTTGAACGCGCACTCGGTC
> CACTGAGCTCTACCGTTGACGTGATAGCACAAACTCACCACGTTTGAAAGAAGCAACCAG
> CACTAACTGTAAATATGATACCTTGTGGCAGAACTTGAAACTATAGGTTCTATCCAATTC
> GGTTGTGATATACGGTTGAAAAACAACACGGAGTTAACAGTCAGCATCTAAAGTAGCAAT
> AATCATAAACACAGATCTACTTCCGAGTCCCACGAAGCACATCTCCGTTTAGAATAAATC
> AATAGGAACTGCGTCTCGACGACTTCATAAAAATTAACTAATTCACAGACCATCCATACA
> GATTACAGAATTTTACGTTTTGAGACCGGAACTTGATACCGACAAAAGTGTCCTAACCAC
> TGCTCGGGGAATTATCAACTAGGAGGTACGCATGAAATAGGAGACAGGATCAATTTTGCC
> TTCATAAAAGTTTCTTTCAAACGCACGAAGTTCAATGAATATACGTCGAACTCGATGCGT
> GATTGACCTCCTTTGATCATGTCATATAATTAATTAGCTAACGTCATTTGTTTTCGGCCC
> CCAAATTGCTGGAGTTTTATGCCTAGAATTACGGTGCTCGCGTCGGATCATCTTGTTAAT
> ATCACAGGCACTTGGTTCTAGTATATGATTCATGCCTCCGTAGTACATTCGCGATAGCCT
> CTATCTTGTCGATACGTAAGGAAGGGCGCGAGGTTTAAGTTTGCGTAGGTAATTCCAGCC
> TTACGAAACGGGGCACTGACCTTTTATAAGACGCTAGGTGTCTTTTCAGACGTAAGTCTA
> GGGTGAAGTTGTTCCCCGTTGTGGATGAATTTCGTCAATAAGAATTGATCTTATCATCTA
> AAGGTATGTCCCTTCTAACTTCGGAGATATGGACCCTCGCCCGCAGTCCAGACAATTCAT
> AAGCCGCACAAGTTGTCGTCCCTACATATCGTGAGTGGGCTCGAGAATGGAGGGGTCTTT
> TTTGCCGACCCTTGGAGACAGACTTGTAAGAACGAGAGTGACATTACTCTGCCGTGCATG
> GTCAGCTTAAGATCGAAACGCCGGGACAGATAAACCAATTGACTTACCAGCACTTGTCAA
> CGACTCCTTGATATATGTCAGTCTTTTTTGATATTTGCGAGGCTCCCGGTCGTCAGATCT
> AGCAGTTCATTCGCAGATAATTGTGTCTCTAACGTTACTTGCAAAATGTGCGATAGAAAA
> AACTAATTTTCTGCAATGAAACATTAGAGGTACGTCCGAAAAAATGCTGTAAATGATATA
> CTTATCAAGTTGACAACCTCTTCCAAAGGTGGGAGAGTTTGAAACGAGCCGGTACTTTGA
> ATAGCTAAATGTATGAGGGGCTGCAGAGCAAGTCAGTTAAGGATGCTTCACTGACAAGAA
> GAGAATTGGCTTAATCTATTTACCATAATCTTTAATCGTCAGTTATTATCCTATAAAGAA
> CGGTGGATCAACTGAAGACAGAACCATATCTGCGTCCGACCTGATGGTAGACACGTATCC
> ATAATGACCAATTTCCCTTCAGAAGTAATTAGCAACGTCCATACCACATAGTGGGACATA
> TCTGTTCGGTTAGAGACAGCATTAATTTTCTACCTCGATCTTATGATTAGGGAAGTTATA
> CTTGGATACAACTACTCTGCGAAGCCGGTAACCTTAATTTGGACACCAGCTTATGACGTA
> ACCATTAATAATAAGCGAAAAAATATCGTGAAAGCCCCACAGTAAAGGTTATTCGTTGTG
> TCGTTAACTACTATTAGAACCGAAAGTGGGTTAGAACCTCAGGTAAGTCCAACGTTGCAG
> AGAACTCTGACGGCTTTATCGTTTCAGAAAAGGAAAGTGACTGCAATTATTGGCGATAGT
> TCTCCAAGGAGAGCTGGGAAATTAAATTGGTAAACTTGAATCGTCTACAATGACGTCTGA
> TTCTGGGGACCCCAATCCGAAATCATTAGACACGTAATACAGTAACTAGTATACAGGTAC
> TATCGGTCATCAAAGCTCTTTTAGATTCAAACAAAAACGAGATTTTTTCGATGACTGTTT
> CTGCGTTGCTTTTTAGACATGATCCACAGTCTCCTAACAATGATTCCCATTCGGCTAATA
> TAGTTCTCTGACGTGCTTTATCCTTTATCTTTGGACTAGACTATAACCCTAAGCATTTCA
> CTGTCTACTTTTGCGTAATTCCACTTCCTGATTATCCCTAGGTAACGTTACAAAATGATA
> TACCATGTGGCGTATCACATAGGACTAACCTATGTTGGGTTTGCCTAGTATTTAAAAATA
> TTTTTAAGGGAGGACTGTATTGACGATAGGCCAGATGTCTCAACGTTACAACGGATCTCA
> TCGTTACTTCTGTCTCATGCAACCGCTCTATTTTTTGACAACTGGTTCTAACCGGGTGCT
> CTGACTAATAGGTTTAGGTGATTTCTCAGAATCTGTTCACACTGAAGTTTCGCTGTGAAA
> CTCCACCGTCTTGACATGAAATGCAATCCTTCTAGGAACATTACAGGTAATGATAAATTG
> AGTTGGGTATCTATAGTTCCACCTAGTCGAGATGGTTAAAACTTAACTTGTGATATCTCC
> GTTTAAGGGTCTTAATTAGTATGTAGGACTGAATTATTTTTAAAAGCGCATTGGAAAAAT
> ATAAATCAAAAGCGGCTTAAGTGCGGTGTAATTTGCCAGTTGTTTATTTTCGAGTATTAA
> CACTACGGCAGACTTTAATACTTAGATATAACAATGTTTTGGGGAAGGTGAGCGGGTTAC
> TTCCCGTTCATAGTCACTATCTTATTATTATACGGCTGTACAACCTTGAATACTCATTGC
> GAAGGCCAGTACAGAGGAACCTATTGATGGATTCAGGGTAGGGATGTAATACTCCGACTT
> GCATACCTAGATCCTTTGCCTAATTCCTCCCTTGGTGAACTAATACCGGACCAGTTTTAG
> TAATACACCCGTACAGGGTATGTGGCTGTCTGGCTAGAACCAACTTTGCTTCTAGTTCGC
> TTCAGAAGCCGCTATGGTTCAGAAAAGGACAGCTCTTGGATTATAACTGGCAACAGCATT
> GAAGGGAGTTGGCCTTACTAGAGTTATCTTTAGATCCAGTCTTTCCTTCGTAGTATTTAT
> TAAATCATGGAGTCTTCTAAGCCATTTACATGAAGTCAGGTGAGGGCTTTACGGTTTTAC
> ACTCAATTCTCTCCTGATCTCCTACCAGACATTAAGTACCCCTACAGCTTTTTTCAAGTA
> CCAATATTTTCGAAATTAAGCATAAGGTGTTTGCTTACACGGCATATCTAGTGAAAAGCG
> TGGGGGAGAGATATTATAATGACACGAGCTGAAGATTGAGTATGCGCCACGCACTCACAT
> CCCGCCGCGATATATCCTTTTTAACAAAGGTCTCCCTAGCTAATACACAGCGACTCTTAC
> AAGGCTGGATTTTAGGACCCGAGCAGGCAGAATCATGCTGCTGAGTAACGGCTTAATCAC
> CGTGATTTTGGAGTAAGGCTTGAAGACTTTACTAAAGTAGGACAGAAAAGAAACTGTTTC
> CTATATAGACATACAAAACCCCTAACCTTAGTTCACGTTAGTCAACCGAAAAAATATATA
> TGAAGGTATTGACACAATCTTTTATTTGATATCGATATTTTATGGGATTCTTAGTTGTGC
> AAGGCGTTTCGGTGGAACCCATAGTAAAAATTACGTTGACTATATTCAAAATTGGCTTAA
> ATCTCGCCTGGTAATGCGTGATAGTCGCCTAGACGGCACATAGAAAATATACCAACACCT
> CGACCTCAGCATTCCTGCCTCGTTGACTGATAACTACTATTGATTATAATAAGGGTGCGT
> GAGGTCCCTACCTGCTACCGTATATGTATGCAGTGCATGAGCCTGCACAGCGTAATTTAA
> AGGGAGTTGGTACCGACCTCAAAAGGATTGGAGACATTAGTCGCCACGACCGCAAAGCCA
> TAAGTAGGCAATCAGATAACAAATAGATGTTATATTGGTTACACAGACATTCTTAGTGAA
> ATGCACTCATGCTCCGTGACGCATTTAAACTAATACCGAGTTTTCTCTTCTAGTTGATCC
> TTACGTTGGGGCCCGCTCAGCAGAAGAAGTTACATTCAAACAGCTTACTCTTTGTGCCTC
> AACGTGTGGGTTGGTGCATGAGAATTTGCTCGATGGTTCGACTGTTTAACTGGCTTATAT
> CATATTCATACGTGCCTATGTGTAGCCATAACATCGCTTATTTGCTCCCTCGTGATGTCT
> CGTAGATAACTAATTGTGACTAGAGAAATAAGCGTGTACGCTCATCGCCACTAAGCAAAT
> CTTGACTCAATATGGTGCGACTGTACACGTTGCGTGTGCCTGTCGATTAGTGTAAGTATT
> GAGTACGAGGGTGGTTGTCGAGAAAGTTCCAAATATCTTCAGATGATCATATGGGTCGTG
> TTTGATTAGTTTTTATATTTGAAGTACCTGCGGAGTACTTATAATTGTTACTGACTCTTG
> GTGCACGGGCGTTACTATACTAGCCGCAAACAAAGTGTGATACGGATTAAACGTCTTATA
> GCCAAATTGTGGATCATGTTGCATTCGCATAGGGCGACATATTGAATCCAATTATCAATC
> ATAAAGTGCGATGCTTCGGTCAAAATTAACCATGTAACCAAATTTAAACTCGTATTTCTG
> GGCATGCACGTGGAGTCGCACAACGCTTGGGCTCTACGTGGGACTAAATCGAAAGTTTGC
> GACGGATATATCTTAGGGATAAGCCGGTTCAGAAACACGTGATATACTTCCATGTGCTCG
> GACCTGCTCAAAAGTTACAAGTTTCTGAACACGTCGATACTGCACCATGATAGCAGCTTT
> CTGTTAAGGGGGGTTTCGGGCACGTTTACCTATTTTAAGTTGGTCTAGCACTTCGAATTA
> CTGTCATTCATGACCGTACCATTCTGTCTAAATTGCGTATTTGTTTCAATTTACTATAGT
> GAAGTTACGCGTCATGACTATCATCTGTTGAACAGCAACAACTTACTTTTCTTTGTACAC
> ATAAGGGCTGTTAACGTTTCCAATTTTGTCTCATAGGTCAGGTTAGGATCCCCAGATCTT
> ATATAGTCAAGTGCGTTGGGCCACTAATCATCTAGTAAATCTACTGAAAATTACTCCCAG
> GTTGGAGGTGGCTGAATTATGTTAAATCTATCCACGTTGAAATATGTATAAATTTCAGTT
> TAGGTGATCCTCTTAAGATTTTCGGATTTGTAGTATACCCTAACACGAACGTGTCTCTAT
> TCTTAAGATTGCTAATACGATTCTATTTGCCAAGAAGTCGGTTGAACAATGGTGTACGGC
> GTAGTTACGTCCTCTTAAGTCAACATATGGCCTATTGTATCCAAACTCTAAGAGTGCTCT
> CACTGGGTAACAAAATATTTCGCCCACTCTTGCTTACGGCTGACATAACTTAATATCCAA
> CCGTTAATAGCATATGACGCCAACAGTACTTAGTATTTGCCAAATTAAAATATACCCTCC
> CGCGTTATGTGGAGGCAATTCGAAGAGCTGTTAATAATTGCTAGCAAATGCTATTGTTCT
> TGCATATCATCTGACAAGGCAATCTTAACGGGATTGGAACACAAGAAGGTGCAATGGTGT
> TATGTATTCAGATTTATGCAAACAAGTAGGCAATTTATATGGGAGACGTTATGGTAGTTG
> ATTCAACGGGATTGGTGTTTGGGTAAGGGGATTTATTATATCAGTTTTCGTATATTGTTA
> AGTATGTCACAATGTGTGCGAGGTCTATACAACCCCTCTACCAACGTAGCCCTGATAATC
> ACACTCACAGACTATTTAACACAATAATCGGCATAAAATCGCTTGCCACCTATGCTAGGA
> TCGTACGATCGGTATTGATTATGAGGGTTACATCATATAGTATAGCATAAGATTGTCGAT
> CAAACCTAGTACAGCTTTAAAAAATGATCCTATATCTATATGTAATATGCGCACGGTACC
> AAGTATGGTAGTGAACGGGAGAGCGCGTTTTAATTCAAATTCTATGTAAAGCGGTGTCAT
> ATGGGACACACCGAAAAGTATGACATTTTGGCATTTCCCTCATAGTAAGCCTCTAAGCGG
> GCTTCCTAAATAAAATGAGCTAATATCCATAGAGCGGCTGAAGCATATCATCAATTGAGG
> AGCCTGTATAGCACTTTGAGAACTAACCTATTGGAATGAATGTACGTACTGGAAAATTAG
> GGTTGTAGAGTCAGTAAACATCATACCTCCGTGCAAGCAAGCCTTATTAAGTGTTCTTTC
> GATTTGGTACATAAATTTTACCTTCGAACACTATTTCACAGGAACTCAAACACCATTAAT
> ACCTAGTGACTCTCGAGGCGTTTGGGCTAGTTACTTTGGACTTCAGCGTTTGTGAAAGTT
> TAACATATAATTTTTATAAGTATGCGATCCCAAGTTGTTACTTAACTCCCTCCAATGCGT
> CCACAACAACTTTTGTTTAGACAACATCAAGGAATGAGTGTGTGATCTGAATCTACATGG
> ATGAATTCGGTCATTAAAGATGACACGCAGGATTCTCACAGGCCTCCAACCGCCATCTTA
> AATGCAGCCCAAAGTTAAGGATAGCATCTGATTTTGGTAAGGATTGCCCACATGCACTAA
> AACTTGTACCAAGAACAACCCATCCTTTGTTTCCACGGTTTGAGTCTCACACTCACGGCC
> TTAATAGTACCTGTTCTGTATAGGCTTGTGCCTCAATAAAACATAAATAGACCCAAAAGG
> AGTGAGATTGCTCTCGTCAATATTAGAAAATAATTGCGCACGCATGGGGCAGGCGTCATT
> TGAATGCGTAAGATTAACCTGAAAACAAGATGTCAGAATAAACAGATAGAATTATTCATC
> CGTATTCGAAGATGCCCCTTCCTTCTGTATTAAGTTATCTCCGTCGATACAATGTTTCTC
> TTTGCCGCGTTTGGTAATCCGGAAACCGTGGACTATATTTTTGATGCTGCATACTAGACG
> CGTGTGGCGAGAGATTGACTATTTTCGAAGGTGCGTCAAATGCATGCCTGTAGAGACGTT
> AGGAGTAACTAATTAACCTATTCGGCCATACCCTTCGATGATACAAAAAGATAAGATGGC
> TCAGAATTCTAATTGGTGGAGTATGTATTGTCTTACGGGGTATGAAGGCTCATGTTAACT
> TATTAATAGGTAATAAGTAGTCCTGAAAAACTCATCGTGACCCTAAGTTGCATCAGGTCA
> CCTTTTGATGCTTCATTGGTTTGCCGGAATTAAACCTTAACACGTGCCTGGCTGATAGAT
> CGGAGCTTGTTCGTGTCGTCTAGTATTATGCCGGGAATGAAGGGTTCCATTCGTGATATA
> AAATTGAATACAACCCATTGTTCAAAAATAACGTCATTATCCCTTCACTAACCTTTAACT
> TGAGCAATAAAATTAGAAAATACCAATTTTACTAGGTCAGCAGCTTAACTATAGGCTCTA
> ACCTCTAATGAAGATACTTACAGTGATCAAGTGAGTCTTGCGGAGGTCTCGCGGCATATG
> CTGTCCATAGCGCCAGCAGAAATTGTAAAAGCTCGATGAGAGATTGGATAACTGATGATT
> TCTATGCTACGGGGGATGTTAATGTCCGAAACATCTTAAATTTGATTTATTTTGTCCACT
> GGCCTCTACAATACCCTAGGAAAAAAAGAGTAGTAATAATTGAAGTTTAGGAACAGTTGC
> GTCGCCATTTAACTTTAGAGGCTCTAGTTCAAGTCCGTCAAATATGCATTGAGGCAGAAA
> TTCTGCGGATCAAAACAGACGTTAGAACACCTCTGGGTCATAGCGATACCAAAAATCTCT
> TGGTAATTATCTTTACTTCCTTATATTCCCTGAACCTATAATTTTCCAGAGACCGTACTC
> GTACAGTGGACTCAATCCCCACGCATAAATCACCTTCTTTTGCTAGTCCAAATTGTGATC
> TTCAACGTCTTATTATTGGCCGATACATGAATTCGCCTTCAGGTATACTCCAAGCTGAAT
> ATTAGAGTAACACATCGTTTAGTGCACCCCGTTCAATTTATACAAGCTTGTTATTCTTGG
> CTCTAACTGAATATCGAATGACTGAATTAGGTCGGCAACAAGTAGCGTATTTTAGCTTAA
> TATCACGTTTTAACATAATTCCAGCCAATTACTTTCACCCCACTATCTAATAGCCGATAA
> CTGCTCAGCGTTTTAATTGTCAACCTCAAGCGGGATTTTAATTTTGATACGCGACCGATT
> ATTCTGATTAGATTTCGCTGACCTAATACGGAGTAAGAACTGAACAAGGATACGGCGGAT
> GAACGTGAGTCGGGCTAGTTGTTTGTTGCTTCTCTTGCCCTATACGAGAAGAGCATGATT
> CGCGGTGTTTTCATCTGATGATTGAAGGAAATGTATGCAATTAATTAAAGCTCAGAGCTG
> TACTAGGACAGGGGGAGTTTGATGTGACCTGTATACAGAGAACTATACTAAGCCCTCACT
> ATTCGGAACGGATATTGCAGTAAATTCTGACATTCATACAAAGATAAGATCTAGAGCAAG
> CGGGTGAGCTGCCTTCTGATTAAAATTATGTTTTCACGGTCAAATGTCAGCATTGCTGAC
> CAAATGTAATTCTAGGACTTATGCGGGGTACCTTGTCGCGAGGTCCTGAGCAAGAAAGCA
> GTTCCCTGGCATTCGTGCTTGGTGTAATAGTCCACTACTTTCTTAGATAAGCATTTGATG
> AATCGGCTCTTGCATTTCCCTCATTCCGAGAACGCGTCCCACAGACAAAAGCTAGACTAG
> TGACATATACAACTTAAATGTCTCCAAGATAAGGTAGATGGCGGTTTTAGAAATTTGTTT
> AGTAGCCGTACTTAGCAGTCCTTCTCATCCCAAAATCACCATAAAACATATTTGCTTAAT
> TCCAATCTCTCTCATAACGTAGCGAACTTGGAACTACTCATAAGTAATTAAGCGCGAGTT
> ATGCAGATCTGCGCACTACGTTTTTCACGTTTTACTTCGCGCGGCAGCCATCTAATTAAC
> CTATATTAGGAATCGAATCTCTTCGAGTCAGCTAAAGGATAGCTAAATGCGCAGTACAAC
> CAATTAGATGTGACTCACGGGGCTTTCAATTGATTATGGCTTAACGGTCGGGCAAGTCTC
> CCACGCACTCTTTATGTCACAACAAAAATTCTATGTTAGAAGCCACTAAAACATGTGCGC
> GGTGGAAACTGCGAAGTGTGTTATCAAGTCTCTAACCCAAGGGTCCGTACCGTGAAATTA
> TGACCGCAAAGCTGCGGTCTAGAAATGAAGTTAGCAAATTCTTACACATTGGAATAAAGA
> GGTAGCAGCGCCTTGTGTGGGCGTGAGTGATCTCCAGCTTATATCCGCATCAATTACCTG
> GTGTCACACACACGGAAGCAAGAATATAGTTTCTCACTCGGTGTTCGTGTCTATCGAGTT
> ACATGCCTATACGAAGTGATACAGACAAGCTCGTGGAAGAGACTGCTTCCGCAACACTTA
> GAGTAGTCATTATTTTTGTCAGATTAAGTGAGGTTGCAACTGGGGCAGTATTCAATGAGT
> GTGCTTGAGCTTTCCCTGTATCGTCCTTACTTTGATATTGAACAGCAATTTTAGGGAACA
> GTGAAGATACTTAATGCCTCCATCCGTTGCTGAACAAGCAAGTAAGACGTAAACTGAAGC
> CGTGATGGATGAGGAGTGAGAGCATCTATCCAGAGAAGTTAGAAAATACTGGCCACTATG
> CCTGTAGAACTACAGCATAGTAGTTAAAAAGCGAGTTGGTATAACACTAGATGCGCGCCC
> TTCCATGGAGGAGTACGCCCGGACCCTGAGGCACGTATGAGAATTTGCTGGGCTATTGTT
> ACAATGAGGTTCATGCATCGACACTCTCAACGTAAAGGGATGCTTTCGTAGATAACCTGC
> ACATCGCCTCCCGATGAGAGAGATAGCGTACCGGGAAGCGTTTGGTTCATTGGCCGATAT
> TCACTAATGTGTTACACTTTAATGAGTACTCGAGCTACTTCAGAGTTGTTCAAGCGTTTC
> TTTCAGTTATTTTGCAAACACACAGTAGACCCCAAAAAGACTGCTGCGATTGTTTTAAAC
> TTTTCAACGAGTTGAGGCAACACAAGATTCTATTATGCGCTTCGTGACACTCAGAAATCT
> GCACATGGCAATTTAGGAAAAGATACATTGTCCCTATGCTTCGATTGTTTCCGGCTAAAA
> CTGTTGATTGAGCTCGGGCAATATCTGTTTCTAAGGCATAAGTGAAATCCATCTGAATAG
> CATGAATTTTAGTTTCGCACACATAATTGTCCAAACTGTATATAGATGATATCTTGAAAT
> CAGCATTTAACAACTAGTCTATAGTTTAAGCTTCGGCCACTTTGACTGTAGGGTCGGAAC
> TAGTCTCCTACCTTGAGCAGTGGTTCCTTGAGTATAGTCAGCTACGAAGCTAGAATCAGA
> TTTCCACTACCGTGTAAGTATGAGAAATTGTATATCACCTAGACCCCATGCGAGGCCAGA
> ACAACATTCTACAATCTTCACTCCATTCAGTTTAACTGATACTGGATCCAATAACAAATG
> AATTAGCGTTTGTATCAGTTTTGAGGATCCTAATCTTTAAGCTCATTGGTGACGTATCGT
> AAAAACTGTTATTTATCTGGAGAGTTCTTGAGTATGATAATCCACTATGTTTAGTTTTGG
> TATTCCAAGTCATTATTACTTACGTCTGCTTCGTAAAGACAAGACTACATTTATATATTA
> CTCTTCCACAATAAGGCTGCTCAGTACGGCAACCGTTGATAGGATAACGATAGAATGCAT
> ATTTCTAGGCGAGGCAAGACAGCTGATGATACTAGTAGAGCACCGTGGATTAAGCTGGTA
> ACTCTTAAACATGTCTCGAAGTTTACATAGACTATCCTGTTAACCAAGGTGTTTTCCGGT
> GAATTCCCTCTCATCGAAAGCGACACGACTTTATCAGTACCTACTATCCGAACACACCCA
> CAGAAGACGGCTCAAGAGGTTCCCATGAAACTATTGAACTACCAATGTGCTCCTGCGAAA
> GCATTTTTTTGTACATGAAACTACAAGGTCAAAGTTGTCTACTTGGGAAGTGATACGATT
> GTAGAGAATGTAATGGCTCCAGTCCAATTAATTATCCTGTAGTCAACTATGTTCGACCAC
> CAGGGGCGTTTTTATTAGTTGATATAGTGGCTTGTCTATTTTAGTTAATCACAGTCTTGA
> TTCAGTGTTCGATCATAAGTGGTACAAGTCAATTGCGCAATTCAATGTCTAATAGAATGA
> CAAACTTCTTTATCTGATTTTGTGCGAAGTAGTCGAAAACCGATTAAATGCGTTGCTACA
> AGTTGTCCCTTTCGTACTAACTTTAATAGCACGAACCTGTTGACGGAGAAGCTCTAAATG
> ATACTAAGATAGAAAGCAATTATACTAACGTAGATAGGAAAGTAGTCTGTGTAGAAAATG
> ATGGAGCAAGAGGGCAGATGAGGTCGAGATCTAGATGATGAGGGCTTTATCAACGCCTCT
> TGCTAAATATCAGGAACGCCGCCACGACAGTGGGAGTTCTGCGTTCTCAACATCGATGCA
> AATCCGGTGTACCCGCACGCGGTCAACTCTCCTAGACAGTTGACGTCAGACCTCATACTA
> TCAACGTGGGATACATCCTACCTGCAATAACTGGAAAGATCTTACCTTGTGGCACAACTT
> GATAATTTTGCTTAGATCCTATGCGCTTCTCATTGACGGGTCAAATAAAAATCGCTGTTT
> ACACTAAGAATCGAATCTTGCTATAATCAGAAAAACACAGAGAAGTACGACTCACACGAA
> CAACAGAGCCGGGTAGTTTATATCAATAGGAAAGGCCTATCGTAGTCTTATTTAAAATGA
> ACTTTGGAAAACACCTTCAAGACTGAGTAATCAATTGTTCGTGGTCTCAACGCTAAGTGT
> TACAGACTAAAGTGTCCGAACATCTCCTCGGGGATTGATCAAAGTGGACCGTCCAATGAA
> TTAGCTCACTGGAGATATTGGGACGGCAGATAACGTGCTTTCATTCCATAGAACTTCAAG
> CAATATAACTCCAACGCGATGAGTCATTCTCATCCTTGGTTATTGTATTATAAGTATTTA
> GATATCGTAATTTCTTTGACGCCAACAAAGTGATCGAGTTGGAGGACTACAATTACGGTG
> ATCGCGGACCATCAGAGTCTGAAGATCTAAGGCACGTGCGTCTAGGATATCATTAATCAC
> TACCTAGTACAGTCCCCTTAGCCTCTAGATGGTCGATTACGTACGAAGGGCGCGAGCGTG
> ATGTTTGAGTAGGTAATTAAACCCTTAACTAAAGCCGCACTCAAATTTTATATGTCCCTA
> CCTGTCGTTTCACACCTAACTCTAGCCTCAAGGTGGTACCCGTTCTCGTTGAAGGTCGTC
> TATAAGTATTCAGATTAGCATCTAATGCGATCTAACTTATATATTAGCACATAGGGACAC
> GCGACCGAACTCCTGAAAAGTCTGATCCCGAACAAGTTCGCGTCAATACATAGCGTGAGT
> GGGCTCGAGAAGGGAGGGGGCGTTTTTGACGAAACTTGGAGTCACTAGTGTATGTAAGAG
> ACTGACATTACTCGCACGTCCAGCGTCAGCTTAAGATCGAAAAGCCGGGTATGTTAAACA
> TATTCACTTAACTGAACTTGGAAAAGTATCATTCATTTATGTCACGAGTTTTTCATTGTT
> GCCACGCTCCACCGAGTATCTTCTAGCAGTTCAGGACCTGAGTATTGTCTCTCGAACCTT
> TCTTCAAAAATGTGAGAGACATAAAACGATTTGTCTCCTAGGATAAATTAGACGTACGTC
> AGAAAAATTGAGCGAATGGATTTTCTGATCATCTTCTCTTAATATTCCAAAGGTGCGAGT
> GGGTGTAACCACACGCGAATTTGAATAGCGAAATGTATGTCGCCATGCAGAGAAAGTAAG
> TTTACCATGATGCACGGTCTAGAACTGAATGCCATTATGATATTTAACAGATTCTTTAAT
> CGTAACGGATTATCATATAAAGTTCCGTCGTTATAATCTTCTAAGTTCATTATATGCGTC
> ACAAAGGTGCCGTGAAACCGTGCCATATTGAACATTTGCAAGTCAGAAGTAATGAGATTC
> GTCATTAAAACAGAGTCGGAAATATCTCTTCGCTTAGAGACAGCATTAATTTTATTCCTA
> CAGCTTATCATTAGGGTAGTTATACTTCGTGACATATACTCTGCCTAGCCGGTTACCTTA
> TTGGCGACACCAGCTTTTCAACGATACATTAATATTAACCGTATTAATTTACTCTAACCC
> ACAAACTAATCGTTATTAGGGGTGTCGGTATAGAAGATGTGAACCCAAAGGGCGGGAGAA
> CATCAGGGAACTCCAAAGTTGCAGAGATAGATGACGCCTGTATAGTTTAAGTATAGGTAT
> GTCTAGCCTATTAGTCCCCATACTTATCCAACCAGACAGCCGATAGGAAAGTCCGAATAG
> TGTATCCGCTAAATTGTACTATGATTCTGGCCACCCCAAGCCCATTTCATTAGTCTAGTA
> ATAAAGTTAAGACTTGACAGGGTATTTCCGTCATATAAGAGCTTTGAGAGTAAAACAAAA
> TCCAGTGTTTTTCGTTGAAGGTTTCTCCCTTCCTGTTTACTAAGGATCCAAAGTATAATA
> AAAATCAGGCCAAGTACGAGAATTTACTTATATCTCGTGAGTTATAATTGATAGTTGGAC
> TAGACGATAACCCGTAGAATTTCACTGGAGAATGTGGCGTATTTCCTCTTACTGATTTTC
> ACTAGGTTAACTGTCAAATTGATATTCAAGCTGGACTATATAATACCTCGAAAATAGGTT
> CCCTGTCAATACTTTTGTTTAAGTGGTGTAAGGCAGGACTCGATTGACGATAGGCAACAT
> CTCGCAACCTGAAAAAGCAGATCATCGTGTCTTATGTATAATGAATCCCATCTATTGTTT
> GTAATATGCGGATTACACGCTGCGAGCAATTTTAGCTTTAGGTGAGTTCTAAGTATCGGT
> GATATATCAACTGTACAGGTCAAACTCCACCCTCTTGACATGAAATGAAAGCCGTATAGC
> TAAATGACTGGTAAGCATTATTTCACTTGGCTTTCTATAGTTACACCGACTCCACATCCG
> GATTTATTATCTTCTGTTATATCCGTTTAACGCGAGTATGGTGTATGTACGACTCAAGGA
> TGTTTTTAACCGCATTGGTATTTGTGAAATCTAAAGCGGCTTATGTGCGGGGGTTTTTGC
> CACGTCTTTATTGTCCACTTTGAACACTTACGCACAATTTTATACTTACATAGATAAATG
> GTTTGGGGTAGGTGTGAGCCTTACTTCCCGTTAAGACTCACGATCGTATGATTAGAAGCC
> GGTAATACCGTCTAGACGCAGTCCCTAGGCCTGTACAGACCATCATAGTGTGGGATTCAG
> GCTTCCGATGTAATACTCCCACGTCAATAACTTGAGCAGTGGCCTTTTTCATCCCTTGCT
> GAACGTATTACGGAACAGTTTTAGTAATACTCCCGTAATGGGGATGTCCCTCTCGGGCTT
> GAACAAAATGTGCGTAGTGGGCCATTAAGAAGCCCCTATGGTTAAGAAAACGAAACATCT
> TCGAGTAGTTCGGGCATCTGCTTTCTTCGGACTTCCACTTTATACAGTTATCGTTTGTTA
> AACTCGTGAATTCCTACGTTTTTTTTAAGAAGGGTGTATTCGTAGAAATTTTATGGAAGT
> AACGTGTGCGATTGACGGTTTTACAAGCAATGCTCGACGCAGCTAATTACACAAAGTAAC
> TACACATTCACCTTGTTTCATCGTCAAAGTTTTTACATATTAACCATTTGGTGGTGGATT
> TCAAGGAATAGCTAGTCATAAGACGCCCGCACAGTGATTATTAGGTCAAGTCATCATGTT
> TGAGTAGGCCCCTCCCAATCACATAAAGCCGAGATATTTACTTTGTATAAAAGGTCTAAA
> TACAGTATACACAGACAAGATTACAAGGCGCGATGGTAGGACACCTCCTCGATGATTCAT
> GCTGCGGAGTATCGGCTGTATAACCCTGATTTTCCTGTAAGGCTTCTAGACTTTAATATA
> CTACGACAGAAAACAAAAGGTGTAATAGATAGTCTTTAATAACCACTAACATTTCGTCAA
> GTTACTCATCACATATTTTTTATATGATGGTAGGGACTCAATATTTTTTTTCTTTTACAT
> TTTTTTTGCCATTCTTTCTTGTCCAAGGACGTGCGGTCGAAACCATAGGAATAATTACCG
> TCAATATATTAAAAATGGCCGTAAATAGCGCCGGGTAAGGCGGGATAGTAGCCGAGACCG
> ATCTTAGTAAATATAACTTAAACTCCTACGATCCATTAATGAATCCGTGTAGCATATCGA
> CTATGGTGGATAATAAGCGTCACGGACGTCCATAAATGATAAAGTATATGTATGCAGGGC
> AGCTCCAGCAAATCAGTTAGTTTAAGGGAGGGGGTTACCTAATAAAAAGGATGGGTGACT
> TTAGTCGCCAACTCAGCATAGCCATTTCTTCGCAATAACAGAACAAATACTGGTGATATG
> GGGTAAAAACTCATTCTTAGTGTATTGCACTCAGCATCAGGGAAGCATGGTAAATTATAC
> CCAGTTGTAGCTTCGACGTCATCCTTACGGTGGCGCACCCTATGCAGAAGATCGTTCTTG
> CAAAATGCTGACGCTGTGTCAATCAAAGGGGGGGGTCGTGAATCACTATGTGAGAGATCC
> GTCGAATCGTGTACGCCAGTATATAATATTATTAACTGCATTTGGCTTCCATTATAATCC
> CTTAGGTGCTACCTACGGATGTATCGTTCATTTATTATGGGCTCTAGAGAAATTACAGTG
> GTAGCTCTGAGCCTCTTAGCAATTCGTCAAGATTTAGGGTCCCAATCGACTCCTTGCGGC
> GCCCGGTACTTTACTCTTAGTTGTCTCGAAGAGGGTGCTTCGCCTCAAAGTTACAAAGAT
> CTTCAGTTGATATGATCGGTAGTCTTTGTGTTCTGTTTATATTTCAACTACAGGAGCACG
> TCGTTTAAGTGGTAAGGTATATGGCTCCAAGCGACTGACTATTCTAGCCGCAAAAATACG
> GTCTTTCGGAGTTAACGTATGTTTGAAATTTTGTCGATCAGGTTCCAGTAGCATAGGCCC
> AAAGATTGAATCCAATTTTCAATCATTTACGGACATCCTTACGGCTAAATTAAAAATGGA
> ACAAAATTTAAAATCCTATTGCTGCGCATGCACCTGGACTCGCACAACGCTGCGGCTCTA
> CGTCCGTCTTATGCGATTCTTTGCCAACCTTATTTCTTACCGATAAGCAGGTGAAGAAAC
> TAGTGATTTAAGTACTTGTCCGCGCACAGCCGATAATGGGTCAAGGTTATGAAAACCTCG
> ATAATGATCAATGATAGCACATGTCTGGTTACCGGGCTTTAGGCAACCGTGACATATGGT
> TTCTTGCTCTTCAACTTCGAAGTTCGCTCATTATTCAAAGTTCCAGGAGCTCTATATGGC
> GTATGTGTGTCATTTTAATATACTGAAGTTACCAGGCATCACTATAATAGCTTCTACAGC
> ATAAAAGTTCTTTTATTTGGAATAAGTAGGGCTGTTAACCGGTCCAATGGGGTATCATAG
> GTAAGGTTAGCATCAACTCAGCTTAGTTTGTATTCTGCCGTCGCAAACTTAGCATATAGG
> ATATCGACTGATAAGTAATCCCACGGTGGAGGTGGCGCAATGATCTTTATGCTTGCCACC
> TGGATATATCTTTAAATGTCAGTTTAGGTCATACTATTAAGATTGTCCCATTTCTAGTAG
> TCCCTTAAAACAAACTCTATCTATTAGTAAGATTGCTTTGAAGAGGCTATTTGCCTACAA
> GGAGGTTCAAATATGCTCGAAGCAGTTGTTTCGGACTATTAACTAAACTTATGGAAGATG
> GTATCCATTCGCTAAGAGTGCTATCTCTGGCTTACTAAAGAGTTAGACAACTATTGATGT
> CCGCTCACATAACGTAATATCCAAACGTGTAGACAATAGCAACACTAAACGTATTACTAT
> TTGAAAAATGAATATATTCCAGAACCACGTAGCGCCTGGAATTGCCAAGAGCTCTGATGA
> AGTGAGACAATTGGCTATTCTTATTGCATTGATTCTGAAAACGCTAGCTTATCCCCAGTG
> GAACAAATGAAGGGGAAAGGGTGGGAGGTAGTCACATTGATCATAACAAGTTCGATATTT
> AGATGGCAGACGTTAGGGTAGGGCAGTAATCGGGATTGGGCTTTGGCTAACGGGAGTTAT
> GTTATAACTTTTCGTTGAGTCGTAAGGATCTCACTATCGCTCCGTGGGCTTTACATACCA
> GATAAAAAAGTAGACCTGATATGCTCTAGCACTGAATATTTTTAAAAATAATCGGATTTT
> AATCCAGTGCAACAGATCCGAGGTGCGTTCCATCCCTTTTCATTAGCTGGCTTTCATCAT
> ATTGTATTGCATTACTTTCTCGTGCAAAAATTGTACTCAGTTTAATAATGAGACGTGTGA
> GTTTTCTTATATCCCCAAGGTAACAAGTTTCCTTGTGTACGGGACACCGCGGTGGAATGC
> ATTGTATATCGATAGCGGTGTAAGATGCCTCACAACGAAAAGGATGACTGTTTCCAATTT
> CACTCAGAGTAAGACTCGAAGAGCCCTTAATAAATTATATGACCGAATATCCTGAGACCC
> GATGTTGAATTTATTAAATTGACCACCCTGGATACCACTTTCTGAACTAAAAGATGCGTT
> TCATTCTTAGGACTGCTTTATTAGGGTTGTAGAGGCAGTAAACAGCATAAATAACTCCTA
> CAAAGCATTAGGTTCTGTGATTTCCATGTCGTTAATTAATTTTAAATTAGTTAACTATTT
> CAAAGGAACTCAAAAACCTTGTATACCTAGTCACTATCGAGGCGTTTCGCATAGGGTATT
> GCGACTGCTCACTTTGTCAATCGGTAAAATTTAAGGGTTTTTACTATGACTGAACAAGGT
> CTTAATTAACTCAATCCAATCCGGCCTATTAAACTTTTGGTTAGAATTCTTCATGCAAGG
> TCTCTCGGTGAGGTAGCGAAATCCATGTATTAGCTCATGATTGAGCTCTCCAACGATTAT
> AAAACCCATACATCCGAAATCTTATATCAAGCCCAAACTTTAGGATAGAATCTCATTTTG
> CTTAGGATTGCCCACTGGCAATTAAACTGGTACCATCTACATACAATCCTTTGTTTAAAC
> GCGTGGTCGCTAAAAATATAGCCCTTAATAGGACCGGTTATCTATTGGATTGTCACTAAA
> TAAAACATAATTAGACCAAATACGTGGGTGAGTGATCGACGCAATATTACATTTTATTTG
> AGAACCCATGGCCCACGAGTATTGTGTATCACTAACATTAACCTGTATACTAGAGGTCAC
> ATTTTTATGATACAAGTATTCATCCCGATTCGAAGATGCACATTACGTCTGTTTTTTGGG
> ATATACGTCGATAATATCTTTCTCTGTGAACCCTTTGCTAATCAGGAATCCGGGCTATAT
> TTTTTGGATCATCAATTAGTGAAGCGTCGGGCGTGAGATGGTATAGTTTCCAACGTCAGT
> CTTTTCCATGCCTGGTCAGTCCTGTGGACGAAATATTGAACAGTTTCCCCCTGACACTTC
> CAGGAGTCTATTTGATATCATCGCTAACAATTCTATGTGGTGGTGTATGTATTCTCTTTA
> GCGCTAGCAAGCCTCATCGTAAAGTATGATTTGGGATTTAGTACTAATGTAAAACTCATC
> GGCTCACTATGGTGAAGCAGGTAACATTGTGAGCCTTCATTCCTTTGACCCTTTTAATCA
> GTAACACGTCCCTCCAGGATACTGCGGACCTGCGTCGTGTAGGATACTAGTAGGACCCCT
> ATGAAGGCTTCAATTACTGATATTAAATTCTAGAAAACCCATTGTGAAAAAATTTCGTCA
> GTATCAATTAAATAACCTGTTAATGGAGCATGATAATGACATAATTCAAATTTTACTTGC
> TATGATGATTAACTAGTCGCGATAAAATCGTATCATCATAATGAAACTGATCATCTCACT
> CGTCACCACCTCGCGAGCAAGTTCCTGGCAAGAGCGCCAGCACAAATGCTATAAGCTCGA
> GGAGTCAGGCCATAACGGAGGATTTCGATGATACGGGGGTTGTTATTCTAAGATAAATCT
> TATTGTGGATGTTTTTTGTACACTCGACTATAAATTAAAATAGCTATATAACTCGTGGAT
> GAATTCAACTTGACCAACTGTGGACTAGCATTTTAACTTTAGTCGATCTTCGTCTTCTCA
> GTAAATTTTGAAGTGACCCTCAATTTCGGACGAGCAATACTCAAGTTTCAAAACAGCGGC
> GGAAGAGCGTGTCATAATATCGCTTCCTTATGAGCTTTTCTTACTTAGATGCCAGGAAAC
> TATTATTTGAAAGAGTCCCGAATACGAATCTGGACTATTGCACAACCATTAAATAAAAGT
> CGGGTGCTTGGCCAATTGCTGATCTGCTAAGTATTATTTGTGGACGAGTCATGTAGTCCA
> CGGCACCTATAATCAATCATGATTATTAGACTAAAACTTAGGTTAGTCAACACAGTGCTT
> TGGATAAAACCTTCTGAGTATTGCCTCTATCTGAATAGAGAAGGACGCAATGTGCTAGGC
> AAAATCTACCGTTTTGTAGATTATTAGATCGGTTTAACATATTTAAAGCAAAGTAAGTTC
> TACCAAAGATATTTTACAAGTGAAATGCTCACACTGTGTATTCTCATCATATTCCGCGAT
> TTTAATGTTGTTAACACAACGATTATTCTGTTTACATTTCGCTCAACTTATACGGAGGAA
> GTACTGAAAAACCATAAGCCCGTTCAACGTCACTCCGCCTTCTTCTTGGGGGATTCGCTG
> CCAATTTAACTGAACTCAATGTTTCCCCCTGGGTTCATATCATGTGTGAACGATATGGTT
> GCATTTTAGGATAGATCTCAGCTGTACTTCCACTCGCGGACGTTCAGCTGAACTGTATAC
> ACAGATCTATACTATGCCCTAACTAGTCGCATCGCTTATTCATCTATATGATCACATGCA
> TACAAACAGAAGATCGACTCCAAGAGCCTGTCCTCAAGTCTGAGTAAATTTATGGGTGCT
> AGGTATAATGTCAGAATTGCTGACCAAATGTAAGTATTGGTATTATCAGGGCTACATGGG
> CGCGACGTCCGCACCTTCATAGCAGTGCAATCGCATTAGGCATGCCGGTAATAGTAATCT
> ACTTTCTTAGTTTAGCATGTCATGAATCGCATATGCCAGTGACCTATGGACGACAACCAC
> TCACACAGACATTTCCTAGAAGACTGAAATAGACTAATGTAAGCTCTCAAACTTAAGCGA
> GATGCAGCTTTTACAAATGGCTTGAGTACCCCTTCTTTCCACGCAGTCTAATCAAATAAT
> CAACATATATAATTTTTGAGTAATTCAATGCGCTCTATGAAACGACCGAAATTGCAAATA
> CGATGTAGGTATTTTCACCGTGTTAGCCACATATGCGAACGACGTTTGTAACGGTGTACT
> GCGCCACGCAGCATTATAATTATCCTATAGTACCATTAGAATCTCTTCGTGTAAGCTAAT
> CCATAGCGAAATCCCAACTAAAAACAATTTCAGGTCACTCACCCGGCGGTATATGGATTA
> TGCCTTTACGCTCGGGCAACTCTCCATACAACGAGGGATGTCTAAACAATAATTCTATGT
> GAGAACACAATAAATAATGGGAGAGGGCGAAAATCCGATGTGTGGTAGAAAGGATATTTC
> CCAACGCTACGTTCCGTGAATTGTTCTCCGCAAAGATCCGGTCTACTTTTGAACTGACCA
> ATTTCTGACACATTCCTTTTTAGACCGAGAAGAGCATTGGGTCCCCCTCAGTGTTCGCCA
> GCGTATTGACGATTAATTTTCATCGTCTCTCTAACAACGTACCTAGTATTTAGGTTATAT
> ATACCTCTTCGTCTCGATCGTCGTACATCCAGTTTCGAAGGCATAAACACATGATCGTGG
> ATCTCAATGCTGACGAAACACTTACAGTACTAATGAGTGGTGTAACATGAACTGACCGGG
> CAAATGGGGATCTTTTCTATCACTGTCATTCAGATTTCCATGTTTCCTCATTAATTTCAT
> ATTGTACACCAATTGTACCGATATCTGAACTTTATGAATCCATAATTAAGTTGATCAAAA
> AGCAAGTAAGTCGGTTTCTGTAGACCTCATGGATCACGTGGCAGTCATTCTTTACAGTGA
> AGGGACTTAATTATGGACACTTTCCATGTACATATTATCCATTCTTGGGATAAAGAGTCT
> GCCGATAACAAGTCATGACACCCCGTACATGCAGCACTAAGCAAGGTAAAGGACGAACCT
> AGCACAATGTGATCGGATATTGTGAAATTGACCTTAATGAAGCGACTCGATCAACCTATA
> GGCTTGCTTTCGTACATTACCGGAACAGCCACGACAGTTCACAGAGATTGCCTAACGCCA
> AGCGGGTGCTTCAGTGGACCAGATGCACTAATGTCTTACTAGTTAATCAGTAATAGACAT
> TATTCACAGTTCTTCTAGACTTTCTGTCACGTTTTTTCATTTCTCAATGTAGACCAAATA
> AAGAATGCTGCGATGGTTTTAAACTTTGCAACGACTTGACGAAACTAAAGTGTCTATTTG
> GACCTGAGTCACACTAACAATTCTGCACATCCATATTTTGGAAATCATTCATTGTCCCGA
> GCAGTAGAGGGTTTCCGGCTAAAACGGGTGTTTCACATACCGCTTTATATGTGTAGTAGC
> CATAACTCTATGCCATCTGAAGTGAATGATTTTTAGTTTAGAACAATTAATTGTCCAAAC
> TGTAGTTACTTGTGTTATTCATATCACAATTTATATTATACTATATTCGTTAACATTAGG
> AAACGGGGTCTCGAGGCTCGCAAATAGTATACGAACGGCTCCAGTCGTTCATTCAGTTGT
> GTAAGATACCATGCTAGAAGCACATTTCAAATACCGTCTAACTATCAGAATTTGTATAGA
> ACCGTGACACAATGACTGCCATGTAAAACTTTATACTATCTTCAATCCATGCTGGTGAAA
> TGTTAAGGGAGACATTAAATATTGAATTACCCTGTCTATAACTGGTCACCAGCAGATGAT
> TTTTGAGCTTTGGTGAAGGTTAGTATAATCGCGTATTTAGATCCTGAGTTAGTCACTATC
> AGAATAAAAGAGCTTTACTTTTCCTATTCCTAGGCTTGTGTACTTTCCGAGGATTAGGAA
> ACACAACAAGACATGTATTTATTACTCTGACAAATTAACCAGCCTAAGTAACGCAACAGT
> TGTTACCATTACGTGAGAATCCATATTGCTTGCACAGGCATGAAAGCTGATCAGACTAGT
> AGACAACAGTGGTTTATGATGGTAACTATTTAACATGGCTCCAACTTTTCTGACTCTAGC
> CTGGTAAAAAAGGTGTTGGCAGCTGTATGAAATCGCAGCGTATGCCACACGACGGTTTAT
> GTACCTACTATCCGTACACAACCTAAGAAGAAGGCTAATGACGGTCAAATGAATATATTC
> TACTACAATTGGCCTACTCACATAGATGTTTTTTGTAAATCATACTACATCGGAAAAGTG
> GTATTCTTCCGATGGGTGACGATTGTACACAAGGTATTCGATCCTGGACAATGATTTAGC
> CTCTTGTAAAAGATGTTAGTCAACAAGGGGAGTGTGTTTTTGTGCATTGACGGGATGGTA
> GATTTTACGTATTCACACGCGTGATGCACTCTTCGATCTTATGGCCGACAACGATATTGA
> GCATGTAATGGTATAATTGTAGCACTAACTTCTGTATCTCATGGTGTCCGTAGTAGTCGT
> AAAAACAGGTAAGGACTGGCTACTAGTTGTACATTTACTACTAACTTTATGAGCACCAAC
> CGCTTCTCGGACAAGCGAGTAAGCTGTAGAAGAGAGAAAGCAAGTATACTAAACTTGATA
> CGATTGGTGTATCGGTAGTATATGATGGAGCAAGACGGAACTTGTCGTCCTGTTATAGTT
> GATGAGGGCGGTATAAAAGCATATTGATAAATTGAAGGAAACAAGACTACACACTCCGAG
> TTCTCAGTTCTAAAAAGAGAGCCAAATCCGGTGTACCACAACGACGGAAAATCTCAGAGA
> AACTTCTACTCTGACATAATAAGATAATACTGGCATACATCCTTAATCATATTAAGCGTT
> AGTTCTTACCGGGTCCAACTACGTCATTATTGTCCGTAGATAATTTGCCCTGCGCAGTGA
> ACGGGCATATAAATATACCTGGGTTATCGATGAATAGAATCTTCATAGTTGAAGTATATA
> TCAGAGAAGTACGTCGCAAAACAACATAAGAGAACGGGTCTTTTTTTATTGTCCAAAGCA
> CGATACTACTATTATTTAAAATGATATTTGGATAACTCCTTAAAGAATCTGTAATCAAGT
> GTTCCGGGGCTCAACGCTAAGTCTTTAACAATAATCGCTCAGAAAATCGCATACCGCATT
> GATAATAGTGCTCCGTACATTCAATGACCTCAATGGTGATTTGGGGACGGCTGATTACGT
> GAGTTATTTACATACAACGTAAAGCTTGAGAACTACTAAGACTTCACGCAGTCTAATAAT
> TGCTTATGCTATTATAAGGATTTACATTTACTATGTGCTGGGACGCCAAAATAGTCATCC
> ACTTGGAGCAATACAATTACCCGCATAGACGACCAGATGAGTCGGTAGAGATATGCAAAG
> TCCGTATAGGATTTCATTATGCACGAACTTGTTAAGTCCACTGACAATATTGATGCGACT
> TTACGTACGAACCCCCACACCGTGATGGTGCACTTCCTATGTAATCCAGTAACTAAACCC
> CCTAGCTAATGTTTTATCTACATTCCTCTAGTTTATCTACTATCTCGAGCCTCAACGGCG
> TACCCCGTCTCGTTCAAGGTCCTATTTTACTTTGCTGATTAGATTAGTTTGCGTTCTAAC
> TTATATAGTAGCACATAGCCACAAGACAAACAACTAATCAAAAGGCTGTTCACCAACTTC
> TTCGACGAAAGAAAGTGACTCTCTGGCCTACTCATGCGAGCCGGAGTTTGGCACCAAAAT
> GCCTCTCACTAGGCTTTCTAACTCTCGCTAAGTTAGAGCACCTCAAGCGGAACCTTATCT
> GACTAAACAAGCCTATCTGTATAATAGGCAATTTACTCAAATTGGATAACTATAATTCAT
> TTTTCGCTCGAGGTTTTCATTGGTGACACCATACACCGACTATCTGCTACAACTTATGGA
> CATCAGTTTTGTCGATAGATACTTTAGTCAATAATGTGACAGACATAAATAGTTTTGGCT
> CATAGCATTAATTTCTCCTAAGTAAGATTATTTCAGCGAATGCATTGTCGGATAATCGTC
> TATTAATATTACTAACGGCCCACTCGGGCTTACCACAACCGAAGTGGTATACCGATATCT
> AGCTCCCCAGCATCACATACGAACTTTACCATCATGAAAGCTCTTGATCTCAATGCCATT
> ATGAGATTTAAAAGTTTATGGTTGCGTAACGGTTGATAATAGAAACTTCCCTCCTGATAA
> TCTTCTATCTTAATGATATGACTCACTAAGGTGCCGTCTATACGTGACAGATTGAAATTG
> GGAAAGTCTCTTCTTTGGACATTAGTCATTTAAAATGAGGCCCTAAGAGCTCGTAGCGGA
> GACAATCATTTAATGTTATTAAGACAGATTATCATTAGGGTTCGGTGAAGGCCTGTATTA
> GAATATCCCTACAACGGTTAATGTTTGGCCTAAACACATTTGCAACGTTAAATTAATATT
> AACCCTTTTATTTGACTCTTTCACACTATCTAATCCTGAGTACGGCTCTACGTATAGTAG
> TTGTCATCCCAAACGCCCGGACTAAAGAAGCGAACTACAAACTTCCTCACATAGATGTAC
> CATGGTGACTTTAACTATACCTATCTCTAGCATTTTTGTCCACATACTGATAAATCCTCA
> CAGCCCATAGGTAAGTCCGATTAGGCTAGACGAGAATTTCTACTATGATTCGGCCCTAAC
> ATTGAACTTTTAATTAGTATAGTAATTATCTTTAGTCGTGAATGCGTAGTGACCGAATAT
> TACAGATGTGACAGGAAAACTTATTACAGTGTTGTGCCTTCAAGGGTTATCACTTCCTGG
> GTACTAAGCAGCAAATCGATAATAAATTTCTGGAAATGGACCAGATTTTTCGTATAGCTA
> CTCAGTTATAAGTGAGAGTTCCAATACTCGTTAAACCGTTCAATTTAAATCGAGTATGGG
> CCCTATGGCATATGAAGCTGGTGAAAGACCTTTACTGTCAAATTGATATTAATGCTCGAC
> TTTATAATACCTAGAAAATAGCTTCCCGGGCAATACTTTTGTTTAAGTGGTGGAAGGCAC
> CAAGCGTTTCACCTTACCAATCATCTAGATAACTGTAAAACCAGATAAGCCTGTATTAGC
> TAGAATCAATCCCATCTAGGGGTTCTAATATCCGGATTTCACGCTCAGAGCTAGTTTACC
> TGTTCCTCTGGGATAACTATAGCTGATATAGCTACTGTACAGCTCATAATACAAACGATT
> CAATTGAATGCAATGCAGGAGACCTAAATGTATGCTTAGCTTTTTTTCACTTCCCTTTAG
> AGAGTTACACAGTCTACTCATCCGGATTTAGGTTATTCTCTTAGAGCCGTTGTTCCCGAG
> GTTGGTCTTGCGACCTCTCAAGGTGGGGTTTATCACAATTCCTATTTGTGTTTGCTTAAC
> CCGATTTTCGCACCGCGTTGGTGCATCGTCTTGATTGGACACGTTGTTAAATTACCAACT
> AGTTTTTTAGTACATAGTTAAAGGGTTGCCCCTACGTCTCAGCCTTTAGGCAACGGATGT
> CTAAAGAGAGTTTGTGTTGAACCCGCGAATTCAGGCTAGAAGAAGGCACTTGCAATCTTA
> AGTCCATAAGAGTGTGCCTTTAACGCTTCCGTGGTAATAATACCTAGTCATGTAAGTCAG
> AAGTGCCATTTTGAATCACTGCCTCATAGTATTACGGAACACGTGTACTTATAATCAACG
> AATCCCGATCTCCCTCGAGCGAGTCTTCAATATGGCAGGAGTCGGACATTATCAACAACC
> GAGCCTGAACAAAACGTAACAGATGCCAGGAGTTCGCCAATCTCCTTGCTTCCCACTGCC
> AAGTTATACACTTATCGTGTCTTAATCTAGTGAAGTACTACGTGTGTTTTAAGATGCCTG
> GAGTAGTAGAAATGTTATGCATCTATCCGCTGCGATGGTACCGGTTTATAGAAATGATCG
> AAGCAGAGAATTAAACTATGTTTCTTCAAAGTCACCTTGTGGAATCGTAAATGTTGTTAC
> TTTGTATCAAGTTCGTCGTGCAGTTCTAGCATGAGATACTCTTAACACGCCCGCTCTCTG
> AGTTGTAGCTATAGTCATCATGTTTGACTAGCCCCATACATAGCAAAGAAACACCACATA
> GTGAAGTGGTATAATAGCTCGAAAGACAGTAGTAAATGACTAGATTTCAACGAGCGAGGG
> GACCAAAACTCATCGATGTTTCAGCATCAGGTCTATACCATGTAGAAACCTCATTTGCCT
> CTATGCAGGCTACTCGTTAATTTACGTCCTATCATATCAATAGGTGTAATAGTTTCTCTT
> TATTATAAAATAAAATGTCGTAAACGTACTATTAACATTTTTTTTATTGCATGCTTGGCA
> ATAAAGAGGTGTTTTCTGTGACATTTTGGTTCCCATGAGTTCGGCTCATTCGACGTGAGC
> GCCTTAAAATTCGTTTTTTTACCGTCAAGTTTTGAATAATGCCAGTATATAGAGCAGCGT
> ATGCCCGCTGACTAGACGTCAACCATATTTCTTATTATTAATTATAATACTACGATCCTT
> TAAGGAAGACGTCTAGCATATAGAATATGCTGGTGTTTAACCCTCACGCACCTAAATTAA
> TGATTAACGAGAGCTTGCAACGCAAGCTCAAGCATATCACGTAGGTTATCCCACGGCCTT
> ACCTAATATTTACGAGGCCTGACTTGTGTAGAATACTAACAATTCAATGTTCGTCCATTG
> AACAGATAATTTACTGCTGTTATGCCGGAATATCTAATTAGGACGGTATTCATCTAAGCA
> TAAGGCTACATTGGTTTAGTAGAAACTCGTGTAGCGGAGTCGGCTTAAGGTACGTCGCCA
> AACAGATCAACTACTTCGTTATTGATTAATCCTGAAGAGGTCTCAATAATACGCGGCCGT
> CGTCAATCTCTAGGTCAGACTTCCGGAGAATCGGGTAAGCCAGGATTTAATTTGATGAAC
> GGAAGTGCGCTTCAATTATAAGACCTTTGGTCATAAAGACGCATCGATACTTCTTTTATT
> TGGGGCTATACACTTAGTACAGTCGTACAGCTGACAATAGTAGAAATTAGGCAAGATTGA
> GCCGCCCAATCGAATCCGTGCCGCGCAAGCGACTTGACGCGTTCTTGTCTCGAAGTCCCT
> CCGGCGACTCAAACTGAAAAAGTTAGTCTGTGCTGATGAGCGCTACGCTTTCTGTTCTGT
> TTAGATTGCATCTAAAGCACCACGTAGTTTATGGCGTTAGGTATATGGCTCAAACCCACG
> GACTATTAGTCACCAAATAATTCGCGCTTTCCCTGGTATACTATGTTTCAAATTTTCGCC
> ATAAGCTTCAAGGACAAGAGCCACAATGTGTGTAGAAAATTTGCAAGCAGTTTCGCACTT
> CATGACCGCTATAGTAAAAATCGTAAAAATGGTTTAAGCCTTTTGCTGCCCTGCAACCGC
> GACTCGAAAAAAGATGCCCATCGTACTCCGTATTTTGACATTCGGTCACAACCTTTTTTC
> GGACCGATATGAAGCTGAAGTAAATACTCAGTGTAGGACTGCTCAGACCACAGCCGATTA
> TCGGTAAACGTGATCTAAAACTAGATAATCATAAATCTGACAACATGTATCGTTTCCCCG
> CTTGACGCAAACGGGAAAGTTGGGTTCTGCCTATTCATAGTACAAGTTAGCGCATTATTC
> AAAGTTCAAGGAGCGAGATATGGAGTATGTCTGTAATTTTAATAGACTCATCTGTACACG
> AATCACGATATGAGCGGCTAATGCTTAAAAGGTCGTGTAGTTCGTATAAGTACGGAGCTT
> ATACGGGAAAATGGGCGATATTACCTAACGTGTGCAGCAAATCAGAGTAGTTTCGATTCT
> CACGGCCCAAAATTAGAAGATACGATAGAGACGCTTTTGGAATACCACGGTGCACCTCGA
> GCAATGAGCTTTATGCTTGCAACCTGCATATATCTTTAAAGGGATCTTTTCCGCTGACTA
> GTTACTTTGTCCCATGGCTACTAGTCAATTTATACTAACGCGAGCTATGAGTTACATGCA
> GTTGAACTGGAGTTGTCCATTCTACGACCGGCAAATTGCCGCGTAGCACGTGTTTACGAA
> TAGGAACTAAAATGTTCGAAGAGGGTTTAATTTAGAGTACACTGAGAGATATCGCGTAAT
> AATGTGGTACAAAAATATGCATGTACCCGCAAAGTAAGTTTTTTCATAACCTGTAGTCAA
> TAGCAACAATTATCGTATTACGATTTCAATATGGTATTGATTAAAGAAACACGTAGCGCC
> TGCATTGGACTTGAGAGCGGATGAAGTCAGACAATTGCATAGTCGGATTCCTTTGATTAT
> CTAAACGATAGATGTTACCCAGGCCTTAAAATGAACCGCAATGCGGGGGAGGTTGGCTCA
> TTGAGCATAAATTCGTCCATATGTTGATCCCACTACGTTGCGTAGGGCTGTATTAGCCAT
> TCCGCTTTCGCTAACGCGTGTGATGTGTGATCTTGTACGTGAGTCGTAACGATCTAAATT
> TCGCGCACTGGGATTTTAATAACAGAGAAAAAACTACACATCATTTGATATAGAAATCAA
> GATTTTTAAAAATATTACCATTTTTTTACAGTCAAACAGTTCAGACCTGCCTTACTTACC
> GTGTCAGGTGCTGGCGTTAATAAGTTTCTATTCAATTACTGTCGACTGAAATAATTCGTA
> TCAGTGTAATAATCTGACGTGTGAGTGTTCTTTGATCACAAACCGTAAAACTTTCCGTCG
> CTAACGCACACACCCGGGGAAGGATTTGTAGATCGTTACAGGGGTATGAGCCCTATCTAA
> CTATTCGTGCTATGGTTCCATTTTAAATCAGACTAACAATAGAACAGCCATTAAGAATGT
> TTAGGACCGAATAGCATGACACCCCATCTTGAATTTATGATATTCTCCACAATGGATACA
> AAGGTCTCTTCTAAAAGTGGCCTTTCATTCGTACGACGCCTTTAGTTCCGGTCGAGACGA
> AGTTAACTGCATAAATAACTCATACATTCCAGGAGGTTCGCGGATTTCCTTGTCCTTATG
> TAAGTTTAAATTACTTAACGTTGTAAATGGAACGAATAATCATTGTATACAGACGCTATA
> GAGTGGACGTTCGCATAGGGTATTGCGTATGATCACGTTCTCTATCGGGTAAATTGATGG
> GGGTGTTCGATGACTGAAATTGGGCGTAATGTAAGAAATCATTTCAGGAATATTAATATG
> GGCGGTACAATTATGCATGCTAGCTCTCTCGCTGAGGTTGAGTATGCCTTCTAGGACCTA
> ATGATTGTGCTATACAACCAGTATATAACCAATAATTCACAAATATTTTTGCATCCAAAA
> TCTGTTGCAGTCAATATCATTTTCCTTACCATTCAACTATGCATAGTTAAATGGTTAAAT
> CTTCATACAAGAATGGCTGGAATCCCGGGGTCGAGATATATATACCAAGTTAGAGGAACG
> CTTATCGATTCCATTGTCAAGAAATAATAATGTTTGTCTAAATTTACGTCGCTCTGTGAT
> AGACGATAGATGACTTTTTATTGCACATCCCAGCCCCAACCACGATTGTGTATCACTAAC
> TGTTTAATGTTTAATTCAGCGATCTTGTTTATGTGACAAGTATTATGACCGATTACAACA
> GCCAAAGGACGTCTCTTGTTTGGGATATACCTAGAGTATATCTGTAGCTGGCAACCCGTT
> CCTTTTAACGAATACCGGCTATTTTGTTTGCTTCATCAATTAGTCAACACGCGGGCCTGA
> CTGGCTATAGTTTACATCCTCAGTATTTTCATGCAAGCGTCACTACGGTGGTCGTTATAT
> TGATAAGTTGACCAATGAAAATGACAGCTGTCTATTTCAGTTCTTCCCGATCAAGGAGTT
> GTCCTGCTCTTTGGTTTCTCGGTACCCCGTGCAACCAGCTTCGTTAAGTTTGTTTTCCGT
> TTTTCGACTAATCTAAAAATATGACGCTAAAGATCGTCAAGAAGCTAAAAGTGGCAGCCT
> TCTTTCCGGTGAACCTTTGTTTCAGTAAAAACGCAAGCCAGGTTACTGCCCACATGCGTA
> GGCTACGATTCGAGTAGGAACCCTTTCTAGCCGTCATTTACTCAGATTAATGTCTTGAAA
> AAAAATTCTGAATTTATTTACGAAGTATAAATTAAATAAAATGTTTATGCTCCTTGATAA
> GGACTTATTTCAATGTTTTATTCCGATCATCATGATCTAGTCCAGATATAATCGTTGCTT
> CATAAGGTATCTGATATTCTCACTCGGCACCTCCTAGACACCAAGTTCAGCGAATGACAC
> AATGATCAATGGCGATTTCATAGTGCACTCTGGCCTTAAAGCTGGATTTAGAGCATTACC
> CCCTGGGTTTTCTAACATAATTATGATTGTGCTTGTTGTTGGTACTATCGACTATAAATT
> AAAATACCTTTATAACTCGTGGTTGAAGTCAACTGGACCAAATGGGCACTACAATTGTTA
> ATTGTCTCCATAGTCGGATTCTAACTAATTGTGCATGTCACCATCAATTGCGGACCTGCA
> ATAATCAACTGTCTTAAAAGAGGCCGAAGTGACTGTCATATTATAGAGTCCTTTGGTGAT
> TTTATTAATTAGATGCCAGGTTAATAGTTGGTGAAAGACTAACGAATACGAATCGGCTAT
> ATTGAAAAACCATTTATTAAAAGGAGGGGGATTCGAATTTTGCTGTTATGCTTAGTATTT
> GTTGGGCAAGAGTATTGTAGTACAAGGAACCGATAAGAAATCATCATTATTACACGTAAA
> ATTACGTTTCGCATAACACTGATTTGGAGAATACATTCTGAGTAGGCCATATTTCTGAAT
> AGACAAGCTCGCTATGTGCTACCATTATTCTACCCGTTTGTTCATTATGAGATCCGGTTA
> AATTATGGAAACAAAAGGTAGTTATAAAAAAGAGATTTGACAACTGAAATCAGATCACTG
> GGTTGGCTAATCAGATTCACCCAGGGGTTTGTGGTTAACACAACCATTAGGAGGTGTTCA
> TTTACATCAAATTTTTACCACGTACTTAGGAAAATCCAGAAGCACCTTCAAACTCTCTAC
> CCATTCTTCGTGGGGCATGAGATGCAAATTTAACTGAACTCAAGCTTGACACCTCGGGTA
> TTAGCTTCTGGGATCGATTTCGTGGCTTTTTAGGATAGAGATCACCGCTAATTCCACTCG
> CGCTCGTTCAGCTCTAAGCTTGTATCACATCGATTATTTGACATAAATAGGCGCATAGCT
> GTTTCATCTATTGGAGCTATTGAATTATATCAGTACATAGTCTCAATCACCCGCTCATCA
> AGTATCAGGTTTTTTATGGGTGATAGCGATATGCTAACAAGTCATCAAAAATTGTAAGTA
> TTCCTATTTGCAGCCCTACAGGCGACCGTCCTAAGCTCATTCTTACAAGTGAAATCCAAG
> TACGCATGCCGCTAATACTAATCTAAGGTATTACTGTACAATGGCATCTAGACCATATGC
> ATGTGACATATGGACCTCTAACACTAACAAACTAATTTCAGTCAAGACTGAAATTGAATA
> ATGTTTGCTATAAAACTGAAGCGACATCCACCGGTTACTAAGGGCTTGTCTACACCTTAG
> TTCCTCGCAGTAGAATCAATTTTTAAAAATATTTAAGTTTTCAGGAATGAAATGCGAGCT
> ATGAAACGTCCCAAATTCCTTAGAAGATGTACGTTTGTTCACACTCGTAGCATCAGATCA
> CAAAGAAGTTTGGATAGGTGGAATGAGCCACGATCCATTATAATTATAAGATAGTTCCAT
> GAGTATAGAGGCCTCGAACCTTATCCTTTGAGTAATCACATCGTATAAAATGTTCAGCGC
> ACTCTCCCCCCGGGATATGGTTTTGCCAGGTTACCTACGCAAACTCTAAATACAAAGAGG
> GAGCTATATAAAATAATGAGATCTGTCATCAAAAGAATTAATCGCACACCGCCAAAATCA
> CTTCTCTCGGTGAATCGAGATTTACCTACCCTAAGGTAACTCTTTTGTTCTAAGCAAACA
> TCACGTATACTTTGCTTCTGACAATTTGAGGAATAATGCCTTTTTACTCCGACAACAGAA
> GGGGCTCCCACTCACTCTTAGAAAGAGGATTGAACATGAATTTTCAGCCTCTATATATAT
> ACCTTCATAGTATTGACGGGAGATATACCGCGGCGTCTAGATACTCGTAAAGCCAGTGTA
> CTTCGCAGAATCAATTCATACTCCATCTCTATGATGACGAATATAGGTCAGTTCTAATGT
> GTGGTCTAACTTGTACTCACCGGCAATATCCCCATCGTGTATTTCACTCTCATTCACATT
> TCCATCGTTACGAAGGTAGGGCTTTTGGTAAACAAAGTGGACCGATATCGGATCTTTATG
> TATCAAGAATGAACGTCAGCAAATACATACGATGTAGGTTTAGGTACACCGCATGGATCT
> CCTCGCAGTCATGATTGAAACTCATCGGACTTTATTAGCCAATATTGCCAGCGTCTTATT
> ATCCATTCTTCGGATAATCACTCTGCCGTGTTAAAGTCAGCACACCAAGGAAAGCCACCA
> CTTACAAAGGTAAAGCACCATACTAGCTCAATGGGAGCCCATTGGCTGAAATTCACCTTA
> AGCATGACTCTAGATAAACCGATTGCCTTCATTTAGGTCAGTTAAGGAAAAGACAAGAAA
> CTGCACTCTCATTCACGAACCCCAAGACGGGCCTTCAGTCCAACAGTTGAACTATGGTCT
> GAATAGGTATGCACTAATACACATTAGTAACACGGCTTATAGACGTGATGGAACGTTGGG
> GCATTTATCAATCGACACCAAATATTCAATGCGCACATGCTGTTAATAGTTGCATAGTCT
> TGACCAAACTAAACTGTATAGTTGCACATGACTCACAAGAACAATTAGGCACATCCATAT
> TTTCGATTTCTTTCAGTCTCACGAGCAGGAGAGGCTTGAACCAGTTAACGCGTCTTGCAC
> ATACCGATTTAGAGCGGTAGTACCAATAACGCTTTGCAATCGCTAGTGATGGTTGTGGAC
> TGTAGATATATGATTTGTAAATTATCTTGTGACTTGTGTTATTCTTAGCTCATTGTATAT
> TAGTCTAGTGTCGTTAACATTACGAATAGGGCTCTCGACGCGACCTAATAGTATAAGAAA
> GGCTCCACGCCTTAAGGCTGTTGTGGAAGAGAACATCAGTCTAGATCAGGTCATATAAAC
> TCTTACTATCACTATTTCGATAGATAAGTCTAAAATGCACTCCAATCTAATTCTTGATTA
> TAGCTTATATAAAGGCTCGGGTTAGCTTAAGCCTGACATGTAATATGGAATTACACTGTC
> TATAACTGGTCACCAGCAGTTGAGGTTTGAGATTTCGTGAACGTGACTTTAATAGCGTAG
> TGTGATCCTCTCTTAGGCTCGATCAGAATAATAGAGCTTTACTGTTCCGTGGAATACGAT
> TGTGTTATGTACGAGCATTACGTAACAAATCAAGTATTGTAGTTATTACTATGAATATTT
> TACCAGCATATGTAACGAAAAACGGGTGACCTGTTACTGACATGCAAGAGGGATTGCACA
> CGAATCTAACATCTGCAGAATTCTAGACAAAACGCCTTGATCAGCCTAAAGATTTAAAAG
> CGCTCCAACTTGTATGACTAGAGAATGGTAAAAATGCTCGGGGAACCTCTTGGAAATAGC
> TGACTATCACTAACGAAGGGTGATGTTAATAATATAAGTTCAATAAATAACAACAACCAT
> ATTCACCGGAAAATCATTAGATTCTTAGACAATTCGCAGAATCACATTCATGTGGGTTCT
> AATTCATAAGTAATCGGATTAGTGCTATTATTCCCATGGCTGACGAGTCGTCACTTGCTA
> TGCCATAATGGAAAAGGATTGAGAAGCTTCGAATAGTTCTGACTCAAAATCCGCACGGGG
> TTTTTCTGCAGTGACGCCATGCGAGATTGTACGGATGCTAACGAGGCATGATCGCTTACA
> GATGATGGCCGTAAACGATAGTCACCATGTAATGGTATTAGTGTAGCTCTATATGAGGGA
> TAGCATGGTGTCCCTACTACGCCTTATAACAGGTATGCACGGCCGTATTCTGCGAAAGGT
> ACTTATAACGTTTTGTCCTACAAAAGCTTCTCGGACTTCAGAGTTAGCTGTAGTACTGTG
> ATACATAGTTTTATAAACGTGAGTCCATTCGTCTAGCGGTTCTATTTCATCCTCAATGAC
> CGAACTTCTCGTACTCTTATTCTTGTTCTCCGAGGGATATAACCAGAGTCATAAAGTGAA
> GCATACAACACTACACACTCCCTGTTCTCACTGATAAAAAGACAGCATTATAACGGCTAA
> CACATACACCGAAAATATCAGACTAACTGCTACTCTCTAATAATTAGATAATACTCCCTT
> AATTCATTAATCATATTTAGCGTTTCTGATGAAAGGCGCCATATTAGTCATTAGTGTCCG
> TAGTGAATTGCACCGGAGCAGTCAACCGGAATATAAATATACATCGGTTATAGATCATGA
> GATTATTCATTGTTGATCTATATATATGAGAACGAACTAGAAAAACATCATATCACAACG
> GGTCTTTTTTGATTGTCCATACCACGATACTACTATGATTTAATTGGATATTTGCATATC
> TAATGAAAGTATCTGGTATAAAGTCGTACGCCGCTCTAACATTAGGCTGTAACAATTTTC
> GCTAACAAAATAGAAGACCCCTTGGAGAATAGTCCTACGTACATGCAATGTCCTCTATCC
> TCATTGGCGCAAGCATCATTAAGTGAGGGATTTACATACTTAGGAAAGCTTGTGAAATAA
> TTAGACTTCACGCTGGATAAGAAGGCCTGATGCTATTTGTTCGTTGTACAGTTACGATGT
> GATGGCACCAAAAATTTCTCAGACTCGTGCAGCAAGACTTTTTACCGCAGACACCACCAG
> ATGACGCGGTAGAGATATCCATACGCCGGATTCCAGTGAAGTATGAAAGAAATTCTTATC
> TACACTGACAAGAGTGATCCGACTTTAAGTTCCTTCCCACACTCACGCTTCGTGCACGTC
> CTTTGGAATAAAGTAACTTTACAACATAGATAAGGTGTGTTCTAAATTCAGCGACTTTAT
> ATACGTTATAGACAAGCTTCGGCCGAAAACGGAGACTTCATCGGACTATTTTACTTGGAT
> GATGACATTAGTTTCACTGAGAAAGTAGTTAGGACATCAGACCCAAAACACAAACATCTA
> ATCTAATGGATGTTAAACAAATTCGGACACGAAAGAAAGTCACGCTCGCCCAGACTCATC
> CCACCCCCACGTTGGCAACAAAAGGCCTCTATCTACGCGTTCTAACTCTAGCTATGGTAG
> ACCAACGCAAGCCGATCATTTTCTGACTTTACAACCCTATCTGTTTAATAGGATAGGTAA
> TCAAAGTCGATAACTAGAAGGAATTGTTCGATCCAGGTGGGATGTCGGCACTACAGAAAA
> AGACGATATGAGTCATCTTATCCACATCACTTGTCGCGAGAGTTAAGTTAGTCAATTAGC
> TCACACTATTTATTACTTGTGGAGAATACCTTTATGTTCTACTTACTAACATTATTGCAG
> CCTTTGCTGTGTAGCTTAATAGTATATTAATATTAATTACCGCACTCTCCCGCTTTACTA
> AACACAAGTGCTAGTCACTTTTCTTGCTACAAAGCATCTCATACGATCGGTTAAAGCAGG
> ATAGCTATTCATATCTTGCCAAGTTTCAGTTTTTAATCTTTATGGTTGACGAAAGCTGGA
> TAATAGTTTCTTAACGACTGATTATATTCTATCTTAATGTTAGCACGAAATAACCTGAAG
> TCTATAAGTGAATGTTGCAAATTGGGAAACGATCTTCGTTGCTCATTACGAATTTAAAAT
> GTCGACCTATGAGATAGGACAGGACTCTATCATGTTAGGGTAGTAAGAATCATTATCTGT
> ACCCTTCGGTGTAGGCCTGTATTAGTAGATCAATTCAACCGTTAAGGTTGCCACTAAAAT
> CAGTTGCTAACTTAAAGGATGTTGTAAACTTTTTTTTGACGATTTCAAAATATCGTTTAC
> TGTGTACGCCTCTACCTTTACTAGTGGTCTTAAATTACCCCCCGACTTAAGAACCCTAAG
> AATAACGTCATCTCTTACATCTACAAGCGTGACTGTAACTATTCCTATCGATACAATTGG
> TCGAAAATGTAGGAGAAATCCTCACAGCCCTTTGCTATCGACGATTAGGCTAGACCAGTA
> TTGCTAATATCTTTAGCCCCTAAAATTCAACTTTTATGGACTATACGTATTATCGTTACT
> AGTCTATCCGTAGTGACCGATTATTTCACAGGTGTCTGGAATTATTATTACTCTGGTGTG
> ACTTCTAGCGTTAGCAAGGAATCGGTAATAACCTGAATATCGATAAGATATTTATGCAAA
> TCGACCACTTTTGTCGTATAGATACGCACTGTGAAGTGAGACTGCCAATTCTAGTTTTAA
> ACTTCATGGGATATCGACTAGCGCCACGTTGGAATATGAAGCTGGTGAAAGACCGTTACT
> CTAATTTGCAGATTAATGATCCAAGTTATATGTAATAGTTAAGTCCTTACAGGGAAAGTC
> TTTTCTTTTTGTCGGCGATCCATCCAAGCCTGGCTACTGTCCAATATGCGACATTAATGT
> ATAACATGATAAGACGCTAGGAGCTAGAAGCAATAACATAGTGGCGGTCTATTAGCACCA
> GTTAAACCGCAGAGCTAGTTTACAGGGTCCTCTCGGAGATCTATACCGCATATAGATAAT
> GGAAACCGATTAATAATAACGATTCTATTCTTTGCATTCAACGAGACCTAAAGCTATCCG
> TTCATGTTTGTCTCGTCCATTGAGTGTCGGAAAAAGTAGAATAAGCCCCTTTTAGGTTAG
> GATCTTTGAGAACTGGTTACCGACGTTCCTCTTGCGTACTAGAAACGTGCGGGTTTTAAC
> AATGCCTATTTCTCTTTGATTTACACCATGTTCGCACCCCCTTGGGCAATCCTATTGTTT
> CGAATCGTTCTTATATTAACAACTAGGGTTTTAGTAATTTCTTATTGCCTTGCCCCTACC
> GCTCACCCTTTAGGAAACGGATCTCTATACTGAGTTGCTGGTCTACAAGCGTATTAACGA
> TTGTACATGGAAATTCCAATCGTATCTCAATAAGTCTCTCCCTGTAACCCTTCCCTGCTT
> TGAAGAAATAGGAATGTAAGTCACAACTGCAAGTTTGAAGAAAGGCCGCTTAGTAGTAAC
> CAAATCGGGTACGTAGAATAAACGTATCCCCTGCGCAAGAGAGCCAGTCTTAATTAGCGC
> ACGAGTCGCACAGGATCTACAAAAGAGCCGGATCAATAACTATAAGATGCCACGAGTTAC
> CCAATATCATTGATTACCTAGGAAAAGTTAGTCTCGTTGAGTGTCTGAATAGACGGAAGG
> AAGTCGTGTGTTGTAACATGCCTCGAGGACTTCAATTGGTATCCTTCGATACGCTCCCAG
> GGTACCGGGTTATACAATTCAGACAACATGAGAATTAATATATCTTTAGTAAAAGTAAAA
> GGGTGGATTAGTAATTGTGGTGAATTTGGATAATGTTCCTCCTGCAGTTATACCATGTGA
> TACGATTTACACGAAACATCTCTGAGGTGTACCTATACTAAGCTTCTTTCTCTTGCAAAA
> TACATAGAAAAGAAACAACACATTGTGAAGTGCGTTATTACCGAGAAAGTCACTTGTATA
> TCAATAGAGGTATTCCACACAGCGGACCAAAAATCATACATCTTGATGCAGCACCTCGTT
> ACCATCTAGATAACTCTGTTGCCTCGTTCCAGGATACTAGTGAATTTTAGTCCTATCTTT
> TCATTACCGCTAAGTGTTTCTATTTATTTTAAAATTTAAGGTCGGATACGGTCGATTAAC
> TTTTTTTTGTTTGCTTCCTTGCCTATAATGAGGGGTGTGCTGTGAATGTGTGGTGCACAT
> GAGGTAGGCGCATTCCACCGCACCGACTTAAATTTCGTTTTTGTTAACGATAGTTTTGAT
> TATTCCAACGTTATAGACAACCCGATCCACCCTGACTACAACTCTACCATATGTCTTATT
> TTTAATTATAATAATAACATAATGGAAGCAAGAACGCTACCAGTTAGTATAGCCTCCTGT
> TGTTCCCGCAACCAACTAAAGTAAGCATTAACGAGTGCTTGCATCCCATGCTAAACCATA
> TCACGTTCGTTTTCCCACGCCCGTAAATAAGATTTACCAGCCCTCAATGGTCGACAATAC
> TAACATTTCAATGTTAGTCCATTGATCACTTATTTTACTCCGCTTAGGCCCGTATATATA
> TGGAGGTCGCTTTTCATAGATCCAGAACCCTACATTCCTTTAGTAGTAACTCGTCGACAG
> GAGTACGCTTAAGGTACCGCCACAAAAAGATCATCTTCTTACTTATTCATTTATCATGTA
> GAGGGCGAAATATTACCCCCCCCGCCTCATGATCTTGCGCACACTTAACGACTATCCGCT
> AACAAACGTGTTATTTGGATGTAAGCAAGTGCCAGTCAATGATATGACAGGTCCGCATAA
> AGAACCATCGAGACGTCTTTTAGTTGGCGATAGACACTTAGTTAACTCGTACAGATGACA
> ATAGTTCATTTGACGCTACATTGACCCGAAATAGCCTATAAGGCACGACAAAGCGACTTG
> TAGAGTTCGTCGATCCTACTCCCTCAGGACAATAAAACGGAATTACTTAGGATCTGCTGA
> TGTGACCTACGCGGGCTCGTCTGGGGTGAGGGCTTCTTAAGCACATCGTACTTGTTCGCC
> GTACCTAGAGCCAGAATACACACGGTAGTTTAGTCAACATATAATTACCGATGTACCTGG
> TTTACGATGTGTCAATTTGGCGACAGATGCGGAATCGACAAGACCAACAATCTGTCTTGA
> AATTGTGAATGATGTTTAGCACTTAAGGACCCATATTGGATAAAGCCTTAATTTGGTTTT
> AGAAGTGTCAGCACATGCATACGCCACGACATAAAACATGCCCAGAGTACGACCTAGTTT
> CACTTTAGGTCACAAAATTTGTTAGGAACCTGTTCAACCTGATCTTAATACGCAGTGTAC
> GAATGCTCAGACATAACCAGATTTTCGGTAATCGGGATCTTAAACGACTTTAGCATAATT
> CTGTCAACATCGAGCGGTTACCCCATGGACCCAAACGGGTAAGTGCCGTTAGGCAGAGTA
> ATAGTACATGTTACCGATTTATTCAAACGTAATGCACCGAGTTTGGCACGAGCGCTCGAA
> TGTTTATTGTCTCTTCGGTAAACCAAGCTAGTTATGACAGGCTTATCATTAATACGTAGG
> GGAGGTCCTATATCTACCCAGCTGTTACCCGAATTTCCGCGAGATGTCCTATCCGGTCAT
> GAAAATAACAGGTGTGTCGATTAGCACGGCCAAAAATTTGATGAGTCCTTTGACAAGCTT
> TTCGAAGAAAAACGTCCACCTCCAGATATGAGCGGTTTCAGTGAATAATCCTTATTGATT
> GATAGCGATCGTGTCCGCTGAAGAGGTTCTGGGTACCTTGGAGTCTTCTAAAGTTATACT
> TACGAGAGATTTGACTTTCATGCAGTTCAACTGCAGTTGTCAATTCTTCCACCGGATAAT
> TGCCGCCTACAACGTCGTTACCAATAGGAACTATTATGTTCCAAGTGCCGTTAATTTACA
> GTTCTCGCAGAGATATCCAGTTATATTGTCGGACAAATATAGGCAGCTAACAGCAAAGTA
> AGTTTGTTAATTAACGCTTGTAATGTGCAAAAATTATACTATGAAGTTGTCAATTTGGTT
> TTGTTTAAAGAAAAACCGAGACACTCCATTGCAATTCTCAGCGGATGTACGCAGTAATTT
> CCAGTGGAGGAGGCATTTGATGATCTATTACATTCAGGTTACCATCGCCTTAAAATCAAC
> CGCAATCCCGCCCTCCGTGGATATGGCAGCATTTATTCGTCCATTGGGTGTGCCAACTAC
> GTTCCCTACCCCTCGATTACCCTTTCCCCTGTCCCTTTACCCTCTGAGGTGTGATAGGGG
> ACGTCAGGCGGTTCCTGCGATATTGACAGAACTCCCAGTGTATTAAAACAGAAATAACTT
> CAAATCTGTTCATATACATATCAAGTGGTTTAAATTGATTACCATGTTTTTAAAGTCAAA
> AAGTGCACTCCTCACTTAATGAACGTGTCTGGTCCTCCCGTTAAGAAGTGTCGTTTCAAT
> TTATGGAGACTGAATTAAGTCGTATAACTGTAATTTGCTCAACTCTCACTGTGCTTTGAT
> CAAAAACCGTAATTCTTTAAGTCGCTTACCCTCACACACCGCGATGGATTTGGAGTGCGT
> TACACCGCGATCTGCAATATATAACTATTCCTGCTATGGGGCAATTGGAAAGATCTCGTT
> CAATACTACACAAAGTAAGTTTGTTTTGCAAACTATTGAATGTCAAAACATCTTCATGTT
> ATGATAGTCTCCACAAGCCAGAAAAAGGGCTCTTAGTAAACTGCACTTTATTGAGTACGT
> AGCCTTTTGTTCCCGTCGACTCGATCTTTTATCATGTAAGAAATAATAAATTCAAGGTCC
> TTAGCGCATGGAATGCGCCTTATGTTAGTTGAAAGGACTTAAAGTGGTATATCCTTAGAT
> TAATAATGGTAGAAAGACGATATAGACTCCACGGTCCCAGTCGCTAGGCACTAGCATAAC
> GGGCGCTATACGGTTATGTGTTCCCGGTGTTCGTGCAATCAAATTCCGCGTTATGTAAGA
> AAGAATTGAACCAATATTAATAGGGGCCGGTCTATTATGATTCATTCCTCGAGCCCTCAC
> CTTGAGTATGCCTTCTAGGACAGAAGCATTCTGATATAAAAACAGGAGATATAAAATAAT
> TAACAATGAGGTTTGAATCAAAATTATGTTCCTGTCAATAGCAGTGTCATTTCCTGGCAA
> ATATCCATAGTTTAAGCCGTAAATCTTATTAAAAGAAGGGCTGGAATACAGGCCTCCAGA
> TATAGATACAAAGTTTGTCCAAACCTTAGCGTGTCCAGTCGAAAGAATGAATTATGTTTG
> TCTAAATTTTCCTCCCTCTCGCAGACAAGATTGAGGTCTTTTGTTTGCACATACATGCCC
> CATACACGATGGGCTATCAAGATATGGTTAAGCTTTAATTCTGCGATCTTGTTTATCTGA
> ATAGTTGGATGAACGTGGACTACAGCAAAAGGAACGAGCGTGGTTCGCAGAGAACGACAG
> TATTTCGGGAGATCGCAAAAAGTGCAGTTTAACCTATAACCCATATTGTGGGGCCTGAAG
> AATGTAGTCTACACGCCCCACTCTCTGCCTATTCTGTAATTCCTAACGATTTTCATGCAA
> GCCTCTCTAAGCTCCTACTTATATTGTTAACTTGAAAAATGAAAAGGACTCCTGTATTTT
> TCTGTTCTTACAGATATTGGAGTTCGCCTCCTCTTGCGTTTCTAGGTACCCAGTCCTACC
> AGATTACGTAACGTGCTTGTCCCTTTTTCGTATAAGCTTAATAGATGACCCTAAAGATCG
> GCAACATCCGATAAGTCGCTCCATTATGTCAGGTCAAAATTTGTTTAAGTATAAACGCAA
> GACAGCTTTATCACCACATCACGACGCTACCAGTAGTCGAGCAACCATTGCTACCCGTAA
> TGGAAGCAGTGTTTTGTCTTGTATAAAAAGGCTGATTTTTGTTACGATGGAGAAATGAAA
> TTTAAGCGTTAGCCTCATTGATATGGAATTTTGTAAATGGGGTATTCAGATCATCAGGAT
> AGTCTCCACAGTTAAGAGTTGATTAAGTAGCTATAGCTTATTCTATCTAGGAAAATCAGA
> GACACAATCTTCAGCGAATCTCACAATCATAATTGCCGTTTTCATACTGCTCTCTCCAAT
> GAAACCTCCTTGGACTGCAGTACCCCCTGCGGTTGCTAACTTAATGAGGATTCTCCTTCT
> TGTTGCTAATAGCCAATATTATTGAAAAGTCATTTTTATATCCTCCTTCTTGTATTATGC
> ACAAAATCGGCACTACAATGGGTTATTGTCTACAGAGTACGATTATAACGATTTGTGCAT
> CGCACCATCATTTGACCACCTCAAATAATCAACGGTCTTATAAGACCACCAACTCACTCT
> AATTTTTGAGAGGAAGTTGCTGAGGGTATGAATGTCAGCAAACCTTAAGTGTTGGGGAAT
> CACTAACCTAGACCAATCGCCTATATTGAAAAAAAATGTATGATAAGGACCCGCAGTCCA
> ATTTGCCGCTGAGCATTACGAGGTGTTCGCCAACACTATGCTAGTAAAAGGATCCGATAA
> GAATTCATCATGTTTTCTAGTTATATGACCTTTCGAATAAAACGCATTGCCTGAATTCAG
> TATGTGTAGGCAATATTTATCTTTTCACTTCCTACATTGGTCAGACCATTATTCGACACG
> TGGCGTCATTTTGTCATACCGGGTAATGTTGGAAACAAAACGTACTGATAAAATACTGAG
> TTGTAAACTCTAATCAGATAACGCGCTTGGATATTAAGATTCACACAGGGGTTTCGGCTG
> TAAAAAAACTTGTGGAGCTGTTCTGGGACAGATAAGTTGTACCTCGTACTTAGCTAATTA
> ATGAACCAACTGATTACGATAGAACAATTCTGAGGCCGCCAGGACAGCCAAATTTTAATC
> TTATAAAGCTGGAAACAGCCGGTATTAGCTTCTCGCATACTTTGCCTGCATTGGTACCTT
> ACAGATATCAGCGTAGTCATATACACCTCGGTCTCAGCTAAGCTTGTATCTCTTAGAGTA
> GTTCAAAGATAGTGGACAATACCTGTGGAATCGATTGCAGATATGGATTTATTTAACTAC
> TGAGTCTCATTCACAAGCTAAGCAAGGAGCACGTTTTGGTGCCGGCATACCGATTTGCTA
> TCATGTCAGCAAATTTGCGTTGTATTCCTAGTTGCACCCATTAAGGCCACACTCCGAACC
> TAATTATTACATCGCAAAGACATGTACGAAGGACCCGATGTCGAATAGAAGGGAGGACTG
> TTCATTGGAAGCTAGACCAGAGGAATCGCAAAGATGCAACTCTTACAATAAAAATCTAAT
> TTCAGTCAACACGCAATTTCTATAAGGTTTCCGATAATAATGAACCGTCTTCCACAGGGG
> AATTTGCCATGCTCGTAAAAGTAGTTAATCCAAGTAGAAGAAATTTTGATAATGTTTTAA
> GTTGGCACGAAGGAATTCAGAGAGATCTTACCTAACAAAGGCATTAGTAGATGTTCCTTG
> GTTCACACTCGGTCAATCAGAGCACATACTACGGGCGATACCGGGAATGACACAACATCA
> ATGAGATTGTTAAGTGAGGTAATTGACTTTAGAGGACTCGATCAGTATACTGTCACTATG
> AACATCGTATTAATTGTTATCCGATATATACACCACCGATTTGCTTGTGCAAGGTTACAG
> ACCCATTCGATAAATACAAACACGGAGCGATATTATTTAAGGAGTGCTGTCTTCAAAAGA
> ATTATTCCCACACCGACATAAGAACTTCGCTCCGTCATTCCAGATTTAAATAACATAACG
> TAACGCTTTGCTGATAACATAACATAACCGAGAATTTGCTTAGGAAATTTGGAGCAATAT
> TGCATTGTTTCTCAGTCATCACAAGGCCCGCCAAAGAACTCTGAGAATCAGGATTCAACA
> TGATTGGTAAGACTCTATATATATAACTTAATTCTTGTGTCCGGAGATAGAAAGAGGACG
> AGAGATACTACGAAAGAAAGTGTACTTCGATGTATCAATTCAGACGCCTTCTCTATCATC
> AACATTATAGGTCTCGTATATGCTCGGCGCGATCTGCTTCTCTCCGCCAATAGCCCCATA
> GTGTATTTCAAGCGCAGTAACAGTGAAATCGTTACGAAGGTAGGGATGTTGCTTATAATT
> GTCGTAACTTATCGCTTATGTATCTTTCAAGAATGAACGGCAGCATATACATACGTTCTA
> CCTTTAGCTACAAAGCATCCATATACTCCCTCTCATGATTGAAACTCTTCCCTATTTTGT
> AGCCAATAGTGAAAGCGTATTAGTATAAATTCGTCGGTTTTTCACTCGCAACTGTTATAC
> TCTGCAAACAAACGAAAGCCTCATAGTACAAACCTAAAGCTACATACTTCATCATTGGCA
> GACCAGTGGCGGTATTTCTACGGAAGCATCACTATAGATATAAAGTTTCCCTTCATGTAC
> GTCTGTTAACCATATCACAAGAAACTGCTATCTCTGTCACGTAACAATTCACGCGCCTTA
> TCGCCAAATGTTCATATATGCGCGGTATACGTATGAACGAATACTAATTAGTATAACGGA
> GGATTCACGGGAGGGATACTTGGGGCATTTATAAATCGTCTAAAAATTTTCTATCAGCAC
> TTGCGGGTTATAGTGGATTACTAGGCAACATAATATTCTGTATTGGTCCAAATGACGCTA
> TAGATAAATTAGCAAAATACATTGTTTCCATTTATGTAAGTCGAAACTCCAGGACTCCCG
> GGAACCAGTTAAACCGTCTGGAAAAGACACATTGTGAGCGGGACTTCAATGATAGCTTTC
> AATGAGCTTCTCATGCTTGGGGTCTGTACATATATGTTGGCGAAATTATCGTCTGTATTC
> TGTTATGCTTTGATCATGGGTTATTAGTATAGTGTCCGGTTAAGTACCAATACCGCTAGA
> GACCCGACCTAAGTCGATAACTAACGATCATCGACGTAAGGATCGTCTCGATCAGTACTT
> CAGTCTAGATCTGGGAATAGTAACTCGTTAGTGAACTATGTCGTGTCATAACTCTAAAAT
> GCAATCAAATCTTATTATTGAGTATTGATTATATAAAGCATCCGCTTAGCTTTACCCTCA
> AATGTTATATGCAATTTAAAGCGCTTGATATCGTCTACTCAAGTTCAGGTTTCACATGGC
> CGCAACGTGACGTTATTAGAGGTGGGTCATCATCTCTGAGGCTAGTGATGTTGAATACTC
> ATTGAATGGGAAGTGGAATACCATGCTCGTAGGTAACAGCATGACCTATAAAATATACTA
> TGGGTGTGTGGTAGATCAATATTGTTCAAGCATATCGTAACAATAACGGCTGAAATGTTA
> CTGACATGAAAGAGGGAGTCCAAACCATTCTAACAGCTGATCAAGTCGTCTAAAAACGCC
> TGGTTCAGCCTTAAGAGTTATAAGCCAGACAAATTGTATCAATAGAGAATCCGTAAATTC
> CTCGGCCAACCTCTTGCAAAGACATCACTATCAATATACTACCGTGATCTTAATTAGTGA
> ACTTATATAAATATCTACAACCAGATTCAACGGAAAAGCTTTAGTGGATTAGAAATTGCC
> AAGAATCACATTCATGTGGGTTCGAATGCTTTAGTAATACCATTTCGCCGAGTAGTCACT
> TCGCTGAACTGTCGTAAATTGCTATGACATAATCGAAAAGGATTGTCAAGAGTCGATTAC
> TGCGGACTAATAATCCCCACGGGGGTGGTCTCATGTCTCCCCAGGCGAGTGGGGACGGTT
> GATAAACACGCTGCATCGCGGACTGATGTTCCCAGTATTACATAGTCACATTGGATTGCG
> AGTAGTCTACCTATTTATGAGCGAGAGATGCCTCTAACTACTTCGACTTTTAAAACCTTT
> CCACGCCAGTATTCGGCGAAAGGGAAGTATTAAGGGTTGTCATAATTAAGCTGATACCAC
> TTCAGACTTTGCTCTACTTCTGTCTTTCATTGGTTTAGTAAAGTCTGTCCATTCGTCGAG
> ACCGTCTTTTGCAGCCTCATTCTACCAACTGCTCCGACTCTTAGTCTGCTTCTCCCAGCG
> TTATAACAAGAGGCATTTTGTCATCCTTAAAACAATAATAAAGAACTCGGAGCACTGATA
> TAATGACTGAATTAGAACCGCTTAAAAATACAACGAATAGATAAGACTATCGGATAAGAT
> CTAATATGTAGTGATTAAGCCCTTTATTAATTAATAATAGTTACCCTTTCTGATGTAACG
> CGACATATTACGATTTAGTGGCACGTCTGAATTGCAAAGCAGATCTCTACCCGATTTTTA
> TTATAAATCCCGTATACATCTTGACTTGAGTAATTGTTCATCTTTTTATATCTCTTCGTA
> CTACAAATAATTAATATCTCAACCCGTATTGTGTGATTCTAATTACCAACAGAATACGAG
> GAGGTTTTTGCTTAGGGCCATATATAATGAATCTATCTCGTTTATTCGCGGAACCCGAGA
> TAACATTACGATGTAACTATTTTAGAGAACTTAATACAAGAAACATTGCTGATTACTCAT
> AACTAAATGCTTGGTAATATATCCTCAGTGCCCCTACCATCTTTTACGCAGGGATGTAAT
> TACTTAGGATTCATTGTGTAAGAATTACAATGAACGATGGATATGAAGGCATGTTGCGAG
> GTGTTCCTTGGTATGTGAAGTTCGCAGGGCAACAAAAATTTCGCAGAATAGGCCTCAAAG
> TATTGGTAAAGAAGACAACTAATCATCACGAGCTTCTGATATCAATACGAACGAGTCCTG
> TGATGGATGAAAGAAAGTCGTATCGAAAATGTCAAGAGTCTGCCCAATGTAACTTACTTC
> AAAAAATAACGCTTCCGCCAAGTACGTTCGAATAAACGTAATTTTAAAAATACATAAGGG
> GTGTTAGAAAGTAAGCGACGGGATATAAGTTAGACTCAAGATTCCGCCGTAAAACGAGAC
> TGATTCCGAAGATTGTTCGTGGATCTGGTCATGACTTTCACTGAGTAAGGAGTTTCGACA
> TATGTCAATAAACACAAAAATAGAAGCTATTCGATCTGAAAAATATTAGGACAAGAAACT
> ATCTCACGCTAGCCCAGAATATTCACTCACCCACGGGCGATACTAAAGCACTATATAGTC
> GCGTGATTACTATACATATGGTACACATAAGAATCACGATCAGGTTCTCAATTTTCAACA
> ATATATGTTTATTTGCATAGGTAATATTAGGCCTTTAAGAGAAGGATGGGTGAGATACTC
> CGGGGATGGCGGCAATAAAGAAAAACACGATATGAGTAATAGGATCCTAATATCTTGGCG
> AGAGACTTAAGGTACGAATTTTGCGCAATCTATTTTTTACTTGGCCAGAATTCATGTATG
> GTATAAGTACGAACTTTTTTGATCACTTTCATGGCTACCTGATTAGGATAGTTTGAGGAA
> TTTCCCAAATATACCGATTTAATATACACTAGGGCTTGTCACTTTGAGTCAGAAAAAGAA
> TATAATTACTTAGGGTAATGCTGCATACATATTCTTATATTGCAAAGGTTCTCTGGGTAA
> TCTTGAGCCTTCACGATACCTGGTGAAGTGTTTAGTAACGAATCATTAGATTAGATCTGA
> TTCTGTGCAAGAAATATCCTCAACTATTTAACTCAATGTGGCTAATTGCCATTCGATATT
> CGTTGCTAAGGACGAATGTTTTATCTCGAAATTTGTCAGACGACACGTCTATATAATGGT
> TGCGGAGGAAGAATCAGGTGATGGTCCCTTACCTCTACCACTCTATTACTAGAGCAATTA
> AAACGTTAAGCTTGCCAATATAATAAGGTCATAACTTTATGGTTGTTGTTAACTTGTTTG
> GCTAGATTTAAATATATAGTTTAAGGTCGAACCCGCGACCGTTACTACTGCTCTTAAATT
> TCCCAACCTATTATCATCCCTTAGAATTACGGCATCTCTTTCTGCTAAAAGCCTCAAGGG
> ATATTGTCCTTGAGATACAAGTGGTCGAAAATGTAGCAGAATTAATATAACAAATTTCCT
> TTCGAACTTTACCATTCAACACTATGGCGAAGTGCTGGACCCAATAAAATTCAAATTGGA
> TGGTCTATTCGTTGTTTAGTTTCTACGCTATCCCGTGTCAAACATGTTTTCACAGCGCTA
> TCGTTTTATTTTTAATCTCGGCGCAATGATACCCGGAGAAAGGAAGCCCGTAGATCATGA
> ATATCGAGTAGTTTTTGATCCAAATCCAAAACTTGGGTACGAGACATAAGCTCGGTGATC
> GCTCACGGACTAGTCTACTGTTAAACTTAATGGGATAGACACTAGCCCAAAGTTCCAATA
> GCTACATGCGCAAAGTAAGGTTAGCGATTTTGCTGTGTAATCAGACAAGTGATATGTAAT
> ACTTATGTCAGGAAACCCAATGTAGGGGCTGGTTCGCCGCCTTCCATACTACACTGGCTA
> CTGTAAAATATGAGACATTAAGCTATTAAATCAGATGACGCTAGGAGCGACATGCATGAA
> AAGAGTGCCGGGATATTAGCACCTGGTAAACAGAACACATAGTTGTAAGGGTAAGCTCCG
> AGTTCGTGACAGCATATTGATTAGCGAAACAGATTTAGAATAAACAGGATATGCTTTCCA
> TTCAACCTGTCATTATGCTATCAGTTCATGTTTGGATAGGAAAGTGACTCTCGGAATAAC
> TAGAATATGAACCTTTTACGTTAGGAGATGTCTCAACGGGTTAAACACCTTCCTCGTCAG
> TAATAGATTCCTCCGGGTTTTAAAATGGAATTTTTCTCTTTCATTTTAACCAGGTGAGCA
> CACCCTGCCGCAATACGAGGGTGGCCAATACTGCTTATAGTAAAATATACGGTTGTACGT
> ATGTCTTTTTCCCGGCAAAAGTCCGCTAACAAGGTAGCAAACCCATCTAGATACTCACGT
> GCTGGTCTACAACAGTAGTAACGAGTCTACATCCAAATTCAAATCGTATCTAATTATCTC
> GCGCCATGGATACAGTAACTGCGTTGTAGAAATACGAATCTAACTATCATCGCCAAGTGG
> CAAGAAAGCCAGATTACTTGTAACCTAATAGGGGTAGTTGTAGAAAACTATACACTGAGA
> AAGACACCCACTATTATTTTGCCAACCACTCCCAATGGTTCTTAAAAAGTCAAGCATATT
> TTACTATAAGAGGAATCCTCTTACCCATTAGAATGGATTACATAGCAAAACGTAGTATCG
> GTGACGCTATGTATAGACGCATGGAAGTACGCGGTGGTTTCATCCAGCCTGGACTTCAAT
> GCGTTTCCTTCGATAAGAGCACAGCCTACACGGGTATACATTGCAGACAACATCACAAGT
> TATATATCGTTAGTAAATCGATAAGGCGCCATTACTAATTCTGGGGAATTTGGTTAATCT
> TACGCCGCCTCGTATACAATGTCAGTCGATTTTCTACAAACATATAGCTCGTCTTCAGAT
> ACTAAGATGCTGGCTCGTCAAAAAGAAATACATATCTAACAAAAATGTCTCTACGGCGTG
> TTTTCAGACAATCTAACGTCTATATCTATTCAGGTATTACACACTGCCGTCATATAATAA
> TACTTCTTGATCAAGCACCTAGTTAAAAGCGTCTTAAAGCTGGGCAATAGTTCAACCAGT
> ATACGGTTGTGTACTAATATATTTTATTTACCGCGAAGTCTGTATATGTTTGTTAATAGT
> TATGCTACGATAAGGTAGATGAAATTTGGTGTGTGTGATTCAGTCCATATATTCAGGGGT
> GGGATGTGAATGTGGCCTGCAATGGACGTAGCAGAATTCCTACGCACACACTTAAATGTA
> CTTTTTGGTAACGATACTGTGCATTTTGCAAACGTTTGTCACAACACGTTCAACCATCTC
> GTCAACTCTAAATTAGGTAGTTTGTGTAAGTTTAAGAAGAACTTAATGGAAGCATGAACG
> AGACATGTTACTAGTGCATCCTGTTGTTCAAGAAACCTAAGAAAGTAAGCAGTAAACTGT
> CCGTGCATCCAATCATAAACATTAGAAACTTCCGTTTAAATACCAAGTAAATAAGTTTTT
> CCTCCAATCTATGCTCGACAATAAGAAAATTTAAATGTTAGTAAATTCTTATCTTATTTG
> TATCCGCTGTGCAACGTATATAGATGGACCTACCTTTGCATAGATCAAGATCCATACATG
> CCTTTACGTCTAAATCGGCGACACCACTACCATGAACGTACCGACAAATAAACATAATAT
> TCTTACGGATGCATTTATAAGCTACACCGAGATAGATTAACACCACCGACGAATGATATT
> CCGCTCACTGAACCACTAGACCCTTACAATCCTGTGATGTGCAGCTAACCATGTGCCAGG
> AAAGGTTATGAAAGGTCCGAAGAAACAACATGAGAGAAGTATGTGTGTTGCCCAGAGTAT
> CTTTGTTAACGCCGTCAGATCAAAAGACGTCATTTGACCATACTGTGTCCACAAATAGAC
> TATAACGCAACACAAACACTAGGCTACACGTAGTCGAGACTTCTAACGAAGCACAAGATT
> TAGCTATTTCTGAGGATCGGCTCTGCTCACAGTACAGGGATCGTAGCGGGTCTGGCATTA
> GTATCAAAATACTACGTGTTCCACGTACCTTGAGCCAGAATAAACAAGCTAGTGGACTCA
> ACATTTTTTTACACATGGAACTCGTTTACGAGCTGTAAATTTGGCGAATGATCAGGAATC
> GACATCTCAAAATTTCTGGCTTCAATTGGGGATTGATCTTTACCTATGAAGGAACCATTT
> TCGTTAATGACTTAATTTCCGTTTTGAAGTGGCAGCAAATCAATAACCCTAGACATATTA
> CAGCAACAGAGTAAGAACTAGTTTCACTGTAGGGCAATAAAGGTGGGACGTAACTGTTCA
> ACAGCATCTTTATTAGCTGTCTACCTATCAGAACAAATAACAACTGTTTACCGATTACGG
> TGATTATAAGACTGTTGATTAATGATCTAATATGCGAGACGGTAACACAGGCTACAATAA
> CCCTAAGTGCCCTGAGCAAGAGTATTAGGAATTCGTACACATGGATGATATCGGAATCCT
> CACACTTTGCCACGTGCGAGCGATGGGGTAGTGTAGCTTAGCTAAAACATGATAGTGATG
> ACAGCATTATCATTTTTACCTACGCGACGGACTATTTCGTACCAGAGGTTAACCGAATTG
> CCCAGAGATGTCAGATACGGTCATCAAAATATCACGTCTGGACTTGAGAAACCAAAATTA
> GGTCATCAGTCCTTTCACTAGCTGTTCGTAGAAATACCGCATACGACACATTGCTGAGGT
> TGCAGGCAATAAGCATGTGTGAGTGTTTCCCATAGGGTACCATCAAGACGTTCTGGCGAA
> ATGGGAGTAGTCTAAAGGTATTATTAACAGAGAGTGCACGTTATGCCACTTCTACTCCAC
> TGGGAAATTATTACTAACCATTTGTGAAGACTTCATAGTCGGGAACTAGACGTTAGATTA
> GGTGACTACTGCCGTGAATTGACAGTTCTCGCACACATAGACACTTATTTTCTCGGTCTA
> TTAGAGCATGCTAACAGATATGTTACGTTGTGAATTTAAGCTTCTATTGTCATAATATTA
> TACTTGGTACTGGGCTATTTCCTTGTCTGGAAACAAAAAACGTCACAAGCAATTCCAATT
> CTCAGACCTTCTTCGAACTAATGTCAAGTGGAGGAGGAATGGCTGGAGCTTTTACATTCA
> GCTGAAAATCGAATTATATTCTTAACAATTCCCCCCCTCCGTCCATATGGCTGAATTTAT
> TACTACTTTGGGTCTGCAATATAACGTCCCGTCCCATCGATTACAATGGAACAGGGCCAG
> TTACCCTCGCTGCGGTGATAGGGGACGTCTCGACGTTCCTGAGATAGTGACACAAATCCC
> AGGGTATGAAAACTGTTATTTAGTCTAAGATGTGCATATACATATCTACTGGGGGATTTT
> GTTGAAAATGGTTTGAAACGAATTAACTGAACTAATCAAGTAATGAAAGTCGATGCTCAT
> CCAGGGATGATCTGTAGTGTCATGTTATCGACAAGCATTTTAGGAGTATAACGCGTTGTT
> GATCTACTCTCTCTCGGAGGTCTGAAAATTACCTAATTAGGGAAGGACATTACCATATAA
> AAACCCCTTGCATTGCGTGTGACTTTAACCCCGATCTCAAATATATAAATTTTACTCCTA
> GCCGGAATTGGGATAGATCTCGTTAAAGACTTATCAAAGGAACTTTGGTTTGCTAACTTG
> TGAATCTCTAAAAAGAGGCTTGTGATGATTGGCTAATAAAGCCTGTAATAGCGATCTTAG
> TTAACTCCAATTGATGGAGTAACTACCAGGGTGGTAACCGAGTCTCCATCGTTTATCATG
> TATGAAAGAAGTATTTCATGGTCCGTACCCCAGGGAATGCGAAGTATCTTTGGGGTAAGG
> ACTGATACTGCGATTTCCTTAGATTTATAATGCTTGTAACTCCATAGTGACTCCAACGGA
> CAAGTCCCTTGGCACTAGCATATACGGCGATTTACCGTTTTGGCTTCCCCGTCTTAGTGC
> AAGCAAATTCCGAGGTAGCTTACATTGAATTGAACCAATATGTTTAGCGCACCGTATATT
> AGCATGCATTCATAGAGACAGCACCGTCACTATGAATGCTTGCAAAGATGCTTGCTCAGA
> TAAATAATCGTGATATAAAAGAATTAAAAATGAGGTGTGAATAAAATTTAGGGTCATCTC
> ATGAGATGGGGCAGTTCCTGGAAAATATCAATACGTTTAGCCGTAATTATTATTAAATCA
> AGGGCGCCAATACACGCCTACACATATTGATAAAAAGGTTCTCCTAACAGGAGACTGTAA
> TGGCGATACTTTGTTTTATGTTTGTCTAAATTTTACTACATATCGCTGACTACATTCTGG
> TATTTGGTTGCCTAATAAATCAAAAATAAACCATGCGCGTGAAAGTTATCGTTAAGCTTT
> TATTATCAGATATGCGTGTTCTGTATTCGTGGATCAAACTGGACTTATGAATAACGAACG
> AGAGTCGTGCCCTGAGAACGACTCTATTGAGGGACAGCCAATAAACGGAAGTTGAAACTT
> GAAACCATTGTGGCGGGCCTGAAGAATGGTCTATACAAGACCCACGCTATGCAGAGTCGG
> GAATTACGATCGATTTGAATGAAACCCTATAGAACCGCCTACTTAGTGGCTTAACTGCAA
> AAAGCTATAGGAATCATCTATTTGTCTCTGATGACACATATTCCACTTCGCAGCCTAGTG
> CCTGGAGACCTAAAAACTCATTAAAGATGACGTTTCGTGCTGGGACCTGGTTCGTAGTAG
> AGTTTTAGATCACCATAAACTTACGCATCATCAGTTAACGCCATCAAGGATGGAACCGCT
> AAAGTGCTTGAACGTTATACGAAACAATCCTGTAGCAAATAAGCACGACCCGACCAGTAC
> TCGTCCAAAAATTGATTCCACGAATGGTAGATCTGTTTTCGATTCTTTTAAATGGAGCTT
> TTTTGTTAAGATCGTGAAAGGATAGTTAAGCGTTAGCATCATTCTTTTGCTATGTTGTAT
> TTGGGGTAGTCAGATCTGAAGGTTAGTCGAAACAGTTAAGACGTCATTATGTAGCTATAG
> CTGATGAGATAGACCAAAATAAGACAATAAATCTGAACACAATCTAAAAATCATATTTCC
> ACTGTTAAGACTCATAGATCCAATGTTACCTCCTGGGACTCAAGTAAAAACGCCCGTTGA
> GAACTTTTTGAGCTTGCGCATGCGTGGGCCGAATAGACAAGAGTATGGTTAAGTAATTTT
> GTTAGACTCCTTCTTGGATTAGGCTAATTAGCGCCAAGAAAAGGCGTTAGGCTATAAAGA
> GTACGAGTAGAACGATTGGGCAATCGATAAATATTTGCACCAAATCATTGTAGATACGCG
> ATTTTATCACCACCTTCTCAATCTAATTTGTGACACGAAGTTCCTCAGGGGAGGAAGGTC
> TGCAAACCTTTAGTGTTCGGCTATCTATAAACTAGTACTTTACCATAGATTCATATTAAA
> TGTTTGATAACCACCCCCAGTACAATTTGCAGCTGAGCATTTCGAGGTGGTCCCATACTC
> TATGCGTCGAAAACCATAACTGTACATTTAAGATGGTGGTCTAGTTATAGGTACGGTCGA
> ATATAACGCAGGGCCTGTATTAAGGAGCTCGTCGCAAGAGTGAGCTTGTCACTTCCTACA
> TTGCGCAGAACATTATTAGTAACGGGGCGTAAGGTTCTCTTACCGGGTTATGTGGGATTA
> ATTTCCTACGGATTAATTTCTCAGTGCTAAAAGCTTAGAACATAAAGCCCTTCCAGATTA
> ACATTAAAACTCGCCTTGCGGCTGTTAAATTAATGGTCCAGCTCGTATGGGAAAGATAAG
> TTGTACCTACTTCTTAGCTTTTTAATGTACAAAATGATTAAGATAGAAAAAGTAGGAGGC
> CCCAAGCACAGCAATAGTGTAATCTTATAATCAGGGAAAAAGCCCCGATGACATGATCGC
> TTACTGTGACTCCATTGGGTCCTTTCTCAGATAAGAGTAGTAATAGACACATACGGATCA
> GATAACAGTCTATATATGACTGTAGTTCAAAGTTAGTCGACATGACATGTGGAAGAGTGT
> CCAGATATGCATGTATTTATCTTCTGACTATAATTATAAACCTAAGAATCGAGATCGTTT
> TGGTGCCCGCATACACTTTTCAGATATTCGAAGCTAATTTGCGTTCGAGGACTAGGTGAA
> CAAAGTAACCCCAAACTAAGAACATAAGTATTTCATCGCATAGAAATCGTACATGCAACC
> GTTGTAGAAGAGTACGGAGGTAGGTTAATGCGATGCTTGAAATGTGCAATCGCAAAGATC
> CTAATATTAAAAGAAATATATATTTTAACTATACTAGCTTTGTCTAGTAGCTTTCAGAGA
> TTTATGTTCACTCTGAATCACCGGTATTTCCCAGGCTAGTAAAAGGACGTAATACAACGA
> CATGATATGTTGATAATGTGTGATGTGGGCACCTTGGAATGCACACAGAGCTTTACTAAA
> TTTGGCATTTGTACAGCGTACTTGCTGATAACGCGGTCAATATCAGAAATTACTACGGGC
> CATACCGCGTAGCACAATACATAAATGTGTTGGTGAAGTGTCGTAATGGTCTTGACAGCA
> ATACTTAAGTTTAATGTCACTTTGAAATTACTTTTAATTGGTATCACATAGATAAAAAAC
> CCATTGCCTGGTCCAACCGTAAAGACCAATTAGAGAAATAATTACACCCTGAGATATTAT
> TTTTGCACTGCGCTATTAAATTGTTTGTTGCCAAAAACCAATTTTGAACTTAGCGCCCTC
> TTTACACAGTGAAATTACAGAACCTAAAGCTTTGCTGATAACATTTAAGAAACGAGTATT
> TGATTAGCTAATTTGCAGCTATATGCAATTGTTTATAACTATTAACATCGCCAGAAAAAG
> ATAGCTGACAATCACGTGTCAACTTCTTGGGTAACACGAGAGAGATATTACGTAATTCTT
> GGGTCCGCTCTTAGAAACACCACGAGACTGAAGACGTATGAATCTGTAATTCCATGTATA
> TATTATGACGAATTAGATAGCAGCAACTTTATACCTATCGTAGATGCTCGCCGCGATATG
> CTTAGATAACCAATTAGCAACAGACGGGATTGATAGAGAAGGATATGGGAATGCCTGAAG
> ATCCTACCGATGTGGCTTATAATTGGCGTAACTTTTAGCTTATGTTGCTTGAAAGTTTCT
> AAGGATCATTTTTAATTAGTTCTACCTGGAGCGTAAAAGATGCCTGATAATACATCTATT
> CAGGCAATATATTCCCTATGTTGGACACAATAGTGAAACAGTATTAGTTGAATGTAGTAC
> CTGTTTAAATAGCAACTGTTATTCTATCATATAAAACGTATCCATCATAGTAAAAACCGT
> AACCTAATTAAGTCATATTGCCCAGAAATGTGCCGCTATTGCTAAGGATCAATCAATATA
> CAGATTAAGTTTCAATGCAGGGACGTATGGTAACCATATCAAAACTAACTCATATCTATG
> GAAACTAAAAATTCAACCCAAGGATCGCCTAATCTGCATAGTTCCGAGCTATACCGTTCA
> TCGTTGTATAAGGACGATATCCGAGGATTCAAGGCAGCCATACGTCCGGAAGTTATATAT
> ACTCTAAATTTTTTATTGCACAAATGCAGCGGTTTAGGGCATTACTAGGCTACTTTAGTT
> TATCGAGTCGTCCAAAGCACGATATAGATATTTGACCATATGAAAGTGGGGCCTTTTATG
> TATCGCGAAACTCAACCACTCCAGGCAAAAACTTTTACCCGCTGCATATGTAACATGGTG
> AGCCCGACGTAAATGTTACAGTTCAATGAGCTTCTCATCCTTCGCGTCGGGACTTATTGC
> TTGGCGAATTTAGAGTCTCTATGCTCGGAGGATTTCATAATGCGTGAGTTCTAGACTCGA
> CGGTTAAGGACCTTTACCCCTAGACTACACACATTAGTCGAGTACTTACCAGAATACAAG
> GAACGATCGGCTCCATCTCTAATTCACTCTTCATATCCGATTTGTAAAGAGTTAGTGATA
> TTGGGAGTGTCATAACTATATATTGAAAGCAAATATTATTATGCTGTATTCAGGATAGAA
> TCCAGCCGCTTACCTGTTCCATCAATTGTTTGTTCCTTGGTAAAGCGAGTGTTAGCCGAT
> AATCAACTTCACCGTTCTCAGGGCCGCTAACGGTAGTTTTTACACGTGGGTCAGAAGATA
> GGTCCATACTGATCTTGTTTACTCAGGGTAGGGGAACTGCAATTCCAGGCTCGTAGCGAA
> CTCCAGGACCTTTATATTATACTATGCGTGTGTGGTAGAGCTATTTTGTTAAACAAGTTC
> GTAACATTATACCCGCTAATGTTAATCTCTTCAATGTGGCAGTCATATCCATTCTATAAG
> CTGATCTAGTCGTCTATTAAAGCATGCTTCACACGTTACAGGGTTATGCCAGAATTAGGG
> TATCTATAGTCAAGCCGTTTATTCCGCCGCCATAAGATTCCTAAGACATCACTTTAAATA
> TACTACCCGCAGCGTAAGTAGTGAACTTATATAAAGATATTCTAAAAGTTTATAACCAAT
> TGATTTAGTGGAGTACTAATTGCCAAGAAGATATGTCTGCGCGCGGCGTTTGATTTACTA
> TGACCTTTTCGCAGTGTAGGAAATTCCATCTACTCGACTATATTCCGTTCACAGAATCCA
> ATTCCTTGCTCAACAGTCCTTTTCTGAGGAAGAATATTCACAACGCCCGTGGTCGCATGG
> CTACACTGCACACTGGCGTACGTGGATATACACCATGCATAGAGGAATCATGTTCCAACT
> ATTACTGTGGATAATTCGATGCCGAGTTCTCTTCATATTTAGGAGCCTGACATGCCGCGA
> ACTTAGTCGAATTTTATATCCGTTCCAACCCACTAGTAGGCCAATCCGTAGTAGTTAGGG
> TTCTCATAATTAACAGGAGACCTATTAACTCTTTCATCTTCTTATCTCTTTCATTCGTGT
> AGTTTACTCTGTAATGTACGCGTGACCGTAGTTTGATGACTCATTCTAACATAGGATACG
> AATCTGAGTCGGCTGATCACACCGTGTTTTAAACTGGATGTTTGGCATCATTTAAACAAT
> AATATAGAAATCGGAGAACGCAGTTTTTCTCTCAATTTGAAACCAGTAAAAATACAAACT
> TTTGAGATCTCTATAGGATAAGAGATAAGTTGTACTGTTTAAGCAATGTATGAAGTAAGA
> TTTGGTTCACGTTCGCAGGTAACCAGAAATATTACGATGGTGGCGAACGTCTCTAGTCAA
> AACCACATCGCTTAACCATGTGTTTGTGAAAGACCGGAGACTTATTCACTTGAGGATGTC
> TGCATCTTTTGATATCTCTTCCTAAGACATTTAATTATTATCTAATACCCTAGGGTGTGA
> TTCTAATTTAAAACTGAAGTAGTGGTGGGTTTTGCTTTGGGCCTTTTAGAAGCTTTCTTG
> ATCCTTGATTCGACGAACAACAGATTAAAGTTCCAGGGTTATAGTTGACAGAACTTATGA
> CATCAAAAATGCCTGATTTCGAAGAACGAATGCATTGCTAAGATTGAATATGTCCCCATA
> CAATCTGTTACGCTCGCTGGGAATGTATTACCTTTCAGGCTCTTAGAAGTACAATGATAC
> ATCCAGATCTAGCAAGCTGCAGTGGTCTTCCTGCGTATGTGAAGTGCGCAGCCATAAAAT
> TATTTCGATGAATACGCCTCATAGTATTGGTAAACATCAAAAATAATCTTCTCGACCTTC
> TCTGTGAATTACCAACCTGTACTCTCATGGTTCATACTAAGTAGGATCGAATAGCTAAAC
> TCTCTGCACAAGGGTACGTAATTAAAAAAATAACCCTGACGCATACTAAGTGCCTTTAAA
> CGTTAGTTTAAAAAGTCATTTCCGCTCTGAGTAAGTAAGAGTCGGGATATTACTTAGACT
> AAACATTACCAACTAAAACGAGAAGGATTACCAAGAGTGTTAGTCCATCTGCTCATGACG
> GGAAAGCACTTAGGTCTGTCGTAATATCTCAATATAATATATATTAGATGATTTTCCAGC
> TGATAATTATTACGACAACATTCTTTCTCAACATACAAAAGTATATTCAATAAAACTCCG
> GCCATAATTTTCCAATAGATAGTACACTGAGTTATAGACATTTCGGACAAATAACAATCA
> ACATAAGGTGAGCAATTTTATAAAAGTGAGCTTTTTGTCCATAGGTTAGATTAGGACTTT
> TAGTGTTCCATGGCTGACATAATCCGGGGATGGCCCAAATAAACAATAACTACTGAGCAG
> TATTAGGTTCCTAAGATCGGCGAGACAGTCTTAACGGTCGATTGTTCAGATATCTATGTT
> TTTCTGCGCCAGAAGTAATGGTTGGTATAAGTTAGATATTTTTGGATCACTTGCATCGCG
> ACCTGTTGACGAGAGGTTGTGGTATTTAACAAATAGAACCAGTTAATATAAAATTCGCAG
> TGTAACTTTGAGTCAGAAAATCATTATATTTACTTAGCGTAATGATCCATACAGAGTATT
> AGATTCCAATCGTGCTCTGGGTTATCGGGTGCCGTCAACTTACCTGCTGATGTCTTTAGG
> AAAGAAGCTGTTGAGGAGTTAGGATGCTGTGATAGATAGTTAAGCAACGATTGAACGCTA
> TCTGCATTTTGCCCATTACAGAGGAGTTCCTATGGAACATGGTTTTAGCTACAAATTTCT
> CAGACCAAACCTATATAGAATCGTTCCGGTCGATCTATCAGGTGATCGTAAAGTACCTCT
> TCCAAGCTTTGTCTTGTGAAAGTATTAACGTTTCCTGGACAATATTATATCGGCATTAAG
> GTATCCTTCTGGTTAAAGTGGTTGGCTACAGTGAAATATTTAGTTGAAGCTCGTACAAGA
> GAACGTGTCTTCGCCGATTAAATTTACAAAACTAGTATCATAACTTAGAATTTACGAATA
> TATGTATGAGTAATCACGCTAGGGTTAGTGTAAGTGACAGTAAAGTGGTACAATATGTAG
> CTCTATTAATATATCAAATGTCATTTCCAACTGGTCCAGTCAACTCTTGGCAGTAGTGAT
> GGACAAAATTAATTGCTAAGGGGTTGCTAGTGTACTTGTTGAGGGTCGACGCTTTAACGT
> CGCAAACTTGTGGTATCACCGCTATCCTTTTATGTGGTATAGCGGCGCAAGGATTCACGG
> AGAAACCAAGCCCGTAGTTAATCAATTGACTGTTCTTTTGGAGCCTTTGCCTAATATTGG
> GGACGTGTCAGAACATAGCTCTTCGCTCTAGGAATAGTAGACGGTTAAACGGATTGCGAT
> TGACTATTGACCAAACTGCCAAGAGCTACAGCCGCTTACTAACGTTAGCGATTTGCATCT
> GGATTCAGAATACTGTGTTCTAAGACTTTTCTCAGGAAACCCATTCTAGGGGAGGGTTCG
> CCCACTTAAATAATACACGGCATAATCTAAATTATCAGTCATTAAGCGTTTTAATCTGAT
> CAAGAGTCCTCAGTCTTCATTGAAATGACTCCCCCGAGTTGTCAACATCGTATAAACAAC
> TCATTCGGGTAACCCGAAGAGACCTCTTAGTGTCAGCTGTGTCATTAGCCTATAACATTT
> AGTATAAACAGGATATGATTTCATTGAATACTCTAAGTTTGCTAGAAGGTAATGGTGCGA
> TAGGAAAGGCACTCTACCTATAACGACTAGATCAAAATGGGTCCTGTCGAGAGGTCTCAA
> AGGCGTAAACTCCTGACGAGTCACTAAGAGATTCCGCACCGGGTTATAATGCAAGTGGGC
> GCTTTCAGTTTAAAATGCTGACAAAACACGGCCCAAATACGAGGCTGGACTATACGGCGT
> TTAGGTAAATATTCCCGTGTACGTATGTATGTTTCAAGGCAAAAGTAACAGATAAAGGTA
> CCAAAACCTTATAGATTATCACGGGCTCCGCTTAAACACTTGTATACAGTCTTAATCCAT
> AGTAATAGACTTTATAATGTTCTCGAGCAATCGATAAAGGAAAGCAGTTGTACAAATACC
> ATTCGTACGATATTCGCAATCGGGCATCAAACCAACATTACGTCGTAAATTATACCCGTA
> GTTCTTGATAACTTGAAAATGACAAACACACAAACGAGGATTTTCCCAAACTCGACAAAT
> CGTTATTAAAAACTCAACCTTATTTTAAGTTATCAGCAATCCTCGGACAATTGAGAAGGC
> AGGAAATAGCAATACGGTCTATACGTCACGCGAGCTTGAGAACCTTCGTACTACGCGCGG
> CGTTATTCAAGACTCCAAGTATTTGCCGTGCATGACTTAACAGAAATCCCGAAACCCGTA
> TTCATTGATCACTTAATCACTTGGTATAGTGCGTTACGATATCGATAAGCCGCCATGACG
> TTTTCGGCGCTATGTCCTTAATCGGAAGAAGCATCGGATTAATTCTCTGTACATGTTATA
> CAAAAAGATAGCTCCGCGTAAGTTTAGATCATGAGGGATAGTCAAAAAGTATTTCATTTC
> TTTAAAATATGTCGCTACGCCGTGTTTTAACACTTTCTATCGTCTTTTTATATTCTCGGA
> TTAAAAAATCACCTAATATTAGAAGAATGAGGCATCAAGAAAATAGTGAAAAGAGTCTTT
> AAGATGGGCAAGACTTAAACCAGTATACGCTTGTGTACTAAGAGATTTTATTTTCACAGT
> TCTCTGGAGAGGGTTGTTTATAGTTATCCGACCATTACCTAGATGTTATGGGGGGGCTGT
> CATGAAGGCCATAGTTTCTCCCCGCGGAGCGCTATGGGGCCGGAAATGCACCGACCACAA
> TTAATACCCTAACAATTTAATGTACGTGTTCGTAACGATTCTGTGCTTTTTGAAAACCTT
> TGTCAAATAAACTTCAAACATCTAGTATAATATTAATGTGGGAGTTGGTGGTAGGTTTTG
> TAGTAATGAAGCGTTCATTCTAACAGTAATGTGACTTGTCAAGCAGCGGCTTAAAGATAC
> ATAAGATTCGTTGATGTTTACTCTCAGTCATTAAAATCAGAATCATTTGATACGTCCGGT
> GAAATACCAACGTAAGTTGTTGTTAATCCAAGATAGGCTACAAAAGTAGATATTGTATTG
> CGGACGAAATTCTTATCTTATTGGTAGCACATGTCCAACCTTGTTAGATCCACCTACAGT
> GGAATAGTTAATGTTACATTAAGGCCGTTTCGTCTTTATACGACTAACCTCGAACAGGAA
> CCTTACGAAAAATTAACTGATTATTAGGAAGGAGGCTTTTTGAAGCTTCACCGAGATTGT
> TGTACAAAAACGAAGATTCATAGTCAGATCTATGAACCAATTGACCAGTACAATACTGTG
> TTGTCCTGCTTACAATCGCACACGATTGGTGTTCTAAGGTCACATGTAACTACATGACTC
> TACGATGGGTCGTCCACAGTCTATATTTCGTATAGACGTAACAGCTAATGACGTAATTGG
> TCCATTCTGGCTAAACAAATTCACTTGAACCAAACACATTCACTAGGCTACACGGACGCC
> AGAATTATAAAGAACCAAAAGATTTACCTTTTTCTGACGATAGCATCTGCTCAAAGTACA
> CGCAGAGGAGCCCCTCTGCCATTAGTTTCATAATACGACGGCTTCCACGTTCAGTGTCCA
> ACATTTAAATACCTAGTGGACTAAAATTTTTTGGAAACAGCGAAAGCCGTTTAGTGCGGG
> ATTTGGCCACAATCATCACGATTACTAATCTAAAAATTTCTCGATTCTATTGCGCATTCA
> TCGGTACATATGAACCTAAAAGTGTCCTTTTTGACTTATTTTCCGTGTTCAACTCGCAGA
> AAATCAATAACAATACAATTATTTAAGCAAAACACTTAGAAAGAGGTGCTATGGACCGAA
> ATTAAGGTCGGACCTAAATCTTATTAAGCTTATTTTGTACATCGCTTCCTAGCAGAACAA
> ATATCAACTGGTGACCGTTTACGCTGATTTTAAGAATGTTGATGTTTGAGCTAATATGCC
> ACACCGTAAAAAAGCCTAAATTAACCCTATCTCCCCGGAGCAACAGGATTTCGAATTCGG
> ACACATGGTGGATTTACGAATCATAACACTGTCCAAACTCCCAGCGATGGGGTTGTCTAG
> ATGACCGAATACATCATACTGTTCTCACCAGTTTAATGTTTTACGACCCCTCGGAAGTGT
> TCGTAAATCAGCTTTAACCAATTGACCACTGTTCTAAGTTAACCTAATCATTAGATCACC
> TCGGGACTGGACAAACCAAATTTAGGTCATCTCTACTGTCTCTACAGGTGACTTCTAATA
> ACGAATAAGAAACATTGCTCACCGTGAAGGCAATAAGCATGTGTGAGGCTTTCACATAGG
> CTAACATCTAGTCGTTAGCCCGAAATGCCAGTAGTCGATTGGTTTTATTTACACTCAGTG
> CTAGGTATGCAACGGATTATCCACTGCGAATGTATTACTAACCATTTGTCAACAATTAAT
> ACGACGGAAATTGTCCTTAGTTTAGCGGAATTCTCCAGTGTTTGGTAACTTATACATCTC
> AGAGAAACGTTGTTGCTACCTATTTTAGTGCATCCGTAAACATATCTTACGTTCGGAATT
> TAACCGTCGATTGTCATTATTGTTTACGTGCTACTGCGATTGTGCCGTGTCTGGTATCTT
> AATAAGTCACAAGAATTGCATATGATATCACCTGCTTACATCTATTGGAATCTCCACCTC
> CAATGGCTGCAGATTTTAAAGTCAGCTGAAAATACAATTATTTGATTAACATTTAAACAC
> CTCAGTCCATATGGATCATGTTTTGACGAATGTGCCGCTCAAATATAACGTAAAGTACAA
> TACTGGAAAATGGAAAAGCGAAAGTTAAAATCGCTCCGCTCTTACCCCAACGCTCCACGT
> TACTCACTTTGGGACACATAGAACAGGGGTTGTAATCTCTTTTTTAGTATAAGATCTGCA
> GAGTAATTGATTCTCCGGGTTTTTCTGGTAATGGGGTTGTATCGATTTATCGCAAATAAG
> CAAGGAATGTAACGCGATCCGCAGAAACGGTTGATCTCGACTGGAATGGTAGCCACAAGC
> ATTTTTCGACTAGATCGCGTTGTTCATCTACGAGATCGCGCAGGTCTGATAATTAACTTT
> TTAGGGAACGACAGTAAAATATATAAACCCCTTCCATGGCGTCTCACTGTATAACACTGC
> TCAAAGATAGTTAGTGGACTCAGTGCCGCAATTGCGTTAGATATACTTATAGACTTATAA
> AAGGTTCTTTCGGGTCATAAATTGTCAAGCTATAAAATGAGGATTCGGTGCTGTCGATAA
> TATACACTCTAATACCCAGAGTACTTTTCGCCAAGGGATGCACGTACTACAAGGGTCGTA
> AACGACTATACATAGTTTAGAATGTTTCTTAGATGTATGTAATCCTCCGGACACATGGCA
> ATCCCAAGGTGCGTTCGGCTTTCCTAGGTTACGCCGTTTTAATTACATGTTGATGCCGTG
> TAACTACATAGTCTATAAAACCGAAATGTACCGTCCCAATAGAAGATACCCAGATTGACC
> CGTTTCGCTGCCCCCGCGTACTCATAGCTTATTAACACGTTGCGTACATTCATGTGATAA
> AAGTGGTTTAGCCCACCGTATTGGAGCATGAATTAAGAGAGAAAGATAAGTCACGTGCAA
> TGAGTCCTAAGTTCATGGATCAGAGAATTAATCCTGTTTTAAATGTTGGATATTTCAGCG
> GGCATTAAAATTTAGCGTAATCGATTGAGATCGCGAAGGTAATCGAATAGAGCAAGTCGT
> TTTCAACTTTTGAGTATGTATTCATGCCAGCCTTTAAACCAAGACACTTTGTGTGTAAAT
> CGGTCTAATAAAAGGTGACTGGAATCGACATTCTTTCTTGTTTCGGGCTAGATTGGGTAA
> GAAAGATACATGACTACAGTCTCCTAGGGGGTGGCATATGAAATCAAAAATAATACTGCC
> CAGTGATAGTTATCCTGATGAGGGTTGGATCACTTAGGCGGGTGAGCTATTCGTCCTGCA
> AACTCCAATTATCAATTTCCTACGACACGCGGGACCTGTCTAACAATCTTGTGACCCACA
> GCCATTAAACGCAACTGGATAATTGTAACAAGTGTCGCCCCCAGGATGATTCGTCGATTA
> AACACAAAAGATATCAAGTGTCGCGAATTAAGATACAGGGGAATCAAACAAGATAGTACC
> GAATACGTTGTGGCTTTTCGGCAAATAGCTATACCAATCATCGAGTGGGATCGGATGAAA
> CTGATTCCTCTGACAAGAAGAGGGACGGGAGACCGTAAAACGCATTAATCATGACCGTTC
> CTCCGGGGAACTGGGTACTAGTTGAGTTTTTGATCTAAAGATACTGACGATTCATAACTT
> ATCGCCATAAAGGATCGAACCGATAAAGGGCGGGATCGTTATTACATACAATCATGTAGC
> AAATATGAACCAACAGTACTCGACTCCTCATAAAAGGCAGTAAACGATTCGTACATCTCG
> TTTCGAGGCTTTTAAATCGAGCTTTTGTCGGTACATCCTCATTGCTTTGTTTAGCGGTTG
> CATAAGGCTGTTCCTAGGTGCGATTTCCCCGAGGAACTGATGATCCTGACTAGAATCTGT
> GTTGACGTCATGATCTTCATTTACATGATGAGATAGACCATAATAACACAATAATTAGGA
> ACACATGCTAAATTGAATATTGCAACTGGTAAGAATCATAGATCAAATCTTTCATAATGC
> CAATCATGGAAAAAAGCACGTGCAGTTATGTTGGTGCTGGCGAATGCGGCGGCAGTATTC
> AATAGTGTTTGCTTTTCTAAGGGTGTTAGAAGACTGCTTCGATTAGCATAATTTGACCAT
> AGTAATGGCCTTAGGCTAGAATCACGAACAGGAGATACTTTGCGCATTCGATAATGATTG
> GCAAATAATCATTGTAGATTAGCGATTTTATCTCAAACTTATAAAGAGATGTTGTCACAC
> GAACGTCCTCTGCCGTGCTAGGTCTCAAATCAGTTACTCGTCCCCTTTATAGAAACTTCT
> AATTGACAAGTGTGGCATATTAATGCGTTGTTTTCCAACCCAACGACTATTGGCAGATGA
> GAAGGTACTCCTCGGACAATTATAGAGCAGTCGTATTCCTTAACTGTTCTTTGATGATGC
> TGGTATACTTTTAGGTACGGGACATGATATACAAGGGCATCTTTTAAGGAGCTCGTCCAA
> AGAGTGAGATTGTATATTAATAAATTCCGAACTAAAGGTTGACTAAACGCCACGATGGTG
> CTCTGAAACGCTTATCTGCCTTTATTTTCCGTCGGAGTAATTTCTCTCGGCTATTAGATT
> TGAACATATACACAGGCCAGATGATCTGGAAAAATCCCCTGGCGCAGCTTATATTAATGG
> TCCACAGCGTATCGCAATCATTAGGTCTAAATACGTAGTACATTTTTAATCTTAATAAGC
> ATTAACAGACAAAATGGAGGACCCACAATCCAAACAAATTGGGTTAGATTAGATTCAGCC
> TAAAAGACCCGATGTCAGGAGCCATGAATGTCACGCAAGGGCGTCATGTATCTGATAACA
> CTTCGAATAGAAAAAGACGGATCAGATTACAGGCGTGATATGACTCTACGGAAATGTTAG
> TCCAAATGAAAGCTCCATGACTGGCCTCATATGCTTGTATTTATATTATGACGAGAATTA
> TAAACAGAACATTCGTCATCCTTGGGCTCAACCAAGTAACTGTTCAGATATTCGAACATA
> ATTTCACTTCGTGGAAGTCGTCATAAAAGTATCCAAAAAAGAACATCATAAGGATGTAAT
> ACCTTTGAATTCGTACATCCAACACTTGTAGTTGAGTTCCGAGCTAGCGTATTGCCATGA
> TTCAAATCTGCATTCCCTAACTGCATAAGATTTATAGATATATATTTGGGAACTATTATA
> CATTTGTCTAGTTCCGTTAACTGATTTAGCTTAACTATGAATAACCCGTAGTTCCCAGGA
> GACTAAAAGGACGGAAGAAATCGACTTGATTTGTGCATTATGTGGGTTCGGCCATACTTC
> CATTGAACTCAGTGCTTTACGAAATTTCCAATTTCTACTGCGTAAGGCCGGATAAAGACC
> TCATTATCTGATATTTCTAACCGACTTAAACCCTAGCTAAATAAATAATGGTCTTGGTGA
> TCTCTCCTAATGCTAGTGTCACCAAGACTTAACTTGAATGGAACGTTGAAATTACTTTTT
> ATGCGGATCACATAGATAAAAAAAACTGTGCAGGCGCAAACCGTAAAGAAAATTTAGAGT
> ATGTATTACTCCCTCACAGTGTATTGTTCCACTCAGCTATTATATTCTTTGTTGACATAT
> AACAATTTTCAAATGAGAGACCTATTGAATCTGGGAAATTAAAGTAACGTTAGATGGCAG
> GAGTAAATTTATGAAAACACTAGGGCATTACCTAATGGGCACCTAGATGCAAGGCGGTAT
> AACTATTATAATCCACAGAAAAAGATAGAGCACTTTAACCTGGCTTATGCTTGCGGATCA
> AGAGAGAGTTAGTAAGTAAGTAGTCGCTACCCTCTGTGTAACACCAACACACTGTAGACG
> TATCAATCGCGAAGGACATCTTTATATGATCTAGAATGAGATTGAAGATAATTTTGACCT
> ATAGTAGTTCATCGCACAGTTATCCGTAGATAACCAATTTGAAAATGACGCGTGGGATAG
> ACATCGATATCGCAATGACGGAACTTCCTTCCCATCGGCAGTTTATTTCGACTAAATGTG
> ACATGAGCGTGAGTGATTCTTGCTTACGATCATTTTTAAGTACTGAGAACGGGTCAGTAT
> AACATGAATGATAAGAAATAGATGCAGGCTTTAGATTACCTAGGTTGGTCAATTTACGCA
> ATCACTAGGTCGTGAATGGACGACCTGTTTATAGAGCAAATCTTATTCGATCATATAAAT
> ACTTTCAATAATAGGTAATTAAGTTTCATAATTAAGTAAGATTGCCATCAAATGTCCAGC
> TTTGGATAAGCTTCATGATATAGACTGTTTAACTGTAAAGGAAGCGTACGATCGGAACAT
> TTTCTATACTATAGCATATAGATCGAAACTTAAAATTATACACAAGGATCCAATAATCTG
> CTTAGTTCACAGCTAGTCCGTTCATAGTTGTATATGGTCGTTATACCAGCTGTATACGCT
> GCCATAAGGCCCCATGGGAGATTGACTATAATTTGTTGATTGAACAAATGCACCGGTTGA
> CGGCATTTATACCATAATTTAGTTTAGCGAGTCCGAATAAGCTAGATATACTTATTGGAC
> AATATGAATGTCGGGAATTTGATGGATCGACAAACTCATCCTATCAAGCCTAAAACGGTT
> AAACGAGGCATATCTAAATGGGTCTCACCCTCGTAAATCTTACAGTGCATTGACAGTCGA
> TTCATGCCCCTAGCGTATGAGTGCTTGCAGATTGGAGACTCGCTAGGAGCGGTGGAGGTC
> ATATGCCCTGTGGTCTAGTCGCGACCCTTATCGTAATTGTCCCAGACACTAAACAAATTT
> GTAGTGTACTTAACAGAATACAAGGATCCAGAGGAGACTTATCTTATGATCTAGTCTGAT
> CCGATGTGTATAGAGGTACTGATATTGCGACTGTCTTTAAGAGTTATGCATAGAAATGAG
> TTGTAGGCTGTAGTCAGGAGTGAATCCAGAACAGTTCAGGTTAAATCTATGCGTTGTGCA
> TTGGTAAAGACAGTGTTAGACGATAATCATCTGCTCCGGGATCTGCCAAGATTACGCTAG
> GGTTGTCACGTCCCGATGAAGAGAGCTCCATACTCATCTTCTTGTATCAGGCTAGCCCAA
> CGCCATGTAATGCAGCGTTCCGAACTCATGGTACTTTATTTTATTCTTTCCCTCGGTCCT
> ACAGATATTTGCTTAATCATGTGAGTTAAATTATACCAGCTAATCGTAAGCTATTCAATC
> TCCCTGGAATATAAATGATTTAACATCATATTCTACTATATTTTACAAGGCTGATCAAGT
> TACTCGGTTTTCACACAATTAGGCGTGATAGACTCTAGACCTTTTTGAAGACCACATAAG
> AGTCCTTTGACATAAAGTGAAATTTAATACCCGCTGAGTATGTAGTGAAAGTATATTAAG
> TTATTATTAATCTGGATAACCATTTCATGGTCTGGAGTACTATTGCAAAACTTGATATGG
> ATGCGCCCGGACTTTGATGTACGTTGAACTGGTACCAGTGGACGAAATGACAGCTAATCG
> ACGATATGCAGTGCAATGATGACTTTTCCTGGCTAAACAGGACTTTTATCACCTAGATTT
> TTAAAATACCCCCGCCGAGCATCGCTACAATCCACTCTCGCCTACCTGCATATAATCCAT
> CCAGACAGGTATCAGCTGAAAACTTTTACTGTCGATAATGCGTTGCACTGGTCGAGTAAT
> AGTTTGCTCCCTCACATCCCGAGAAAGTAGTACAAGTTTTTATACGTTCATACCAACTAG
> TACCACTATCCCTAGGAGTTACCGTGCTAATAATTTTCAGGAGAAATAGGATCTCGTTCA
> GCGTCGTATCTATTTATGTCGGGTTCTTTACGATCGAATGGACGACTCACACGAGTGGCA
> TCAAGAATTATAAATTAGCAGAACAAGAGGTGGAGGATGAGAAAACACTGTTTTAATCTC
> CATGTTTCGCTTAATTTATTATAGTATATACAAATAGCACATAGCTGTTTTTCTATCAAT
> GTGAAAACAGTTATATTTATAACTTTTCAGATCTATTTACCAGTACAGAGATGTTGGTCT
> GTTGTACAAAGGTAGGATGGTTGATGTCGTTCAAGGTAGCAGCTTTCCACAATTAGTTAC
> ATGGTCGCGAAACTAGCTTGGCATAACAACATCGATTAAACATGTGTTTGTGTAAGACAG
> GTGACTGATGCTATGGACGATGGCGGATTAGTGTGTGAGATATTACTTAGAATTTTTATG
> ATGTTATATTAAACGAGGCGGGCTGGCGAATTTAATAATCTAGTAGTCCTGCGTTTGCAT
> GTCGGAATGTTAGTTGCTTTAGTGAGACTTGATTCCACGTACAACAGAGTTAAGTTACAG
> CGTTATTGTTGACACTTATTTTGTCTTCTAAAAGGCATCTTGTAGAAGAAAGTATGCATT
> GCGAAGATTGAAGATGGCCAAATTAATGATGGTAACATCCCTGGGTATGTAGTACCTTTA
> AGGCTCTTACTAGTTATAGGATACATCCAGTTCTTCCAAGCTGCACTGCTCGTAATGCCT
> ATCGGTACTGCCCACCCATAATTTTTTGTACATCAATACCAATAATTCTATGCCTTAACA
> TCTATAATAATATGATACACAGTATCTGTGAATTTACAAACTCGAATCGCATCCTGCATT
> CTTACGACGTTACTATAGCTATTCTCGATCAAATAGCGTAAGTAATTAAATATATAAACA
> TGACCCATACGAAGGGCCTTGATTCCTTAGTGTAATATGTCAGTTCCCCGCTGAGTATCG
> AACACTACCCTGAGTACGGACTATAAACAGTAACAACTTTTAACACAAGCATGAACTACT
> GGCGTAGGCCAGATCCTATGCTCGGGAAAGCACTTTCCTCTGTCCTAAGATCTAAATTTT
> ATATTTATGACTTGATTTTACTGAGGATTATTTGGACCAATACTTTCTTTCGATACAGAC
> AAATCTAGATGAAATAAAAATACCCACATTATTTTCAAAGAGTTAGTACACGGAGTTAGA
> GAAAGTTCCGTCTAATTACATTAAACTTATCCTGAGATAGGTTATTAAAGTGAGCGTGTT
> GTCAATTCCGTTGATTTCCAATGTTAGTCTTCCATCGCGCACTGAATACCCCCAGCGACC
> ATATAATCTTTAAATACTGAGCTCGATGACCTGAATATGATAGGCCACACTCTATGTACC
> GTACATTGGTCACATATATAGGTTGGTAGGCCAATCATGTAAGGGTTCCGAGAACTTACT
> TATGGTGGCATAAATGGAAGCGCGTCATCTTGACCAGTGGTTCTCCTTGTTAACAAATAG
> AAACAGGGTAGATTAAATTCCCAGTCTATAGGGCACTCAGAAAATCATGAGATGTAATGA
> CCGTAATCATCATGTAAGTGGATGAGAGTCAAATCCGGATATCCGGTTGAGGCTCCAGGC
> TACTTAAAGCCTCTTCTCGTTAGGTAACAAGCTGTTCAGGAGTGAGGTTGCTCTCATACT
> TAGTTAAGAAAAGAGTGTAAGATTTCTGCATTTGGCAATTTACTGAGGACGGCATATGGT
> ACTTGCGTTTTGATACAAAGTTCTCTCACCTAACCTAGATTGATGCGTTCCCCTCGTTCT
> ATATCCTCAGCCTAAAGGACCGATTCCAAGAGTGGTATTCTCATAGGATTAACGGTTCCG
> GCAAAAGTTTTTATCCGCATTAAGGTTTCCTTCTGCTTATAGGGGTGCGCTACAGGGATT
> TTGTGACTTGAACCGACTAAAACACTAACGGTAGTAGCAGAGGTTATGTAAAAAAATAGG
> TTCTTAAATTACTTTTTACCATGAGAGGTATCAGTAATCAAGCTACCCTTAGTGTAAGTG
> ACAGTAATGGCCGACAATATCTACCTCTTTGAAGATATAAAATGTAAGTTACAAATGGTA
> CAGTATAATAGTGGCAGTACTCATCCTCAAAAGTTTTGGATTAGGGCTGCCTAGTGTACG
> TCGTGACGGTAGACGATTGAAAGTCGATAAATTCTGGGATATCCCATATACTTTTTGGTG
> GTATAGACCACCTAGCATTAAACCTCATACCATCAAACTAGTTAAGCTTTTGACTCTTCT
> TTGGCAGAATTTGACTAATAGGCGCGACCTCTCAGTACATACCTCTTCCATATACCAATT
> CGAGTAGCTTTTTAGGATTCCCTGTCAATAGTCACAATACTGCCTTGTCATTAAGCCGCT
> TTCTAACGGTACAGTTGTGCATCTCGTTGAACAATACGCTGTGCTAAGTATTTTCGAACC
> AAAAAAATTCGACGCCAGGGTTAGAACAATTAAATAATTCAAGCCATTAGCGAATTGAGC
> ACTATGGTACAGTTTTAAGATCTTCTACAGTCCTCACTCTTCATTGTTATCTCTCAACCC
> AGTTGTCAAAATCGGTTAAACATATAAGTCGGCTAACCCGAACAGACCTCTTAGTCTAAC
> ATGTGTCAGTACACTATAACATGTTCTTGTTAATCCAGTGCAGTGCATTGATTAATCTAA
> GTTTCAGTGAACGTAAGCGGGCCAGACGAAACGCTATATACCTTTTTAGACTAGATCAAA
> ATGGGTCCGGTCCACAGCGATCTTACCCGGAAAATAAGGAAGACGAACTAAGTCATTAAG
> AACCCGGTGATATTCCAAGTGGGAGAGGGATGGTTATAATCCGGACATAAAAAGGCACAT
> TGAACACCCTGCACTATACGCAGGTGTCGTAATTAGTACCGGCGTCCTAGCTAGGTTGAA
> ACCCAAAAGTAACAGATAAACCGTCATTTACATGAGACTTTATCTACGCAGCCGAGTAAT
> AACTTGGTTACAGTAGTATTACATAGGAATTGACGTTAGAATGTTAGACAGAAAGCCTTA
> AACGAAAGCACTTCTTCTTAGTACATGAGTTAGATATTACAATTCGGCCTTCTTTCCAAC
> ATGTAGTCGTTAATTTGACCCCTACGTCTTGTTTAATTGAAAATCACAATCACTAAATAG
> AGGTTTGTCACATACTAGAAATATCCTGATTATTATCTCAACATTATTTTAAGTGATCTC
> CAATACTAGGTAAATTGTGATGCCAGGAAATACCAATTCCGTCGAGACCTCTACAGAGCT
> TGACTACATTCCTACTAAGACCGCCGTTATGAAAGACTCCTAGGATTTCCCGTGAATGAC
> TGAACAGAAATCAAGTAAACCCGTGTATTTCATCTATTAATATCTTCGTTTAGTGACGGA
> CGTTTTAGTTATCCACCATGGAAGTTTGAGCCCCTAGGGCCTGATGCGGAACAACAATAC
> GTGTAATGCGATCTACTGGTTATAAAAAAAGAGAGATCCGAGTAAGTGTAGATCATGAGC
> CATACTAATATTGTATGTCTTTTATTTATTATATCTAGCTTCCCACGGTGGTAACTCTTT
> CTATAGGAGTGTGATAGTATCCGTGGAATAAATCAACTAATTTTAGATGAATGAGGCTTC
> ATCATAAGACTGTAATCAGTCTGTTACATCCCCAAGACGGAATACAGTAGTCCCTTCGGT
> ACGAAGTGATGTGATTGTAACACTTCTAGCGAGTGCGTGGGGTTTTCTTTTCCGAACTGT
> ACCTACTGGTTATGGGGGCGCTCGCATGAACGAAATTGTTGATCCCCGCCCAGCGCTATC
> GCCCCGCAAATCCTCCGACCACATGGAATAACATAACAAGGTTTTCGAAGGGGGCCTTAA
> CATTAGCGCCTGGTTCAAATACTGTCTATATTAAACTGAATAAAGCTACTATTAGAGTAA
> TGTGCGAGGTGCGCGTTGGTGTTCTAGTTATGATGCCTTCATTCTAACAGTAATCTGTAT
> TCTCAAGAAGCGGCTTAAACATAAATAACTTTCGTTCATCGTTACTCTCACGCATTAAAT
> TAAGATTAATGTGATACGTACCGGGAAATAAAAACGTTAGTTCTGGGTAATAAAAGATTG
> CCGACTATTGTAGTTATGGGATTGCGGACGAATGGCTTATAGGTGGGCTAGAACAGCTCA
> AAACGTGTGAGTTCCTCCTAAAGTGCATGTCTTAATCTTAAAGTATGCAAGGGTAGTCTT
> TAGACCACTATCATAGAAAAGCTTACGTAACAAAATTTATATGATTAGTAGGAACGTGCA
> TGGTTGATCATTATAACACATTCTGGTAAAAAAAACAACATTCAGAGTAACATATAGCAA
> AATAGTCAACAGTTAAATACTCGCTTCGCATGCTTACATTCGCAAACGATTGCTGTGCTA
> TCCGAACATCTTTCTAAATCACTCTACGAGCGGTCGGCAAAAGTCTATAGGTCGTATACA
> AGTATCTGATATTGTAGTATTGGCTACATTATGGCTAAACATATTCAAGTGTACCATAAA
> AATTAAATAGCCTACACGGACGACAGAATTAGAAACAACCAATAGATTTACATTTTTAGC
> TCCTGAGCAGATGAGAAAACTACACCCAGACGACACCCTCTCCAATGACTTTAATAATAA
> GTACGCGGAAAACGTAAGTCTCAAACATTTAAATACATTCTCGTCGATTATGTGTTGGAA
> AAAGCGTAAGACGGGTACTCAGCGATTGGGCCACAATCTTAACCATTACTATTATAAATA
> TTGAGCCAGGATTTTCCGCTTTCTTAGGGAAATAGCATCCTAAATGTGTCCTTTTTCAAG
> GTTTTGCCCGGTTCTACGCCATCAAATGAATTTACAATACTATTTTTTATCAAAATCTCG
> TACAAAGTCGGGATAGGGACCCATATTAAGCGCGCTCCTAAATCTGATTAACATTAGTTT
> GTACATCGCGTAATTGAACATATAATTTAATATGGTGAAAGTTTAACCTCAGTTTTACTA
> TCTTCATGTTGCAGCTATTATCACTCAACGGAAAAAACCATAAATTTAACATTTCGCAAA
> GGACAAACTCGATGTCCTATGACGTAAATGCCTGCATTTACGTTTAATAACTCGGTCAAT
> ACTCACACACTTGCCCTTCGCGACATGACCGTATAATTCATTCTCTGCTAACCAGGTGAT
> GGTTGTACGTACCCTCCCAAGTGTTAGTAAATCACCTGTAAACTTGGCAAAACTCTGCGA
> ACTTAACCGAATCTTTTGATATACGAGCGACTGGACATAACAAATTTTCGTATTATCTAA
> GGGCTATTCAGGGGACTTCTTTTAAACAATAACAATAATTCATCACCGTGATCGATTTTA
> CAAGGTCGCACGCTGTAACTGACCCGAACAGCTTCTACGTAGCCACTAAGCCCACTACGA
> GTTTCGGTGTAGGTACACTCTCTCCTACGTATCCATCGGATTAGAATAGCCCATTGGAGT
> AATAACCATTTGGCAACAAGTAATACGACCGTAATTCTACTTACTTTTGCGCAATTAGCA
> ACGCTTGGGTATCGGATACATATCTGTCAAAAGTTGTTGAGACCTATTTTTCTCAATCAG
> TAATCATTTCGTTACGGCGCTTGTTTACAGTAGATGCTAATTATTGGTGAAGTCCTACTC
> CCATTGTGCAGTGGAGCGTTTATTTATAACTAAAAAGAATGGAATAGGATATCAAATGAT
> TACATATATGGGAATCTCCACCTCCATGCGATGCTCAGTTTAATGTATCAGGTAAATACA
> AGGTTTTGATTAAAATTGAAAAAAAGAACGAATGAGCCATCATGTTTGGACGAATGTCCC
> GATCAAATAGTACCGAAACTAAAAGACTGGTAAATCCAAAACCCAAACTGAAAAGACATC
> AGCGCTGACCCCTACGATACAACTTAATCACTTTGGCAAACATAGAAATCGCGTTGTTTT
> ATCTTTGTTACGATTTCATCGGATGTGTATTTGATTCTCCCGGTTTTGCTGCTAATGCGG
> GGCTATACATTTTTAGCATAGAAGATACGTAGCTAACGCCAGCAGAAGAAACCGTTCTTA
> GCGACGCGATTCGTAGCCACTAGATTTGTTCGACGTGATACCGTTGTTCAGATTAGAGAT
> AGAGCACGGATCATATTTAAAGTTTTACGCAACGAAAGTTAAATATATATAAAAATGCAT
> GGGACTCTCAAGGTATAAAACTGATAAAAGTGTGTTAGTGGAAGAAGTGACCCAATGCCC
> TTTCTTAGACTTATTCTAGTATAAATCCTTCTTGCGGGTCATATATTCGCTTGAGATATA
> ATCAGGATTCGCTGCTGTCCAGAATATTCAATCTATTTCCCAGAGGTCTTTTAGCAAAGG
> CATGCACGTAATTCAAGGGGCCGAAAACACTATAATTACGGTTGATTCTTTCTTACATGT
> ATGGATTCCTAAGGAAACATCCCTAGCACAACGTGCGGTCCCCTTTCCTAGGTTTCGCCC
> TGTGAATGTCTTGTTGTTGCAGTCTTTCTACAGTCTCTAGAATACCCAAATCTAAAGTCC
> AAAGTCATGATACCCACAGTGAAACGTTGCGATGAAACCGCGGACTCATAGATTTGGAAC
> ACCTTCCGTTATTTCTTGGCATAATTGTGGTTGTCCCCAAACGATTGGTGCTTGAAGGAA
> GACACAAAGATAAGGATAGTGCAAGCAGTCCTATCTTCATGGAGAAGTGTATTAATCCTC
> TGTGAATTCTTGGTTATTGCTCCGGGCATGATTTTTGACCGGAATCGATTCTCATCCCCA
> ACGTAATCCATTTGTGAATGTAGGTTTCAACGTTTGAGGTGGTTTTCTTCCCACAATTGT
> AAACAAGAATCTGTGTCTGTAATTCCGGCTAATTTAACCTCAATCGAATCCACATTCTTT
> CTTGGTGCGGGCGAGTTTGGGTAAGAAAGAGACATCTATAATGTATCCTAGGGGCTGCAA
> TATGTATTCAAAATTAATACTGCACAGTCATACTTAGCCGGTTCAGGGTTGGAGAACTGA
> GGAGGGTGAGCTATTACGCCTGCTTAATCCTATTATCATTTTCCTTACTCACGCCGGAAA
> TCTCTTACTATCGTGGCACCCTCTCAAATTATACCCAACGGCTTAATTGTTAAAAGTCGC
> GCCCCAAGCATCATTCGTAGATTATACAAAATAGATAGCAAGTCTACCCTATGAACATAC
> TGGGCATGCATTAAAGATAGTAAAGAAGAAGGTCTGCAGGTTAGCATAATTGATTTTCCT
> AGAAGAGTGGGGGAGAGGAGCAATATGTGTACTCGGACAACAAGACGCAAGCCACTCCGT
> AAAACGAATTAATCTGCAACGTTACGCAGGCGAAAGGCGGACTACTTCAGGTTTTCTGAT
> AAAGTTTATGAACATTATTAACTTTTACAAAGAATCCTGCCAAACCATTAAGGCCGGGTT
> ACTGTTTACATTCTATAAGGTAGATAATATCAAACTACACTAATCGACTACTAATTAAAG
> GCAGTAAAACTTGCCTACATATCGTGGACAGGAGTTTTTTTCCACATTGGGTCGGTACTG
> ACTCTTTCCTTTCGTTTCACGGTCAAGATGGATGTGCATAGGTGCGTTTGCCCCGTCGAA
> CTGATGATCCTGTCGAGAATATCGGTTCTAGGCAGGATCTTCAGTGACATCTGGACATAC
> TAAATAAGAACTATATAATGAGCATCAATTGAGATATTGATGATGGCAACTGGGATCTAG
> AATAGAGAAAAGCTTTAAGAATCCCTATCATCGTAAAAAGAAACGGCACTTATGTTGCTC
> CTGGACAAGCACGCCCAACTTGTCAATTCTCGTGGCTTTTCTAAGGGTGTTAGAAGAAGG
> ATTCCATTACCATAATTTGACAATACTATTGCACGGTCCAGAGAATCTCGAACTGGACTT
> ACTTGGCGAATGACATAATGATGGCATAATAAGATTTGTTGATTACAGAGGTGTTATAAA
> AATTAGATAGAGTTGGGGTCTATACAACGGCAGATCCCGTCCTTCCGATCATTTAAGGTT
> CGCGGACCATTTATAGTTAATTCTAATTGAAAAGTCTGGATTTTTTATGCGTGCTGTTAA
> TAAACATCGAATTGGGCAACAGCTCATGGTACTCCGCCGACAATTATAGTGCAGTACTAT
> TAATTAACTCTTCTTTGATCATGCTCCTATACGTTTTGCTAACCGACATGTTTTACATGG
> CAAGCTTGGATCCACATACTACAATCTCGGTCAGTCTATATTAAGTAAGTCAGAACTAAT
> GGTGGACTATACGCCACGATCCTGAGATGTAACCCTTTGCGGCCTTTATTTTACGTACCT
> GTTTTTTATCTCGGAGATTAGAGTTCATCTGATACACAGGCAACTTGTTCTGGATAAATA
> CCAGGCACCAGCGTATATTTATCCTCCTCAGCCGATCCCTATCATTTCGGCGTAAGAAGT
> AGGTCATTTTGAATCTTAATAAGCAGGTACAGACTAAATCGACCACCAAAAATCCTATCA
> ATTTCGCTTAGAGGAGATTCAGCCTATAACAAAACTGCTCAGCAGACATGAAGGGCAAGC
> ATGGCCGTAATGTATCTGAGATCACTTCGAATTGAATAAGAACCAGAACAGTTCACGCGT
> GATAGGTATCGTCGGATTTCTGTCGACTAATGTAAGCGCCATGACTGGCATCAGTGCATT
> CGTGGGATAGTAGCTAGAGATTGATAAACAGATCATTACTCATACGGGGCCGCAAACATG
> TAACTGGGCACTTATGCCATCATTTGTGCACTTACTCGAAGTCCGCATAAAACTTTAAAA
> TATAGAACTTAAGATGGAGGTATTACATTTCAATTCCTAAATCAAAAACTTCTACTTGTC
> TTACCTCCTAGCGTATTGACATCAGTCTAATCTCAATGACATTTCTGAATTAGAGGTATA
> CTTTTTTAGTTGGGATAGATTATACATTTCGAGTGTTCAGGGAACTCTTTTAGCTTAAAT
> ATCAATAACCCCTAGTTAAAACCAGACTATTACGTCCGATGAATTACTATTCTTTGGGGC
> TTTTTCTGGGTTCGCCCATACTTCCTTTGATATCTCTGATGTAAGATATTTCCAAGGTCT
> TATGAGGAAGGCCGGATATAGACCTAATGATCTCATATGTAGTACCCACTGTAACACTTC
> ATATATAATGATTGCTCTTCCTGTTCTCTACGAATGCTAGTCTATCATAGACTTATCGTG
> AAGCGATAGTTCATATGAAGTGTTTTGCCGATAAAATTCTGTAAAATAAATGTCAAGCCG
> CAATCCGGTAACTAAATGTACTCTTTGTATTTATAAATCACTGTGTTTTGTTCATCGCAC
> AGATGATTTTCTTGGTGCAAATATAAATATTTTCATAGGACACAACGATTGAATATCGGT
> TTGTAAACTTAAGTTACAGGGCAGCAGTTATTTTATCATAACTCTAGGGCAGGACATTTT
> GGCATCATTGTTCAAAGGCGGGAGAAATATGATATTCCAAACAAATACATACAGCTATTG
> ATACTCGATTATGCTTGCCGTTCAACACTGTGTGTGTAAGGATGTAGGCGCTAACCTCTG
> TCTAACACCTACACTATCTAGAACTTTCATTAGCGTAGGAAAGCGTGATTGGATCTACAA
> TGAGAGTCATCATTATTGTGTACGATACGACTTCAGACAACACTGAGCAGGACAGAAAAA
> TTGTCAAAATGAAGCCTGGCATACACATCCATATCCCTTTCAAGCTACTTCAGTACCAGC
> GCCAGTTGATTGCCACGAAAGGTGACAGGAGCGTCAGTCATTCTTGCTTACCATCATTTG
> TATGTACGGAGTAAGGGTCAGTATTACATCAATCAGAAGAAATAGATGATCGCTTTAGAT
> GAAAGAGGGTCGTAAATTGTCGCATTAACGAGGTCGTGATTCGACGAAATGTGGATAGAC
> AAAAGCGGTTTAGATAATATATTTACTTTAAATAATACGTATTTAAGTTTAAGAATGTAC
> TAAGATTCAAATCAAATCGCCACATTTGCATAACCTTAATGATAGTGTATCTTTTACTGG
> AAAGCATCCCTACGAGCGGTTAATTTTATATTATTTAGAATAGAGAGCGATACGTTAAAT
> TATAAACAACCTGACAATTAGAGCATGTCTGAACACCGTGTACCTGAATACTTCTAGATC
> GTCCTTATAACACCTGGATACCCTCACTTAACGAACCATGGGTGTTTGACTATTTTTTGT
> GGATTCATCATATCAACCCCTTGTCCCATGGTAGACCATAATGTTGTTGAGACTCGCCGA
> ATATCATACATTGTCTTATTGCTAATTTTCAATGTCCCGAATGGGAGCGTTACACTTTAT
> AATAATAGAAACCATTAATCGGTTTAAACAGCAATATCTAAATGGCTCTCAAACTAGGAA
> TGCTTAAAGGGATTGCTCAGTAGATGCAGGACCCGACCCTATGTGTGCTGCCACTTTGGT
> CACGAGATAGCAGAGCTCCAGGTATGATGCCCTGTGGTAGAGTCGCGAACCGTATCCTAA
> TTGTAAAAGTCAATAAACTAAGTTCTACTCTTAGTTAAAGATTAAAACCTTCCAGACGAG
> AATTATCTTAGGATCGAGTATGAGACCTTGTCGTTACACGTACTCATAGTGCCACGCTAT
> GTTAGAGTTTTGCATAGAATTGAGGTGGTGCCTCGTGTCTCCTGTCTTTCATGAACAGGT
> CAGCTTAAAGATTTGCGTTGTGCATTCCTATACACACGCTGACAACAGAATATTAGGATC
> ACGGATATGCCAACATTAAGCTACGGTGGTAAACGCCCGATCAAGAGACCTAAAGAATCA
> TATGCTTGTATAACCCTACCCCAAAGCATTGTAATGCAGACGTCCGTAATAATCCTAAGT
> GATTTGATTAGTGCACTCGCGCCTTCTCATTGTGGCGGAATAATCTGACTTAATTTTTAA
> AAGCTAAGCGGTAGATATGAATTCTCCATCGAATATAATTGAGTTATCAGCAGATTCGAC
> GATATTTTACAAGCCGGATAAACGTTCTCCGTGTTCAATCTATTACCCGTGATAGTCTAT
> TCAACGTTTGGAAGAACAATTAACAGGAATTTCTATGATAGTGATAGTTTATTAAAGCTG
> ACGTTCTTCGCTTAGGTTTGTTTGTTATTATTAATCTGGATAAACTTTTCAGGGTCTCCA
> GGTATTTGGCAAATCTTCATATGGATGACCCCCCACTTGCAGGTTAGTTGAAATGGTACA
> ACTCGTCCAAAGGAAAGATTATACAAGATAGGAACTGCAATCTTGAATTTTCATGCCTAT
> TCACGAATTGTAGCACCTAGTTGTTGAAAATACACACGCCGACAATCGATAAAATCAAAT
> AGCCCCTAACGGCTGTTAATACATCATGACACCTAGATGCTGAAAAAGTGTAATGTCCAT
> ATGGACTTGAACTCGTAGAGTAAGTGTGTCCTCACTCTCAGCAACACATAGTACTACTAG
> GTGTTATAAGTGAATACAATCGTGGACCACTTTACCTACGTCTTTCCCGGAGATGTAGGT
> TAACCAGTAATAGGATATAGGTAAGAGTAGGAGAGAGGGATGTACGCGTCGTTAAGAGCG
> AATGGAAGACTCAAACGAGTGGCATCAAGATTGAGAAATTAGCAGAACTAGAGCTCGAGC
> AGCAGAAATAACTCTGTTATTCTCCATCGTTCGATGAATGTATTATTGTAGTTACAAAGA
> CCTCATACCTCTTTTTATATAATGGTCTTAACACTTTTATGTATAAATTGTCTCTTATAG
> TTACCAGTACTGAGTTCTTCGTATCTTGTACAAAGCTTGCTTCGTTCATGTCGGTAAAGG
> GAGCTCCTTTAAACAATGTGGTACAGCGTCCACATACTAGATTCGAATATCATATTACAG
> TAAAATTGGCGTTGTCTATCAAACGTGTATGATGCTAGGCTCCATCGAGGATGAGGGTGT
> GTGATATTAATTAGTATTTTTATGTTGTGATATTAAAAGACCCGCGCTGGAGAAGGTAAT
> TATCTACTACTCCTCCCGGGGCAGGTCCCAATGTGTGTTCATTGAGTCAGACGTCTGTAC
> ACCTAAAAATCTGTTATCGTACACCGTTATTCGGGAAACTTAGTTTCTATTATAAAAGCC
> ATCTGGTACAAGTTACTTTGCATGCAGATCTGTCAAGATCGCAAAATTAATGAGCGGTAC
> ATACCTGCCTTTCTAGGTACTGGATGGAGAGTTCTTGGTATAGCATAATGACTCTTCTTC
> CAACCTCAACTCCGAGGAAGCACGATCGCTACTGACATCAAATTATTTTTGGGACATCTA
> GACCAATAATTCGTGGCCGTAAAATCTATAATTTGATGATACTAAGGAGATCTGAATGTA
> CATACTCGAAGCGCTTCCTGATTTATTTCGACGTGACTTTTCATATTATAGATCAAATAG
> CCTTACGTAGGAAATATAGATACAGCAACAATACGAACGGAATTGTTTACGTTCGGTATT
> ATGTATGTTCACCGCGCACTTTCGTTCACTACCCTGTGTTCGGTCTAGATTCTGGAAAAA
> CTTTTAACTCTACCAGGAACTACTCGCGGACGCATGATCCGATGCTAGGCATAGCTCTTT
> CCTCGCTACTATGTTAGAAAGTTTATATTTATGTCTTCAGTTGAATCAGCTTTATGTGGA
> ACTATAATTTAGTTAGATACAGACAAATCTAGATGAAAGAAAAATAACCAATTTAGTTTC
> AAAGACTGTCTAAACGCACGTAGAGTAAGTGACGTATATTTACTTTATAATGATCCGGAG
> ATAGGGTATTAAACTCACAGGGTTCGAATGTCCGTTCATGTCCAATGTTACTCTTCATGC
> CCGCAATGTATAACCCCTGCCAAAATTGTATATTTTTATACTCTCATCGATGACCTGAAT
> TTCATACGACACTATCTAGGTTACCTACTTTGGGAACATATAGTGCGGGGTAGCCCAATC
> TTCTAAGCGTGCCGAGTACGTACTTAGGGGGCCATATAGGCAAGCCACTAAGCTGCTACT
> CTCCTTCTCCTTGGGAAAATAGACAAAAACGGTTGTTTATATTACAAGGCGATAGGGCAC
> GAACTATTTAATGAGATGGAATGACACGTTTCATAATGTAACTCGAGGTCTGGAATTTCC
> GCATAGCCCGTTGAGCCTCAAGGATACTGTAAGCAGCTTCGAGGGACCTTACTACATCGT
> CTGCTCTGACCTTCAGCTCATACTTTGTTAACATTACAGTGTTACATTGAGCCAGTTGCA
> AATTTAATGAGGACGGAAGATCCTACTTCCGTTGTGAGAATAAGTGATATCTACTATAAG
> AGAGTGATGCCGTCACCTCCTTATTGATCCGCTGCCGAAACGAAAGAGTAATACAGTGCT
> AGTCTCATTCGATTAAACGTTAAGCCAATAGTTTTGATCCCATGTTAGCTTGCAGGCGCC
> GGTTACGCCGGCCATTCTCGGTTTTTGTGTCGGCTACAGACTAAAACACTAACGCTAGTA
> GAACAGGTTTGGTAAATAAAGAGGTTATGAAAGTTCTTGGTACCATGAGAGCTATCAGTA
> TTCAAGATACCCTTACGCGAACGCAATCTATTCGCCGACTTTTGCGTCATCTTTGTTGAG
> TTATTAGCGAAGGGACTTAGGCTAAACTATTATAGTGCCACTTCTCAGCCTAAATTGTTT
> TGGATTTGCCCTGCCGACTCTACGGCGTGACCGTAGTACAGTGAAACTACATTAATGCTC
> GGATATAACAGAGAATGGGTGGGGCTTGACACCACATACCAGTAAACCTCTTTCCTTCAA
> ACGTCTGAAGATTGTGAATCTTCGGTGGCTGAATTTGAATTATAGGCCCGTACTCTATCT
> ACATACAGATTACAGATACCAAGTCGAGTAGCGGTTTACGATGCCCTGTCAATAGTCAAA
> ATACGCAATTCTCATTAAGAACATTTAGAACCGTTCACTTGGCCAGCGCCTTGATCAATT
> CGCTCTGCGTTCTAGGTTAGAACCTTTAAATTTCGTCCCCACCCGGACAAAAAGGAATGA
> AGTATAGCCAGTAGAGAATTGTGCTCTATGGTTCAGTGGTATGATCTGATACACTCCTAA
> CTATGAATGCTTTTCTAGAAAACCACTGCTCATAATCCGTTTATAATATATGTACCCTAT
> CACGAACAGAAATATGACGCTAACATCTCTATGGTCAATTTAAATGGGTCTTGTTTATCC
> AGTGCAGGGAATGGATTAATAGATCGTTCAGTCAACGGATGCCGCCCTGTCCAATCCATA
> GAGAACTTGTTAGTATTGTGATTAAGCCCTAAGCTACTCACCGATATTACCAGGTATATA
> AGCAACACGAAAGTAGTCTTGAAGAAAACCCGGTTATGCCAACGCCCACAGGGATCGGGA
> TAATCAGCAAATAAAAACCAACATTGTACTCCAGCCAATTGTACCAGGTGTCCTTATTTG
> TAAACGCGTACGTGCGAGCTGGAAACCAAAAACGAAAACATATTCCGTAATTTAAATGAG
> TCTGTAGATACGCAGAAGAGTATTAAAGTCGTTAATCGAGTATGAATTTCGAATTCACGT
> GAGTTGCTTAGACACAAAGCCTTAATCCTTAGAACGGCTTATTTGTAATTGAGTTACAGA
> TTACAATTCCCCATTCTTTCAATCAGGTACTCCTTAATTTGAACACTTCGGCTTCTTTAA
> GTCAAAAGCACTTTCTATAAATACAGGTTGGTAAAATAATACAAATTTCCTGAGGATTTT
> AGAAACATGATGGTTAGTGTTATCATAGAATACCTAAATGCTCATCCATCCTAAGTCATT
> TTACCTAGTGACCGCTACACACCTTGTCTAAATTACTTCGTACACACCCCGGATGAAACA
> ATACTACGATTGCAACTCAAGGACTGTAAACATATCAAGTAAAACCGTGTATGGCATCTA
> TTATGATATTCCTTGTGTGACGGTAGTTTTACTGTTCAACAATGCTACTTGGACCACCTT
> GCGAAGGTTGACCAACAACAATACCTGTAATGAGATCGACTGCGGATTATTTATGTGACA
> GACGACTAACTGTACTTATGCACCCAGACGAATTTTCTTTGTATTTTATTTATTATAGCG
> ACATTACAACGCTGGGAACTATTTAGTTACGAGTGTGATTGTATACGTGGAATATAGAAA
> ATAAGTTTTCTTCTATCAGCCTGAATCATAAGACGCTAATCACGATGTTTCAGCCCATTC
> AAGGAATAATCGAGTACCTTCGCGTAGTAGTGAGGGGTTGGTAACACTTAGAGCGACTCC
> CTGCGGTTTTCGGTTAACTACTGTAAAGTCTGCTTTGCGCCCCCCGCGAAGCAACGAAAG
> TCTTGATAAAACCCCTCACATTGCCCCAACCATTGCATACCTAAACTTGGAATTACATAA
> ATAGGTTTGCGAAGGCGGCCGTTACTGTAGCGCATGGTGCAATTACGGGCTATATTAAAC
> GGAATAAAGAGACTATTAGAGTTATCTCCGACGTGCGCGTTCCTGTTCTTCTTATCTTGC
> CTTAATTATTACACTATGCGCTAGTCGAAACAAGAGGCGGATACTTTAAGTACTTTAGTT
> CATCGTTAAGAGAACGAATGAAATGATCTTTATTGTCTTAACGAACCGGAAAGAAAAAAC
> TTTCTTCTGGGTAATAAAACAGTCCAGAATATTGTTCTTATGCGATTGACCTACTATGGA
> TGTGAGGTGGGCGTCAACAGCTAAAAAAGTGTGTCTGCATAAGAAACGCCATGTCTGATT
> CTTAAAGTATGCAACGGTACTAGTTTGAACACTATAATAGTAATGCTTAAGTAACAATAT
> TTTTATCATGAGGAGCTACCTCCATGGGTCATCAGTATAACACTTTCTGGTAAAAAAAAC
> TACATGCTGTCGAACATATAGCTTAATAGTCTAAACTTATTTAAGCGCTGCGCATCAGTT
> AATTACAAATCCTTTCCGCTGATTTCCGAACATCTTTATTAAGCAATATACCTGCCCTCC
> GAAAATCTATAGAGGGACGTTACAACTATATCATATTCTACGATGGCCTAATGTATCCAT
> AAAATTTGTCTAGTCTTACATAATATTTAAATTCCAGTATACGAACACTCTAGTAGAAAC
> ATAATATTCTGGGACATTGGGAGCTACTGACAAGATCAGATAACTAATACAACACCTCAC
> CCGATCCATGGTCGTTAATATGTACTACCCGGAAAACGTAACTCTAAATCTTGTATATTA
> AGTCGCCTAGATTATGGGTTCGTAAATCACTAAGAACGGTACTCACCCATTGCCAAAATA
> GCTGAACCTTGAATATGATAATTTTTGAGACAGGATTGGCCCATTGATGACCGTAATTGC
> TTAATTAATCGGGACGGTTGCAAGGTTGGGAACGGGTATTAGACATCATATGAATGTTAA
> ATTCTATGTGGTATCATAATATAGTACTTACTCCGCATAGCCTAACATTGTTTCCGCCCT
> AAGTTAGCGGATTAACATGAGGGTCTAAAGACAGTAATTCATCTTATATGTTATTATCGG
> CAAACTTGAACATCAGGTGTTCTAGCGTCATCTTGCAGAGATTTTCAATCAACCGTTAAA
> TCAATAATTTTTAAAGTTAGCAAACCTCATTATCCTTGTACTATGACCTATATGCCTCCT
> GTTACCTTGAATATATAGCGCAATACTCACACACTGCCCCGTCGAGTCAGGACAGTTTAA
> TTCTGTAGCTGATATAATCGTGATGCTTGTAACTACACTACCAAGTCTGACGAAATAACC
> GGTTAAATTGGCAAAAATCTGCGAACTGAAAAGATGATTTTCTTATACGACCCAATCCTC
> ATTAATATTTTTCCGATGATCGAAGCGATAGTAAGCGGAAGTCTTTTTAACAATAACAAT
> ATGGCAGATACCGCATCCATTGTTCAAGCGCGCTCCCGGTAAATGACCAGAAATGATTCT
> ACGGAGCCACTTTGCAATCGACGACTTTCCGTGTTGGTTATATATCGCATACGGAGCAAT
> ACCAGTAGAATAGCACATTCGTGGAATAAAATGGTCGAATATAGTATTAACAACCTAATT
> CTAATTTCTGGTCAGCAATTAGAAACGCTTGCCTATAGGAGACATATATCTCAATACGTC
> TGGAGAACTATTTGTCTCAATCACTTATATGTTAGGTACGGCGCTTGGTTAAACGAGTTG
> CGATTTTTTCGTGTACTCCGTAGCCCATTGGGAAGGCGAGCCTTTATTTTTTACTATATT
> CAATGCAATTGGAGATATAAGCAGGACATAGTTGCCAATCGACTAATCAATGCCATCATC
> AGTGGTATCGATCAGCTTTTGAAAAGGTTTGCAGTAAAATGGAAAAAAAGAACGAATGTG
> CCATATTCGGTGGAACTATCGCACGAGCAATGAGTAACGAAACTAAATGACTGCTAAAGC
> CAAATCACAATCGGTAAAGACAGCACAGATGTCAACTAACAGAATACGGAAGATCTGTCG
> CTATATTTCAAATCCCGTGCTTTTATAGTTGGTACGATTTCAGAGCATCTCTATGTCATT
> AGACCCCTTTGGCGGCTAATCCCCGGCTTTACATTGTTAGATTAGAACATACCTTGCTTT
> ACACTGAAGATCAATACCTGCTTAGCCACGCCATGCCGTCAATATACATGGGTTCCAAGT
> CTTACACGGCGGAAGATTACACATACACATCCGAGCTTTTGTAAAGTTGGACCCTTACAA
> ACGTAAAGTTTTATAAAAAGGAATGCCACTAGATAGCTATAAAACTGAGAATTCTGTGTT
> AGGGGAAGAAGTCAACCTTTGCACTTTCTGAGACGGATTCTAGTATATTTCCTTAGGGAC
> GCGAATTTAGGCGATTCAGATTTTATCACCATGACCTCATGGCCAGTTTTTTAAAGATTT
> GTAACTCAGGTAGGTTAGAATACCCTGCCTACTAAGTAATCCCGACGAAAACAATAGAAT
> GACGGGTGATGCGTTATTTCTTCGTTGGATTAAGAACCTAAAATCCCTTGAACTACCTGA
> CGTACCCGTTCCTACCTTTAGCACTGTGAAGGTATGGGTGTTCCACTCGTTATAATGTCT
> ATAGAATAACCTATTCGAAACTCCATAGTCATCTTTAACACTGGCTAAAGGTGACAGGAA
> AAACACGTAGAATTCATTTGGAAATACGTCAGTTATTTCTTGGCTTAATTCTCCTGGTCA
> AAAAACGAGTCCTCATGCATGGAACTCTCTAACATAACGATAGTGATTGCACGAATATCT
> TCATCCAGATCTCTTTGTATAATCTGTGTTTTCTTGCTTATTGCTCAGCGATTGATTTGG
> GTCACGAAGAGATGCTCTGCCCCATCCGAAGACATTTGTCAATGTACGGTTAAAAGTTTC
> TCGTGCTTTGATTCAAACAATTGTATAAAACTATATGTGTCTCTATTTACGGAGAATTTA
> ACCTCTAGCCAATACAATTTATGGAGGGGTGAGGCAGAGTTTGGCGTACAAACAGAAATC
> TATTATGGATAAGTGCCCCGCCAATATGTTTGAAATTTGTATAATCCACACGCTTTCGGT
> GAAGGTTCACGCGTCGAGAAATGTGCACCCTCAGATTGTACGCCTGATTTAGCATAGGAG
> AATTTTAATTACTAACCACCCAAATCTCTTACTATAGTCGCTCACTATCAAATTTTTACC
> ATAGGCTTAAGTCTTAAATCTCGCCAAAAAAGCTTCTTGCCTACAGTATAATAAATACAG
> AGAAACTCGACCCTTGGTACTTAATCCCCTTGAATTAAACTGACTTAACAAGTAGGTCGC
> CAGGTTACCATTTTTCATTTTCATTGAAGAGTCGCCCAGAGCTGCTATATGTGGAATAGC
> ACAACAACACGCAAGCCTCTAACTATATAGATGTATTATGCTACGGTACGAAGCCCAAAG
> CCCGAAGTCTTCACGGGGTCTGATAATCTTTAGCAACATTATGAACTGTTACAAAGATTC
> CTGCCTTAACATTTTCCCAGGCTTACTGTTTAATTTATTTAAGCGTCATAAGTTCATAAT
> AAACTAATAGTAGACGAATTTTTCGCAGTAATACTTGACTTCAGAGACGGGACTCGAGTG
> GTTTGACACATGGGGGCCCTAATGAAGATTTCATTTCGGTTCACCGTCAAGATGCATCGG
> AAGTGCGGACTTGGACACGTCCATATCATCATAAGGTCGACTATATCGGTTCTACGATGC
> TTCGTAAGTGTCAGCTGCTCTGTCTAATTTTGTTATATATATTGACCTTAAATTGAGATA
> TTGATGTTGGAATAGCGGATCTAGAAGACTGAATTGCGTTAAGAAGCACTAGAATCGTAA
> AAACAAACGCATCTTAGCGTGCTCAGCCACAAGCACCACCAACTTGTATATTCTCGTGCA
> GTTTAGATCGCGCTGTCTACAAGCAGGACTGGTCAATTTGGTCAAAATTCTATTCCACGG
> TCCAGACTATCTACTAATCCTCTTAATGGCACAATGACAGTTTCTGGCCATAATTAGATG
> TCGTCTGTACACTGGTGTTATAATAATGAGATACACTTCGGCGCTATACTTCCGAAGATC
> CCCTCATTCCGAGCATTTAAGGTTCGACGAACATTGAGACTTTAGTATTAGTCTAAAGTC
> TCCATTTTGTTTCAGTGCTGTTAATAAAAATACAATTGGCCATCAGCTCATCGTACTACG
> ACCAAAATTAGACTGAACGACTTTTAATGTTATCGTATTGCTTCATCCGCCGAGTAGGTG
> TCCTAACCGAATTGTTTTAAATCCCAAGAGTGGTTCCTCAGACTAAATTCTCGCTCAGGC
> GATAGGAAGTATGGCACATCTAATGGTGCTCTTTAACCAAAGATCCGCAGATCTAAACCG
> TTGCGCAATTTATTTTAAGTACCTCTTTTGTAGATCCCAGTTTACAGGTCATATGTTTAA
> AACGAATCTGCTTATCCTTATAGAAAAGGCACAACAGTTTTGTTAGCCGAATAACACGTG
> CCATATATGTTCGGCGTAAGAAGTACGTAAGGTGGTTGAGTATTTACATGGTACTGTATT
> ATTCCTCCTAAAAAAATAATATCATTTTCCCGTTCAGGTCTTGAACAATTTTTCAAAACT
> GCTATGCACAAAGGTAGCGCAACAATGCCCCGAAGCGATATCTGATAACGTACTTGTCTA
> TAAGTACCTGATCAGTTAACGAGTGTGAGCTAGAGTCGCATTTCTGTCGAATATTCTATC
> AGACTTCTCGCGAATATGTGCATGCGTGGGTGAGGAGCTAGTCTTGGATATTAACTTCTT
> TACTAAGAAGGGCCCGAAAACATCTAAATCGGAACTGATGACATAATTTGGGAAAGGACT
> CCAACTACGATTAAATCGTTAAAATATAGTAATTATGTTCCTGCTATGACATTTCTATGA
> CTAATTCATTAAATGCGACTTCTCGTAACTCATACACGATGCAATTCAGGATATTATCAT
> TGAAATTTATCAATTAGTGGTTTTCTTTGTGAGTGCCCTTAGAGTATTCATTGCGAGTCG
> TAACGGATCTCTTGGTCAGTATAGAGCATTATAACCTTGGGAAATCCAGAAGTTTTCCTA
> CCTTGTATTACTATGCTTTGCGGATGTTGCGCGCTGACCCCATAAGTCATTGCATATATC
> TCAGGTTAGTTAGGTACATGGTAGTATCACGAACGAACCTTTTACAAAGATTGTGATCAT
> ATGTAGTAAACAATGTAACAATTCATATTTTATGATTCCTCGGCCGCTTAGCTACGTTGC
> ATAGGCTATAATACAATGATCGTCTTGCGATAGGGCTTTTGTAGTGGTTGGACGTGAAAT
> GTCTGTTTAATAAATCGCAAGCAGAATTAACGTATCTAAATGGTCTCTTTCTTTGTATAA
> ATAACTCTGGTGGCTGCATAGCACAGAGGTTTTTATGGCTGCAAATATAAATAGGTTCTT
> AGCACACAAAGATGGAATATCCCTTTGTTATCTTAACTTACAGGCAACCTCTTATGGTAT
> CTTAACTCGTCCCAAGGTCAGTTGGCCATAAGTGTGCATTCCACCGAGTTAGATGATATT
> AAAAACTTTTTCTTACACATATTGATAAGCCATTATCATGCCCCTTATACTCTCTCTGTG
> TTACGTTCGACGCCAGAAAATATCTCTTTATAATAATCTAGCTACTACTTGATTTACACT
> AGGAATGAGTGTGTGCATCTACAAGCTCTGTCATCATTATGGTGTAAGTGACGTCTGAAG
> ACAAAACTGTGAAGGTCAGTTAAATGGTCAAAATCTACACTCGCTGTCACTTACTGATAC
> ATTTCAACCTTATTAAGTAAATGAGCAACGTGTTGGACAAGTTAGCTCTAAGGTCCCTCA
> GGCTTTATTCATTAACATATGGTGGATGTAAGGACTAACCCTAACGATTTATTCAAGCTG
> TACAATGACTTCATCCATTTACAGGAAAGTCCGGCCTAAATTGTCCATTTAAAGTGCTAC
> TCTTTCCTCCAAAGCGGGATACTCATTAGAGGTGTACTGAATTTTTTTAATTGAATGATG
> TCGTATTTAACTTTAAGTATGTTCGATGTTGCAAATATAATCGAAACAGTGCCAGTTCAT
> GAATGATAGTCTATCTGTTTAGCGAATCCATCACTAAGTGACGTTAATGTGATTTTATTT
> ACATGTGAGAGCCATTAGTTATTGGATAAAAATCCTGACAATTTGAGCATGTCGGAACTC
> AGTCTAACGGATGACGTCTAGTTCCTACTGTTAAATCATCGATTACATCAATGTACCAAA
> ATTCCCTCTGTCAAGAGTTTTGCGGGAGTCATAATAGCAACACCGTGTACCATGGTAGTC
> AATTATGGTCTGGACACTCGAACAATTTCATACTGTGTATGTGGCCTAATGTGCTTTCGA
> CCCAAGGGCTGCCTTACAATTTAGATTAATAGAAACCATTAATAGGGTTAAACACCATGT
> TATTTATCCCGATAAAACTACGATTGAGGTATCGCATTGCTAAGGACATGAAGCAAAAGA
> CACTATGTGTCAGGCAACTTGGGTCAAGACAGTCCACACCTCCTGCGATGTTGCACGCTC
> CTAGTCTAGACTAACGGTTCCTAATTGTAAAACTCTAGAATATATGGTCGACTCTTAGTT
> AATCTTGAATACCTTAATGACCACAATGATAGTTGCATAGAGGATGTGAACTTGTCGTTA
> CTCGGTCGCTGAGGCACAAGCGATGTTACAGTTTTGAATTCATTTCACGTGGTCCATCGT
> CGATCCTGTCTTGAATCAAAAGGTAACCGTAAAGATTTCAGGTCGCAAGGCCGTTTCACT
> CGCTGTCAACTGTTGATTAGCATAACCCATATCCAAACAGTAACATACGCGGCTATACGA
> AAGATCTTCAGACCTAATGTAGCTGAGGCTTGTAGATCCCGTCACCTTAGAATTCGAATC
> CACACGTCACTTATAATCCTAAGGGTGTGGTGTAGTGAAAGACCGCCGTCTCATTGTGCC
> GGTTTATTCTGACGTTATTGTTAAAACAGTTGACGTACAGATGATTGAGAAATCCATTTG
> AATGCAGTTATAAGATGATTCGACGAGTTTTTAAAACCAGCATAAACGGTATCCCGGTGA
> AATCTTTTTCCACTCAGTCTAGATTCAAAGGTTGGAACAAAAATTATCACGAATTTCTAT
> GATACGCATTGTGTAGTAAACATCACGTTCGTCGCTTACGTGTGTTTCTGAGGAGTAATC
> TGCATTAAATTTGAAGGCTAGCCTCGTATTTGCCAATTATTCTTTTCGATCACAAACCAC
> GTGCTGCGTAGTTCTAATGGGACAACTCCTACTTAGCAAACAGTAGACAAGTTTGGAACG
> CATATCTTCAATTTGAAGCCAGATTATCCAATGGTAGCACATACTTGTTGAAAATAAAAA
> CCCCCACATGACAGTAAATAAAATAGCCAAGTAAGCATGTTTATAAAGCATGTATCCTAG
> ATCAGCAATTAGTGGTATCTACATATGCACTGCAACTCGTACACGATGTCGGTCATAAAT
> CTATGAAACACTTACTACGAATACGGGTTTGAACGGAATTAAATAGTCGAAAAATTTAAA
> TTCGTCGGTAACGCAGATGTTGGTTATCCTCTAATTGGATATACGGATCACTAGGAGAGA
> GGGATGGACGCGTCGGTTACAGAGTAGCCAACACTATAAAGACGCGCAGCAAGATGGAGT
> AATTTCCACTACTTCACCTCGACCAGCAGAAATAAAGCTGTTATTATACATCGGGACATG
> AAGGTTTTATTCTTGTGTATTAGACATCTTACATCTGTTGATAGATTGGGCTTAAAACGT
> TTTTGTATTAATTGTATCTTAGAGTGTCATCTTCTCAGTTCTGCGTAGCTGCTTCAATGC
> GTGCTTCCTTCTTCTCCGTATACCGACATCAGTTAAAATTTGTCGTACTGCCGACACTTA
> CGAGATTCCAATTTAATATGACAGTTAAATGCGCGTGCGCTTTCAAACCTCTATCAGGAT
> AGGCTCCTTCGACCATGACGCGCTCTGAGAGGAAGTACTATTTGTTGGTGCTGAGATTTA
> AACTCCCCCCATCCACTTGGGATTTAGATTCTTCTAATCACGGGGAAGCTCCCAAGCGGT
> CTTCATGGAGTCTCAAGGCTGGACAACTTAAAATCTGTTATCGGAATCACTTTGTCGGCT
> ATATTAGGTGCTATTATTTATGCAAGATGCGACATCTTACTTTCATGGCAGTTCTGTCAA
> CAGCCAAAAAGTAATCAGCCGTAAATAAATCCCTTGCGTGGTAATGGATCCAGAGTTATT
> CGTATTCCTTTATGAATCTGATTAAATCAGCATAGCAGAGGAAGCACGTGACCTTAGCAC
> ATAAAAGTATTGTTGCGAATGATTGTACAAGATGTAGTGGCAGTTTATGATATTAGTTGA
> TCAGAATAACGAGATCGCATTGTAATTAATCGAAGACATGACTCATGTAGTTACACCTGA
> CTTTTCAGTTTATACAGAATATTCCCTTACGTAGGTTTTTTTGTTAAAGCAAAATTTACT
> TCGCAAGTCTTTAAGGTCGGGTTTTTCTATCGGAACACAGCTCTTTACTTATATAACCTC
> TCTTAGGTCTAGATTATGGTAATAAGTTTTAATATACCTGGAAATTATCCCCGTCCAATC
> AGAAGATCATACCCATACATAGGTACTAGCGAATATGTGAGATTGTTTATTGTTTTGTCT
> TCTGGGGAATCACCTTTTGGTCCTAATATTATGTAGTGACATTATCTAAATTATTCTGCA
> TAGATTAATAACCAATGTTGGGTAATTCTCTGTCGAATACCTCGTTCTCTATCTGAACTA
> TATGTTATTGATAATGTTACGCTCATTCGGGTTTATTCGCTCACGCTGCGAATGTAACTT
> CTGGTACAAGCGTTCGATGAATGCCACATATCTAGAACAAATGACAAAATTGTTTATTTT
> TAGTAGCTCATAGTTGTCCTCAAGTTCTGACCACAATATATAGCTTACCTAATGGCGGAA
> CTTTGAGTGCGGGCTACCACAATATTCGATGCCTGAACTCTTCGTACTGAGCCGCCATGA
> TAGGCATGACACTAAGATGCTACTCTCCGGCGCATTCGGTAATTTGTCTAAATCCGTTGT
> GTTTAGGAAAACGAGTTAGCGCTCGATCTTTTTATTCTGTGCGTAGGTAACGTTGATGAA
> TGTATCTCCAGCTCTGGAATTGACGCAGAGAACGGTGACCCTCAACCATAAGGTAACAAG
> ATGCGAGGGTCCTTTATTCAGCGGCTCCTCGCTCCTGCAGCGAATTATTTCGGAACATTA
> CTGGCTTACATTGAGCAAGTTCCAAATGGAATCTCCTACCAAGTGCCTAATGCACGGGTC
> AGAATTTCGGAGATCTAATATAAGAGTGTCTTCACGGAAACTACTTATTGATCCGATGAC
> GAAACCTAACAGTAATTCACTCCGAGTATATTTCGTTTTAACCTTAACCAAATTCTGTTG
> TTACCATGTTACCGTGAAGGAGCAGGTTTCCCCGCCCAGTATCCCTTTGTCTCTAGGCTT
> CAGACTTAATCTATTACGCGACTACAACTGCTTTGGGTATTTAAGTCGTGATGATAGGTA
> TTGGGTAATTCTGTGCGAGCACTTTTAAACATTCACGGTCGCGTTCGCTATCGATTCCAA
> CAATTTTGAGTAAGATTGCTTCTGTGATTTGCGAACGGAATTAGCCTAATCGATTATAGT
> CCATCTTAGAAGCCTAATTTCTTTTCCATTTCCCCTGAAGACTCGAAGGCCGCTACCGAC
> TACAGTCATACGACATTTATGAGCCGTGATAAAAGTGAAGGGGTCCGCCTTGACAACACA
> TTCATGGAAAACTATTTAATTAAAAAGTCTGATGATTGTCTATAGTAGGGCCCTCAATTG
> CAATTTGAGCACACTAAGCGATCTTATGACAGATGACAGAGAAATTGTCGTCTACCGGTT
> TACCTGGAAATGTCTAGACTAAAATTTAGCAATTCTAAGTATCAACATTTAGTTACCGTA
> ACTGGGCAAGAGACTGCATCTATTACCGCTGAGTTCTAGGTGAGATACTTTAAATGGAGT
> CCCCACCCGGACAAAAAGGAATGTTGTATACAATGTTCAGTTTGCTGATATATCGTTCAC
> GGGGTTGATCTGATTAACTAAGATATAGGATTGCTTTTCTAGAAAAAATCGGCTATTAAG
> ACCTGTATATTATATCGACCCGTTAAACTTCTCAAATAGGTCGATATAAGCTCGATCGTC
> AAGTTATATGCGTATTGTTTATCCTGTCCAGGCATGGCATTAAGAGTTCGTGAACTCATA
> CGATCACCCACTGTACTTTACATAGAGAAATTGTTACTATTCTGATTAAGCCCTAACCTA
> ATCTCCGAGATTACAACCTTTATAACCAACTACATAGTTCTATGGAACAAAAACCGCTTT
> TGAATTCGCCCACACCCATCCGGTTTATCACCTATTTTATACCAAAATTCTACTACAGCC
> AATTGTACCACCTGTACTTTTGTCTAAACGCGTAAGTGCGAGCGGGAAAACATTTTCGTA
> ATCTGATTCACTAATTTTAATCACTCTGTAGATACCAACAACAGTTTTATAGGCCTTAAT
> CGAGTATGAATTTCCATTTCTACTGACTTGCTGAGACACATTCACTGTATCCTTACAAAG
> GAGTATTTCTAATGCACTTACTGATGACATTTACCCATGATTTAATTATGCTACGACGTA
> AGTTGTAAAAGTACGAGTCTTTTAGTCTTTAGATATTTATATATATACTCCTGGCGAAAT
> TAATACTAATTGAAGCTGGTTTTTAGATTAAGGTGGGGTACTGTTATAATTGAAGACCTA
> TTTGCTCTTCCATCCTTTGTAATTGTACCGAGTGTACGATACACTCAGTCTATAAAGGAA
> TTAGTACAAACCACGGAGCATTCAAGAATACGATTGCAACGCATGCTAGCTTATCATATA
> AACTTTAAACCTCGATGGCATATATTATGATATGACGTGTCTCACCCTACTTTGACTGTT
> AAAAAATGCTACTGGCACAACAGTCCCAAGCTTGACCTAATACATGAACTCGATGCAGAT
> CGTATCCGGTGTATTTATCTCTCAGAACACGATCTCTACTGATGCACCCAGTAGATTTTT
> CTTTCTATGTGAGGTTTTTTTGCGACAGTACAAAGCGGCGATATAGTGAGTTACGACTGT
> CAGTCGAGAACTGGTTTATAGAAAAGTTGTGTTCTTCTAGCACCATGATTATTAACTAGC
> TTTTCACGAGGTTTATGACAATTCTAGCATTAATCGTCTAAAGGCCCGTACTTCTCTGCG
> CTGGCTAAAACTGAGACCCTCTCACGCCGCTTGTAGGTGAACTAATGGTAAGTATCCTGT
> GCCCCCACAGCCATGCATCCAATGTCTGGATAAAACACATCACATTGACACAACATTTGC
> ATAACTAATATTCCTAGTAAATATATTCCTTTGACTACCCCCACGTTAATGTACACCATG
> CGGCATTTAAGCGCGATATTATAAGCATTTATCAGTCGATTACTGTTTGCTCACTCCGCA
> GACTTCCGCGTCTTCGTAGCTTCAATTAATGATTAATCTATGAGCTAGTCGAATCAACAC
> CAGGTTTATGTATGTTATTTACGTAATACTGTAGAGATCCATTGTATTGATCTTTATGCT
> CTTTACGAACCGCTTTGTAATTACGTTCGTAGCCCGTAGAATTCAGTCAACAATATTCTT
> CTGTTGCCTTTCACCTACTTTCCAGGTGAGCTGCCAGTCATAACCGAATTAAGTCTCTCT
> GAATAAGTAACGCATTCTATGATGATGAATCGTTCCAACCCGACGAGTTTCTACAATATA
> ATACTAATCCTTAACTTAATATTTGTTTAGCTTGTCGTCCTAACTCAATCCGTCTTCAGT
> ATAAATATGGATGCGTATAATTAATACTGGATCTCGAAATGAGTCCTTAATAGTCTAAAC
> GTATTGAAGACAGGCCAAGCAGGTAATGACATATACTTTCAGCGGATTTAACAAATTCGT
> TAGTATGCTAGATTACTCCCCGACCAAAATCTAGTGTCCGACGTTACTACGTTATCAGTT
> TCTACGATGGCATAATGTAGCCAGATTATTTGTATAGTCTTAAATTATATTTATAGTCAA
> GTATACCTACAATCTAGGACTTTCTTAATATTCTGGGTAAGTGGGACATAATCACATCAG
> CAGATATAGTATAAATCAACTCAAAAGAGAAATGCTCGTGATGTTGTACTACCAGCAATA
> ACGAACGATAAATATTGGTTTTTAAGTAGACTACTTTTTGGCGGCCTATATCACTTTCAA
> CGCTTATAACACTTGGCCAATATTGATGATAATTGAATTTGAGATTTTGGCACACACGAT
> TGGCACATGGATGACCCTATGTCATTAATTTATCGCGAAGGGGGATACGTTGGCAAACCG
> GATTACAAATAATTTCATTGTTATAGTATATGTGGTATCATTTTATACTTATTACTACCC
> ATTGCCTAAATTTGGTTCCCACCTAAGTTAGAGCATGATCATGACGGTCGTATGACACGA
> AGTCATCTTATTTGTTATTAGCCGCTAACTGGTAAAGCTCGGGTTATAGCGGATGCTTGA
> TCAGTTGTGCAATATAACCTTTTATAAAGTATGGTTAAAGTTACAAAACCTAATTATACT
> GCTAATTGGAACTATATGAAGCCTGTGAACTTGAAGATATAGCGAAATAAGAAATCAATG
> CACCGGCGAGTATGCTAACTTGTATGATGTAGCTCAGATAATCGTCATCCGGGGAACTAA
> AATAAATACGCGGACGTAATATCAGCTTAAATTGGAAAATAGATCAGTTCGGTAAACATG
> ATGTTCTGATAAGACACTAGCCTATTTAATTTTGGTCCGATGATAGTAGCGATAGTATCC
> CCAAGGATTTGTAACATGTTATATATGGCAGATAACGCATACATTGTTCATGCGCGATCC
> AGGGAAATCTAAACTTATCAGTATAACGTCAAACTTTGCAATAGTAGACTTTACCTCGTC
> GGTATATATCGAAGAACGTGCATTACCAGGTCAATACCACTTTCCTCGTAGTTAATGGGC
> CATTATACGATGTACAACCTTAGTAGAAGGTCGGGTCACCTAGGAGAAAACATTCCCTAT
> ACGTGTAATATATCTATATACGTCGGCACAAAGTGTGGTCTAATGAACTTTTATGTGACG
> TACCCACCTTCGGTTAACGACTGGAGATGGTGTCCGGTACGAAGTAGAACTGGCGCAACG
> CCAGACTTTAGGTTGTAAGATATTCATGCCAATTCCAGATATAAGCAGGAATGAGTGGCC
> ATTAGAATAATAATTCACAGCATATCGGGTATCGATAACCTTTTGAATTCCTGGGCAGGT
> TATGGCATAAAAAGAAACAATCTGAAAGATGCGGTCCTACTTGCGAAACAGATTTGTCTT
> AAGATACGTAATCAAGCCTATTGACTTATCAATATCGGTATACACAGAACACATCTAAAA
> TTACAGAATAAGGTAGATATGTCCATATATTTCAAATACACTGCGTTGAGAGGGGGGTCG
> TGTTCTGACCATCTCTATGTCTGTAGAACCCTGGGGAGCATTTTCACCCCCTTTACTTGG
> TGACATTAGTTCATTCCTTCATTTACAATGAACATCAATACCTGATGACACTAGCCTTGA
> CGTCAATATTCATGGCGGACTACTCTGACACGGCGGATCAGTACACAGACACATCCCAGC
> TTTTGGTTACTTGGTACATTACTATCGTTATGTGTTTTTAAAAGGAATCCCAAGAGATAC
> CGTTAAAAAGCAGATTTCTCTCTTTCGCCTACATCTCAAAATTGCAAATGTATGAGTAGG
> TTTCTAGGTGATTTACGGAGGCACCCGAAGTTAGGAGATTCAGTGTTTTGATCCTGGACC
> TCAGCGACTCTTGTTTAAAGAGTTGTAAATCTCCTAGGTTACAATTCCCTGCATACGTAG
> TATTCCCGACCTTAACTAGAGTATGAACGGTCATGAGTGAGGTATTCGTGCCTTGAAGAA
> CCTATAAGAAATTCAAATTACGCACGGAACAGTTAAGTCCTGTACAAATGGCAAGGTATG
> CGTCTTCAACGAGTTAGTATCTAGATACAATTAACTATGAGAAACGAAATACTAATCTGT
> AAATATCGCTAAACGGGACAGCAAAAACACCTAGAAGTCATGTCCAAATAAGTAACGTAT
> GGATTCCATTAATTCGCCGGCTAAAATAAAGTGTCCTCATGCATCGATCTATATATCAGA
> ACCATACGCATTCATCGAAGTTATGAAGCCTCATCTCTTTGTTGAAGAGCTGTTTTATTC
> CTTTTGGATAACCCATGCTTTTGGCTAACCATGACTGGATATGACACTTACGTTGAATTT
> TCTCATTCGACCGGTAAAACTTGCTCCTGCGTGGATTAAATCAATGCTTTAAAACTATAT
> CGCGAGCGTTTTACCGAGAAGTTATCCGATAGACTTGAAAATGTAGGGAGGCGTCACCCA
> CTCTTGCCCGTACTATCTCAAAGATAGTATCGAGAAGTCCCCAGCCATGTGCTTTGATTT
> TTGTTGTATCAAAACGATGTAGGTCAACCTTAACCCGTCCTGATATCTCCACCCGCACAG
> TGGAAGAATCATTTAGAATTGGTGATTGTGAAGTAATATACAACCAAAGATATTTATAGA
> CTCGATAAATATCAATGGTTTAAATTACCATTTAGGCTTTAATCGACACAAAAATCATGA
> TTGACGACTGGTTTATAAATTCAGTCAATCGAGAAACTTGCTTCTGAATCCCCTTCATTT
> ATACTGTCTTAACAACTACCGCGCAAGCTGACAATTTTTCAGTGTAATTGATCACTCGCC
> CTGACCTCATTTATCTGGAATACCAATTAATCTACAAACCCTCTAACGTTTTACATGGTT
> TATCCTAACGGAACAACCACTTACCCCCTAGTCGGATCGGGGTATCATTATCTGTAGCTA
> ATGGATGATAGGTTAAAATGATTCATCACTTAACAGTTTCCCACCCTTACGGTGTTATTT
> ATTGAACCGTCATTTGTTAATAATAATATTAGACTAGAAGAAGTTTTCCATCGATTAATT
> CAAGTATGAGACGGCACTCCAGGGGTTTGAATCAGGCCCGACCTTATGAAGATGTCAGGG
> CGGTTAAACCTAATCTTCCAGCGGAAGTCCGCACTGGCAAAACTCCTTAGCTGCTGAAGC
> TAGACTTTATAGCGTATACCATCCTGAGGAACGCTAAGATCCTATGTATAATGTTCTTAT
> ATTGTTTGACCTTATATGCAGTTTTTCATCTGGCAATAGCCCTTATACATGTCTCAATTC
> AGGTATCAAGCAATAGATTACTTTTTTCAAAACCATATTTGCGGCATAAGCCACATCCAC
> CACCAACTTCTATAGTCGCGTGCAGGGGAGTTCCCGCGGTCTACAAGCAGGAATGGTCAA
> GTTGGTCAAATGTCGTTGCAAACGTAAACTCTTGATACTAATCCTATGTAGGCCACATGC
> AATGTTTCTGGCCATAAGTTCATGGCGTCTGGTAACTCCGGTGATAATTAGGAGATTCAC
> TGCGCCGATATAATTACGAACATAAACTCAGTAAGAGAATTGAACCGTAGACCAAAAGGG
> AGTCTTTAGGAGTAGGCTAATCTATCCATGTGGTTTCACGCAGGGGAATAAAAATACTAT
> TCCCAATAACATAATCCGAATAACAACAAATGTAGACTCAACGAATTTTAATGTTAGCGT
> ATGGCTGCTGCAGCAGTGTACGTGTCAGTACACTATTCTGTGTAATCCAAAGAGGCGTTA
> CTAAGACGAATTTCTACCTCAGGCGAGTGGATCTATCGAACATATTTTCCGCCTAGTTTA
> CAAAACTTCAGCAGAGCTTAAAAGGTCAGCAAGGGTTGGGAACGACATCGTTGGGAGATA
> CCAGTGTTCAGGGATTATCTGTAAAACCAATCTGCTTAGCCTTTTTGAAAACCCAAAACA
> GGTGTGGTTGCAGAATAACACCTGAAATTTATGTTACCACTTTGTACGTCCTAAGGGGCT
> TGAGTATTTTCATGGTTATCTATTTTTACTCATAAAAAATGAATATAATTGGCCAGGTCA
> GGTCTGGATCAATTTTTATAAAATCATATCATCAAAGCTAGCCATACAATCCAACGAAGC
> GAGATCTGTTATAGTACTTGTCTATATCTAACTGATATCTTATCCACTCTGTGCTAGACT
> ACCATTTAGGTAGAATATGCTATCACAATGCTAGCCAAGATCTCAATGACTCGCTGACGT
> GATACTCTTGCTGTTTATCTTATTGAATATGAACCCCAAGAAAAAATCTATAGCGCATAT
> GTGGACTTATGTTGGCAAAGGACTCCTTCGACCATTATTTAGTGAATATTTACTTATTAT
> CTTCCTCCGTTGAAATGTATTTGACGTATGAATTATAGGAGTAGGCTAGTAAATAAGTCA
> CGTTGCAATGATCGATTTGAGAATTCAAAGTTATCAAGTTCTCGTTGTCTGTGTGTCTGC
> CCTTACTGGAGTAAGGGCCAGTCGGAACCCATATCTGGGTCAGGATAGTGATTGTTAAAA
> GTCGGAAATCAACTAGTTTTACTACCTTCTATTACTATGATGGCCCCATGGTGAGCCCGG
> ACCAATGAAGGAATGGCATATATAGCAGGGTACTTTGGGAATTCCGAGTAGCACGTACCA
> ACCTGTTTCTAAGATTCTGAGATTTGGTAGTAAAAAAGCTAAAAAGTCATATTGTATCTT
> GCAGAGGAAGCTTAGAGAACTTGCAGACGCTATAATTCTAGGTTACGCTTCACATACGGA
> TTTGCTACGCGGTGCAACTGATATGTATCTTTTTTAAATCGCAACCACATTTAACCTTTA
> TTATTGGTATATTGCGTGGTATAAAGATATCGCGTGGCGGAATAGATCACTGCTGTGGAG
> GCCGGCTATGTTTTATTGGGGATTTCCTATCTAACAGGCTATATCCCTTTCGTTTCGTAA
> CTTTATCCCAACATCTTATGGGTTATTTAATAGTCCCATCCTAAGTTGCCAATAAGTCTG
> AATTCCACCGTCTTAGTGGTGATGAAAATATTTTTATGTATCATATTGTTAAGCCAGTTG
> CAGGCAACTGATTCTCTCTCGCTCGTTCCTTCGACGACAGTAAAGAGCGATTTATAATAA
> TATAGCTTCTAAGTGATTGACACTTCCTATGAGGCTGTCCTGATTATTGCTCTCGAATCA
> TTAGGCTCTAACTGAACTCTGAACAAAAATAGGTCAACGTATGTTAATTGCGATTTTTCT
> ACACTCCCTGTATATGACTGTGAAATTGATACATTATGAACGAAATCACAAACGTGTTGG
> AAAAGTTAGCGCTAAGCTCACGCACGCTTTAGGCAGTTAATGATGGGCGTTCGTAGCTCT
> AACCCTAACGTGTTATGCAAGATCTTCTATGACTGCATCCAGTGTCTGCTAAGTCCCGAC
> TATTGTCTACATTTATACTCCTACGCTTGCCTACTAAGCGGCTTTCTAATTACACCTGGA
> CTGATGTGTTTTAAGTGATTGTTGTACTTTTTAACGTGATGTTGCTTAGATCTGGAAAAT
> ATTTGACAATAAGTGCCTGTTAATGATGCATTCTCTAGCTGGTTAGCCATTCCTTCACTA
> ACTGACCTTAATGTGATTTTAGTGTCATGTCTCTGACTTTAGGTTTTGGATTAAATTACT
> GAATTGTTGACCATGTCGCAAATAAGTCGAACGCATGTAGGCGTGTTCCGACTGTGTAAT
> AATCGATTAAATAAATGTAACAAAATGCCCTCTGGCTAGTGTTTGGCGCCTGGCATATTT
> GCATAAACGGCTACAATGCTACTAAAGTTGGGTCGGGTCAATAGAACATGTTAAGTATGT
> GTATGTGGCCTAATGTGATTGCGACCCTAGCCCTCACTGACTATTTAGATGAATAGAATA
> AATTTTTACCGGTATACTCAATGTGAGTTATCCAGAGATAAAGACGTTTGAGGTATCCCA
> TTGATATCGACATCAACCAAAAGTCACGAGCTCGCAGCAAAATTGCCTATACACAGTCCA
> CACCGCATCCGATCTTCAAAGCTCCGACTCGACACTAAAGGTGACGTAGGCTAAATCTAT
> AGTATATTTCGTAGAAGCGTAGGTAATCTTGTATTACTGAATCAACACAATGAGAGTTGC
> TTACTCGATCTGAAATGCGAGTTTCTACGTAGATGTCGCAATAGAGAGCTTACTCTGTGC
> ATTTCTTTTCTCGGCCTCCAGACTCGATAATCGCTTGAATCTAAACCGATCAGGATTGAG
> TGCACGGCGCAAGGACGTTTAAATAGAGGTAAAATGTTGATTACCATAAACCAGATCAAT
> AAAGTTACAGTACCGGCTATAAGAAACATCTTCTCTAAGAATCTAGATGAGGAGGCGAGA
> TCCAGTCAAATTACAATTCGTATCAACAACTAACTTAGATTCATTAGGGTGTGCTGTACT
> CAAAGACAGAAGTATAAGTCGCCACGTTGATTCGCAAGGTATGGTGTAAACAGTTCACCT
> TCAGTGCATTGAGAAATACATGTGTATGCTCGGTTATCATGAGTACTAGAGTGGTTTATT
> CAAGCTGATTCGGTAGACCGGTGATATATTGGTACACTCAGTCTAGATTAAAAGGGGGCA
> TCTAAAATGTTCTCCAAGTGATATCATTCGCTTTCTGTAGTAAACATCAACTTCGTAGAT
> TACCTGTCTTTCGGTGGTGTTTTAGCCTGTTAATTGGATGCCGAGAATCCTAGTTGCATA
> TTATTCTGTGCCTGCAAAAAAATAGGCATGCGTACTGCTAAGCCGAAATAGACTACTTTG
> CAATCAGTAGAATACTGTCCATCGCATTGATTCAAGTGGAAGCAAGATTATACTAGGCGA
> CATAATTCTGGTGCTTATTTAAAAACAACTCATGACAGTATTGAATAGAGAAAAGTAAGC
> ATCTGTATAATGAATCTATAATTGATCAGCAATTACTGGTAGCGACTGTTGCAATGCAAA
> GACGACACGATCTCGCTCATAAAGATATGAAAAAATTTCGTCGTATTCCGCGGTGAACGC
> ATGTAATTACTCCTAATAGTGAAAGTACTCGGTAAACCAGTTCTTGGTTATCATCTAAGT
> CCTTAGACCGATCACGACGTCACAGCGTTCGAACCCTAGGGTACAGACTTGCCTACTAGA
> TAAACTCGCCATGATTCTTGCAGTTAGGTCATCTAATTCTCAGACTCAACATCTTATAAA
> GCGCGGTTGAGAATGCGGGACATGTTGCGTGGTTTCTTGTGTATTTCAAATATGTCATAG
> GGGGAGTGATTCCGATTTAATCGTTTTGCTTGTTAGGGGATCTGAGTCTGTAATCGTATC
> TCTGCGGACTAGAGGCGTATTTCCGTCATTACTTCTGCGACCGATACCCTCATCAGTTAA
> TATTGCTCCTAATGCCGACAATTAAGACAGTCCATTTTAATATGACTGGTTAATGCGCGG
> GCGCGTTCTAAACGCTAGCTGCAGAGCATACTGCCACCATCTCGCGCTCTCAGAGGTAGT
> TCTATGGGGTGCTGCGCTGTGGTAAACTCCACACAGCCACTTGCGTTGTAGAGTCGTAGA
> AGAAAGGCCAAGCGAAAATGCGCTCTTAAGGGACGCTCAACGCTGGAATAATTATTATAT
> CGTTTCCGAATAACGGTGGACCCTATATGTGGGGATATGAGTTTTCAAAGAGGCGAATTC
> TTAATTGCATGGAACTTCTCGATTCTGACAATATGTATTCTGACGTAAAGAAAGCACGTG
> CGTCCTAAGGGATCCACAGGTATTCCGATTCATGTATCAATATGAGGAATTCAGAATAGA
> ACACCTACAAAGTGACAGTAGCAAATAAATGTTTTGGTCCCTATGATTCTAAATGATGGA
> GTCCAACTTTATGAGTTTTGTTGAGCAGTATAACGAGAGCGCTTGCGTATTAAGACTTGA
> CATGAAGCATGTAGGTACTACTCTATTGTCAGTTTAGACAGATTAGTCACGTACCTTCCT
> TTTTTTCTTTATCCTAAATGTACTTACCAAGGCTTGAAGGTCCCGTTTTTCGATCGGAAA
> ACACCTAGTGACTTATAGTAAAGCTCGTACCTATAGTTTATCCTAATTAGTTTTAATATT
> AATGCTAATTAGACACGTACAATCAGAAGTGCAGACCCTTTCATAGGTAAGACAGAAGTT
> CTGAGTTTGTGGTGTGTGTGCTAGGATCGGCAATAACATGTTGGTCCTAATTGTATGGAG
> GGACTGTATCTATTTTAGTCTGCTTTGTTTTTGTAAAAATGTTGGGGAATTCTCTCTAGT
> ATACATAGGTCTCTATCGCAACGAGTTGTTATTGATTAGCTTAACCTCAGTCCCGTGGTT
> TCGCTCACCCGGCGAATCGAACGTATGGGAATAGCGGTAGAGGAATGAAACATATCTTGA
> AAAAATCAATAATGTCTTGAGTGTTAGTAGCTCATACTGCTAAGCTTGTGATGTCCAATA
> TAGAGACCTTAACGAATGGCCGATATGTGTCTCCCGCCGTCCAAAATATTCGTTCACGCA
> ACTCTTACGTATGTGCCGCCATGATTCCCATCAAAATATCAGGCTAATCTACGGAGAAGT
> CCGTTATTTCTCTTTATCCCTTCTGGTTTGGAAATCGACTTTCCCATACATATTTTGATG
> CTCTGCGTAGCTAAACTTGATGAAGCGATCTCCTGCTATCCATTTGAACATGAGAAACGT
> CTCCAGAAACCATTAGGTATCAAGAGGAGACCGTAATTTATTCAGACGATCATAGCTCAG
> GAACAGATGTATGTCGGTTAATTAATCGCGTAAAGTCACAATGGGCCAAATGGTATCTCC
> TACCATCTGAAGTATGCACGGGGCACTATTTCGCAGATATAATTTAAGTCTCGCTGCAAC
> GAAAAGAAGGAGTCTGAAGATCAAGTTTACTAACACGAATTAACGCAGACGAGATTTCCT
> GGTTACCGGAACAATTTTCTGGTCTGAAAATCGTTCCGGGAAGCACCACGTTTACACCCA
> AAGTATACCTGTGTCGCTACCCTTAACAAGTATTATATTTACCGTCGACAAATCCTTTCC
> GTTTTTTAGTCCTGAGGTTTCGTATTCGGTAATTCTCTCCGTGATCGTTGATACAGTAAA
> GGTCGACTTAGATATAGTTGACAACTATTGTCACTAAGAGGGCTTCTGTGATTTGCCATC
> GCTATTAGCAGAATAGAGTTGACGCAATAGTAGATCAATATTTTCGGTGCCTGTTCCAAG
> CAAGTAGCGTACGACGCTACCGTCTAATCGCTTAAGAAATTTAGCAGCCCTGTTAAAACT
> CAAGGCCTCCGCAGTCTAAAAAAATTCATCGATAAAGATGTAATTATAAAGTAGGTTCAT
> GCGCTAGAGGAGCGCCATCATGGGCTAGTTGTCCAAACTAAGAGATCGTATGTAACAGGA
> AAGAGTAATTGGACTCTACACCTTTTACTGCAAATCGATAGTCGATATTTTACCAATTCG
> AAGTATCAAAAGGTAGTTAACGTATATGCCCATGAGACTGCATATTGTACAGAGCACTTA
> TACCGGACTTAATTTAAATGGACTAAAATAAACCAATTATAGCTTTCTTGGATTCAATCT
> TCACTTGGCTCATAGTGCCGTATCGCGGTTCAGATGATTATAGAAGATAGAGGATGGATT
> TGATACAATAAATCGCAGATTTTGAACTGTTTATGAGATCGACAAGTTAAACTTATCTAA
> GAGCTAGAGTTATGCGCGATCGTAAAGTGTTATCCGGAGTCGGTAGAATCTCATCCCATG
> CCTTGTAGAGTTCGGGATCGCTTACCTTCACCCAATCTAATTTACAGACACTAAGTGTGA
> CTAGTCTGATTTTCACCGAACCGAATATCACAGATTTAAACCTTTAGTACCTTATACATA
> CTTCTATGGTACATAAACCCCTGTGGAATTCGACATATCCCATACCGTTTTGAACATATG
> TTTTTAAAAATTGCTTATAAACAATAGTCTACATCCGCGACGTTTGTCGAAAACACTAAG
> TCACTCAGCCATTAAATTTTAGTTATCTGTTTAACGAATGGTAAGCTCTAGCGTCAGAAC
> ATCAACTCGTTTATACGACTGTATACACGTGCAATGTACTTGGATACGCTCTTGAGGACT
> ATATTTCAAGGTTTACTTTCATAGCAGTAGTTCTAATGCACGTACTGTGGTAATTGAAAA
> AGGATTTAATTATCCGAAGACGTTTGGTCTAAAAGTACGAGGATGGTACGATTTTCATAT
> TTATATATTGACTCCTGCCGATATGTAGAATATTTGAAGCTCGTGTTTAGATTAAGCTGG
> CGTTCGCTGAGAATTGTAGAAATTTTGGCTATTCAATCCTTTGTAATTGGAAAGACTCTA
> ACATAAACTAAGGCTAGTAAGGAAGTACTAAAAAAAACGGTGCATTATAGAAGTCCTGGC
> AAACGCTTCCTAGCTTATATTTGAAACGTTAAAACGCGTGGCATGATTGGTTCATAGGAA
> GTCTCGCTACCTACTGTGAATGTTAATAAAGCCTACGGCCAAAAAAGTCCCAAGCTGCAC
> CTTATTAATGAAATCGTTGCACAGAGTATCCCGTGTATTTTTCTCTAAGAACAAGTTAGC
> GTCTGATCATAAATCTACATTTTGAGTGCGATGGGAGGGTGTTGTGACACAGGAAATACA
> GCCGTTATAGGGACTGTACACGCGCTGTCGAGAACTCCTTTTTTGATAAGTTGGGGTCTT
> ATTGCTCAATCATGATTTTCTACCTTTTATAGAGCGTTATCAAAATTCTACCTTGAATAG
> TCTAAAGGACACTACTTCGCTCCCCTGCCGTTATAGGACACACTCTCACGCACCGTGGAC
> CTGAAATAAGCGTAACTATCAGGTCACAAAAAACACATCCTTACATTCTAGGCAGAAAAC
> AAATAACAGTCACAAAAAATTTGAATAAATAATATTCCTTGTTATGTTATTCCGTGCACT
> ACCACCAACTTTATCGACACAAGCCGCATTTGTACCGAGAGTTGTTTAGCTTTTTTCAGT
> AGTGTTCTCGTTGCGAACTACGCACACGGACGCGGAGTAGTTGCTTCAAGGATGGAGTTA
> TAGTTGACCTACGAGATTCTTCACCACCTTTATGTTTGTTAGGGACGGATGACGGTAGAC
> ATACATGCTTTTCATCTTGTTGCGATGTAACTAACCCTTTGTATTTACGTTCGGAGCCCG
> TTGATTTATGTAAACTATTTGCGTAGGTGCACTGGCAACTAATTTCCAGCTGTCCGCCCA
> GTATTATCAGAATTTACGCGCTATCAAGAACTATACCATGCTAGCTTGAGGTTTCGTTCA
> TTCCCGAAGACGGTCTAATAGTTAAGACTTATCAGGAACGTTATTTTTGGTGAGATGCTC
> CTCCTTAAGAATGCCCGATTAACGAGAAATATGGAGCCGTTTTTTTTATTATGCATCTCC
> ATATGTGTCATTTATTCGATTATAGGTTTGTACACAGCACAAGAACGTATTGAAATTTAA
> TGGAAGCGCAGTTAACTTATGAGTTAGTTTGATAGAGTACTCACAGACCAATATAGAGTG
> TCCGAACTGTATAAGTGATAAGTTGATAACTGCCCAGTATCGTGACAGTTTATTTCGATT
> CGCTTAATTTATTTGGATAGTAAACTATAACTAATATATTCGTCTTTATTAATTGTATGG
> GTAAGGCCGTCAGAATCTAATCAGAACATTTAGTATAAATCTACTATAAACAGAAATCCT
> ACGGATGTTCTAATTAAACCTATTACGTTCGAGATTTATGCGTTTGTAACTACAAGACTT
> TTGCGCGGCCTTTATAAATTTCAAACCGTAGAACACTGGCCAAATATTGAGCATAATGCT
> AGTTGAGTTTGTGGCTCAATCCAGTGCAAAATGCATCACACTATGTCATTAAGTTTTCGC
> CAAGCGGGATTCCGGCCCAAACCCGATTACAATTATTTTCATGCTTATTGTATTGCTGGG
> TTAATTTGATACGTATTTCTACCCTGTCACTAAATTTGGTTAACAAATAAGTTTCACCTG
> GTTAAGCTCCGGAGTATGACACGTAGTAATATTAGTTCTGTTTAGACCCTAAAGGCTAAA
> GATCCGGGTAGTCACGATGAGGCATCACTGGTGATAGATAAACTTTTTTAAAGTTTGGTT
> AAACGGACATTACATAATTAGACTGCGAAGTGCTACGTTATCAAGCATGGGTAATGCATG
> TTAGACCGAATTTAGATATATATGAAAACGACACTATCCTAACGTGTTTGATCTACAGCA
> GTTAATCCGCTTCCGGCGTAATAAAAGAAATTCGAGCTAGTTTGATAACCGTTTATGCCA
> TTATAGAGCACTTAGCTTAACTTCATGGTATGTGAACAAAATAGCATATGTAATTTGGGG
> AACAGCAGACTTCACAGTGTATCACCTAGGAGTTGTTAATTGTTATTTATCGAAGATAAA
> CATTAAATTCTTATTCAGACATACAGCGATAGCTAAACTTATCAGTAGAACCTCAAAATT
> TCAAATACTACTCTGGAACGCGTCCGTATAGATACAAGTACCTGAATGAACTGGTCATGA
> CAAATTGACTCCTTGTTAATCGGACATTATTCGTTGTACTAAAGTTGGAGAAGGTAGCCT
> AACATTGGACATTACAGGCCAGTTACCTCTATGAGAGCGATTTACCGCGCCACTAAGTGG
> GCGAGAATGATCGTTTATGGGACGGAACCACATTCCGTTATCCTCTGCACATGGTGGACG
> CTTCGAAGTACAAATGGCCCAACCACACAAGGGAGGGTGTTAGATTTTATTGCAATGTCC
> TCTGATAAGAACGTATGACTGCACTTGACAATAAGAATTCAAAGAAGATCGCCTTTCCTT
> AACATTTTCTATTCCGGGGCTGGTTATGGCTTTATTTCTTACAATCTCAATGATGCCCGC
> CTACTTGACAAACACATTTGTCGTAACTTTAGTTTTCTAGCCTTTTCAATTTTAAATTTA
> CCTTTTCTAAGAAAACAGCTAAAATTAATGAATAACCTTCATAGCGACATTTATGTCTTT
> TAAACGCAGGTGTGAGGGCGGTACTGTTATCACATTAGCGTGCGATGGACAAAAAGGGCC
> AGCAGTTGCAACCCAGTGAATGGGTGACATGTCTTATTTAAGTCAGTTACAATCAACTTC
> TTTAAAGGAGGACAATACACTGGACCTCAATATTAAGGCCGGAATACGCTGTAAAGGACC
> ATCTGTTCTATGTCAAATAACAGATGTTGGTTACGGCCTAAATTAATATCCGTTTCTGTG
> TTTTATAGCAATCAAAAGACATACAGTGTTATAGCTCATTTATCTCGGTCGCCTTCATCG
> AAAAATTGCAAAGGTATCTCTACCTGGATTCGTGTTTGAAGGACCCAACCCATGTTTCGA
> CATGCACTGTTTTGATAATGCACAGCAGCGAATCTTGTGGATTGAGTGGTAAATCTCCTA
> CGGGTCATTTCCATCAATACGTACTATTAAACAACTTTAATAGTCTATCTACCCTCTTCA
> CGGAGGTATGAGTGCCTTGAACTTACTATATGAAATTCATATTACGCAACGAAAAGGGAA
> GTAAGGTACAAAGCGCTTCCTAGCCGGCTGCAACGAGTGAGTATCTAGAGTCTTGTAAAT
> TTGACTATAGAATTTCTATGATGTAAATATCGATTAACCGCAAACCTTTAAAACCTACAT
> GTATGGTCCTTATAACGAACGTAGGGATGCCATGTTGGAGAAGGCGAAAATTAACTCGCC
> GAATCATTCCTTCTATATTTATGTTACAGACGCATTCATCGAAGTTAGGATGAATCATAT
> CTTGGTTGAAGAGCGCTTTGAGGCATGTGGCAGAACACATGCTTGTGCCTAAACTTCACT
> GGATATGAAAATTAACTTCAATGGTCTCTTTCGAACCGGATTACGGGCTACTCCGTGGAG
> GAAATAAAGGCTTTAATTCTTTAGCGCGAGCGTTGGAACCACTTGGTTTAAGATACACTT
> GAATATGGAGGCAGGCCGCACCCACTCGGGCCACTTATTTCTCTATGAGTGTAGCCAGAA
> CTCCCAACAAATGTGCTTTCATTTTTCTTGTAGCAAATAGATGTAGCTCAACCGGATCCC
> GGCCTCATAGCTCAAACAGCTCAGTCGAACAAGCAGTTACAAGTCGTGATTGGGAAGTTA
> TATAAAACATATGAGAGTTATTGACGACATAAAGATATATGGTTTAAATTACCAGGTTCG
> AGTTTTTCGACAAAAAATTCATGATGGAAGACTCGTGTATTTTTTATCTCATTAGACTAA
> AGTGCTTATGTAGCCCATGCATTGATTCTCTAGTATATTCTTCCGAGAAACCGGTAAAGT
> TGTAAGGGTAAGTCTTCACTACCAATCACATCATTTAGCTCCAAGACCTATTATTCTACA
> TACAATATAACGTTTTACTTCGTTGATCATTACGGTACATCAAATTTCAAACTACTAGGA
> TACGGCGATCAGTTTAGGTAGATAATGGTTCTTAGCGGAATATCTTTAATCAATTAAATG
> GTTAAAACCATGAAGCGGGTATGTATTGATCACTATTTTGTGATTTAGTATAGTTGACTA
> CTAGATGGTTTACATCGTTTAATGCAAGTATGACAACCCAATCCACGCGGTTGAATAAGC
> CCCCACCGTATCAAGAGGGAAGGGACCGTATAACGATTCTTCCAGCGCAAGTCACCACTG
> GCAAAACGAATTAGCTGATGAAGCTACTATTGTGACCGGATAACATCATGACGATCGCTA
> TCATCATATCTATAATGTTCTTAGAGTGTTGCTAATTATATGCTCTTTGGCTGCTGCCAT
> TACACCTGATTCATCTATCTTTTCAGGGTTCTTCAAAGTCATGACTTTTTTAATAACCAT
> AGGTGCGGCAGAAGCATATTCATAAAAAATAGTCGATTGTAGACGCAAGGGGACTTACCC
> AGCTATTATTCCTCCAATCCTAATGTTGGGATAATGTAGTTGAAAACCTAAACTATTGAG
> ACTTAGAATATGTAGCCAAAATGCTATGTTGATGCAAATTTGTTCTTGGAGGATGGTAAA
> TCCGCGGAGTTTTTGGTCTGTATCTGACCACAGAGAATTAACATCAGAAAAGAAGTAACT
> GATTTGTTCCGGACACCAAAAGGCTGTCTTTTCGAGTTGGATATTCGAGCAAGGGGGTTG
> AACGCAGCGGAAGTTTATGACTTGGCCAATTATCAGATTCCGTAGAACAACTATTGGTGT
> ATCATAGAAGTGGTAGCTTAGAGGAGGCATGATGAACAACTCTACCGCGAAGTTAACTAT
> GCGGTGTATTAAATTCAGGCCTGAATAACAAGAATTTAGACATATCCACTGTGCTTCTTT
> CCAAATTAGTTGCCGCCTAGTTTAAAATACTGAACAACTGCTTTAAACGTCACAAAGGGT
> GGGGTACGTAAGAGGGGCGTCAGACAACTGGTATCGGATTATCTGTATATACAATATCCT
> GAGACTGTTTGAAAACCATAATAACGTGTGGTTCAACAATATCAACTCAAAGTGATGGGA
> CCACTTTCTACGTCCGATCGGCCTTCAGGTTGTTCATCCTTATCTATTTTGACTAATAAT
> TATTGAATTGATTTGGAAACGTATCCTATGGATAAAGTTTTATTAAAGCAGATCATATAT
> GCTTCACATTCATTCAAAAGTTCAGTGAGATCTTATACGACTTCTATTTTTCTAAATCTT
> ATCGGATACACGCTCTCATAGACGACATGTGAGCTACAATTTGATTTCACAATGATAGAC
> ATGATCGCAAGCACTCCCTGTCGTCAGACTCTTCCTGTTTATATGATGGAAGATGTACCC
> AAACATTAATGCGTTAGACCATAGCTGCAATGATGTTCCCATACCAAGAATTCGAACATG
> TTTTACTGAATTGTTTCTTAGGTTCTTAATCCGTGCTATGGGATTGCAAGTATGATTTTT
> AGCACTAGGATAGGAAAGAAGTAACCTGCAAATGATCGAGTTGAGAATGCTATGTTAGAA
> TGTTCTCCGTGTATGTGGCTCGGACCTGACTGGTGTATGGCACTCGAGGAACCCTTAGAG
> GCGTAAGGTTACTCATTGTTAAAAGTCCCATTTAATCTACTTTTAAGAAATTCTTTGAAT
> AGGATGGCACCATCGGCAGACAGGAAAAATGTAGGAATGCATTAGATAGATCCGTTCTTT
> GGGAATTCCGACTAGAAACTTCCAACATGTTTATAACTTGCTGAGATGTGCGTCGTAAAT
> AGCTTTAAAGGAAGTTTGTTTCTTGCAGAGGAACAGGACAGAACTTCAAGTCCAGAGAAT
> TATAGCTTACGATTCACTTTCGCATGTGCTACGCCGGCCAACTCTTATCTATCTTTTTTT
> TAGACAATCAACATTTAAACTTTAGTTTGCCTATAGTGAGTGGGTGTAAGATATAGCCTC
> CAGGAAGACATAACTCCTGGGGAGGCAGCATTTGTGTTATTGCGGATGTCCTATATTACT
> GCCTTGAGAAAGTTCGTTTAGGTACGGTATCCAATAATCGTTTCGGTGATGTTAGAGTAA
> AATCCTAAGTTCCCAAGATGTCTCAATTAAACCCTCTTACTGCTGTGGAATTTATTTGTA
> TGTATCAGAGGCTGAAGAATGGTGCAGCAAACTGATTATATAGAGCGCGTTACTGCCTCC
> AAACTTAAGAGAGAGTTATAATTATAGAGAGTATTAGGGATTGAAAAGTCCTATCACGCT
> GTCCTGAGTATTCCTATCGATGATGTTGGCGCGAACTCTACTAGCATCTAATATAGCTCA
> TCCTATCTTATTGGCGATTTTGATAAAAGACATGTATATGAATGTGAAATTGATAAAGTA
> GGAACGAAATCACAATACGCTGCCAATACTTTCCGCTATCCTAAAGATCCATGGAGGCAG
> GTAATGATGCGCGTGCGTACCTCGTTAAAGATAGTGTTATGATTGATCTTCTTTCTCTGA
> AGAAAGGGTATGCTTTCTCACCAAGATTGGCGAAATTGATACTCCGAAGATTGAATACTA
> ACACCCTGTCTATTTTCACCGCGTCTCATGTGTTTGTAGGGATTCTTCTACGTTGGTTAG
> GGATCTTGCGTACTTCTGCAAATGATTTGACAATAAGGCCATCTTAAGGATGCTGTCTCG
> AGAGCGTTACCCTTTAATGAAAGTACTCAACGGTTGCGCTGTGTAGGGTCATCTCTCTCA
> ATGTACGTTTTCCTGTATATTAATCTATTGTTCACATGCTAGCATATAACTCGTAAGCAT
> GTAGGAGTCTGAAGAAGCTGTAATAAGCCTGTAAAGAAATCTTACAAAATGAACTATGGA
> TACTCTTGGGCCCCTCGATTATTTCAATAAAACGCGAAAATCCGTCTAATGTTGCGTAGC
> CTCAAGACAAATTGTGAAGTATCTCTAGCTGGAAGATTGTGATTGACAAAATTGCCCTCA
> CTGAATATTTTCTTGTAGTCTTTAAAGGTTTACCGGTTTAATCAATGTGAGTTTGAAACA
> GATAAAGTACTTTCAGCTATACATTGCATATCCTATGCATCAAAAACTAAAGTGCTCGAA
> CCAATATGGCCGATACTCACTCATCTAAGAATCCCATCTGCAAACAGACGACTAGACAAT
> TAACCTGAAGTTGGCGTTATCTATAGTTTAGTTCGGACTAGAGGTCGGTATATTCTATTA
> AGGAATCTAATCTAGCTGACGTCCTGACTCGAGCTCAAATGCGACGGTATACCTACATGT
> CGAAATACACTGCGGTATCGGGGCATGTATTGGATACGCCTAAAGACGACATAAGCGATT
> GATTATTATCCGATCACGTTTCTGTGCACCGAGCATGGAACTGTATATACAGCTATAATC
> TTCTTGACCTGAAACCTGTGAAATTATGGTAAAGTACAGCCGATAACAAACTGATTATCT
> AAGAATCTACATCACCAGGCGTCTTAAAGTAAAATTACAAGGCGTTGAATATACGAAAGT
> TGATGAAGTTCGCTGGGCTCGTCGCAAACACACAACTAGATGTCGCAACCTTGATGAGCT
> ACGTTGGCGGTAATAAGTTCACCGTAAGTGCATTGAGAAAGACTTGTGTTTCATCGGTTA
> TCATCTGGACTACTCTGGGGTATTCAACATGATTACGGAGAAAGCGGATTTATTGGTAAA
> CGATGTCTAGAGGATTACGGGCCTTATAATTGGTTATCCATGGGAGTTCTGTCGCTGTCG
> CTTCGTTAAAGATACGGACTACATGTCCTCGCGTGAGCTCGTGGTTGAGCCTGTTAATGG
> GATCCCGACAATACTAGTGCCATTTGAGGATGTGACTGAAAAAAAATAGGCATCACGACG
> GATTTGCCCTATTAGAAGAATTTCCTATAAGTTCAATACTGTCCATAGCATTGATGCTAG
> GGGATGAAACTGTATACTAGCCGTCATAAGTATGCGGCTTTTGTATAAAAAACTATTCAA
> TCTTTTGAATAGACAAAAGTAACAATCGGTTGTATCATGCTATAAGTCAGCACATTTTAC
> GCCTTGAGAATGTTCAAAGCAATAGACGACTCGTTCTCCCGAAGATAGATATCATTATAT
> TTAGTACTATTCCCCGGTGTTACCTTGTATTTACTACTAATAGTGAAAGTACGACGTAAA
> CCACTTCGTCCGGTTAATATTTGTCCTGAGTACCATCTCGTCCTCACTCCCTGCCTACAC
> GACGGTAATCACTTGAATAATAGATTTACTACCCATGATTCTGCCTCTTTGGTAATCTTA
> TTATAAGACTAATCATCTTTTATACAGCGGTTGAGAATGACCCAATGCTTCCGTGGTGTA
> GTCTGTATTTCTAATATGTAAGAGCGGCAGTCATTCCGAGTTTATACGTGTGCGTGTTAG
> GCGAGATGAGTCGCTAATAGTATATCTGAGCACGACAGCCGTATTTCACGCATGACGGAT
> GAGAACGTTTAACTAATAACGGTATATTGCGACGTATCAAGAAAATTTACTCAGGACATG
> TTATGATCTATCGTTTAGCACACGCAGAGTGATTTAAGAGTGCTCCAGTCCATAATGACA
> CATGCTCCACAGCGCTCTCCTACGTATTGGGCGTCCTGAGCTCTGGTTTACTAAACAAAG
> ACTATTCCGTTGTTGAGTAGTAGAAGAAACCCCATCCGAAATTGCGCTAGGAAGGCTCGA
> TATACCAGCCTATAAGTTTTATATCGGTTACGTATAAAGGTCGACCATATAGGTCCGGAG
> TGGAGTTTTCAATCAGCCGTATTAGTTAGTGAATCCAACTTATCGATTCTGAAATTTTCG
> TTGCTCAACTTATGAAAGAAAGTCAGTCCGAAGCCTTAAACACGGAGTACGTGTCATGTA
> TCAAGAGCAGGAATTAACAATAGAACACCTTCAAACTCACAGTACATATTAAATGTTGGG
> GGCCCTATGAGTCTAATTCTTGGACTCCAACGTTATGAGTGTTCTTCTGCTGTATATCCT
> CAGAGATTGCGTATTTAGACTTCAAAGCAAGATGGGAGGGACTAAGCTAGTGTAACTGGA
> GACTCATTTGTAAAGTTACTTCCTTTGTGTCTTTATCATTATTGTAATTACATAGGCTGG
> TACGTACCCTTGTGAGTTAGGAAAACACATAGGGAATGATAGTAAAGCTAGTACCGAGTC
> TTGATCCTTATTACGGGTTAGAGTAATCCTTAGTAGACAACTAAAATCTCAACTGCAGTA
> AATTTAATACGGAAGACACTAGTGCTCACTTTCGGGTGTGGGTGCTAGGATCGCCTAGAT
> CAGGGTGCGAATAAGTGTAGGGTCGCTATGTATATATTTGAGTCTCATTTCTTTTTGTAA
> ATATCGTCGGGATTTATAGCTACTATACATACGTCTAGTTAGCAAAGTGTTCGTATGCTT
> TAGCTGAACATATGTCCCCTGGTTTAGATAAACCGCACATGCGAACGGATCCGAATTCCC
> GTAGAGGAATCAAACATAGATTCTTAAAAGCAATTATGTCGTGAGGGGGTGTAGAGAAGA
> CTGCTAAGCTTCTGATCTAAAATATAGAGTCCGTAAAGTATGCACCATATGTCTCTCACC
> CCGTCAAATTGATGACTTCAAGCAAATAGTACGTAGGTCAACCAATCTTTCCATTCAATA
> GTTCAGCAGAATAGAACCAGAAGGACCTTTTTTCTATTTATAACGTCTCGTTTCGAAATA
> CACTGTCACATACTTAGTGGGATGCTCTGCCTTCCTAAACTTCATCATGCGTTAGACTCC
> TATCCATTGGAACATCTCAAACGGCTAAAGATTAATGTAGCGTTCAACAGGACACCCTAA
> GGTAGTATGACGATAATAGATAAGCATCACATGTAGGTAGCTTATTTTATCCAGGTATGG
> CACAATCGGCAATTGCCTAGATAATACAATCTGAAGTAGGAACCCCGATCTATTTCCCAC
> TGAGTAGTGTACTCTCGATGCAACCATAAGAAGGAGGCTGAACATCAACTTTACTTTATC
> GTTTTATAGAAGTCGAGATGGACTGGTTAACGGATCAATTTTCGCGGCTGAAATTCGTTA
> ACGCAACCACAACCGGTAAAACAAATCTATACATGGCGCGCTACCAGTAACTAGTTTTAT
> AGTTACAGTCGTAATATCCGGGCCCTTTTTTTCTACGCTGCTTTCCTAGGCCGTAATGAT
> CTCAGTCATAGTGGATTATGTAAAGCTACACTTACATATAGTGGACAAATAGTGGCACTA
> TGAGGCATTCTCTGTTTTCACTTACCTAGTTCAAGTTTACTGTTGTCGAAATAGTAGATC
> AAGTTTTTCGGGGAATGGTAAAAGCAACTAGACTACCAACATAAACTAGTATCGATTTAC
> AATGTTTGCACAACTGTGATATCTCTACCCCGAACAAGTCTATAATATGTAATCGTTTAA
> GATGGAAGGATTTACGAGCTTCAGGCGATAGACGACCCCAAGATTGGGATTGTTGTCCAA
> AATTAGAGTGAGTATCTAACAGCTATCTGTAATTCGACTAGTAACCGGGTAATGCAAAGC
> GATTGTCGATTTTGTACATTGGAGATCGTTAATATGGGACTTAACCTATAGCCCAATCAC
> AAGGCTTATTGTAAAGAGCACGTAGTCCGCACTTAATTGTTTTGCACTAAAATAAACCTA
> TTATTCCTTGCTTCGTTTAAATCGTCACTTGGAGCATAGTGACGTATAGCCGTTCTGAGC
> AGTATAGAAGATAGTGCATGCAGGTGAGACATTAAATAGCAGATTTTCAAAGGGTTATGT
> GTTCGAAAACTGAAAATTATATTAGACCTACAGTTATGAGACAGACGATAGGGTTAGCAC
> GAGGCGGTTGAATCGCATCCCTTGCATGGTTCACTTACGCATAGATTAACTGCAAAAAAT
> CTAATTGAAAGTCTCTAAGGCGGTAGAGGAGCATTTTCAAAGTACAGAATATAACTCTGG
> TAAAAAGTTTGTTCATTATACTTACGTAGATCCTTATTAAAAACCTGTGCAATTACAAAT
> ATCAATGAACCTGTTGAACATATGTTTTTAATTATGGCTTATAAACAATTGTCTTAATAA
> GCGAAGTTGCTAGTAAACACGTACGCACTCACCCTTTAATTTTTACTTATATGTTTAAAG
> ATGGGTTTGCTCTAGCGTCTGTAAATCAAATCGTGGTTACGACGGTAGACTCGTGCTTGG
> GAATTGGATAAGCTATGCAGCTCTATATTTCAAGCTTTAATTTAATACCACGAGGTAGTA
> GGATAGGTATCTGCTATTGGAAAATGGAGGGATTTATCCGTACAAGGTTCGGCTAAAACT
> ACCACGAGGGTTCGATTTTCATATGGAGTGTTTGTATAAGCCACATTTGTTGTATTTGTC
> AACATCCTGGGGACTTTATGCTCCCCGTAGCTGAGAATTCTTCTAAGTTTGCAGATGAAA
> GAATTTCTATGGGGTAAGACTCTAACAGTATATAACGAGAGTATGCAAGGACTTATAAAA
> AACCTGATTTATTCAAGTACTGGCATAACATTCATAGATTATATTTGATTAGTTTAAACG
> CGTGCCATGAGTGGTGCTGTGGAACGCGAGATACATAAGGGCTAGCTGAATATTGCATTA
> GGCCTAAAAAGGCAAAACCGGCTAATTATTATTCTAAGAGTTGCACTGACTAGAACCTCT
> TTGGTTATATATCTAATACTTAGCGTAGGATCATAAATCTACTTGGGGAGTGAGTGCGCT
> CGGTGGTGTCACTATCGTAATACACCCCTTAGTGGCTCTGTACTCGCGATCTCCTGAAAG
> CCTTGTGTCATTACTTCGCGTATGAGTCATAAAGCTTGATGTTATACAGTTGATACTCCG
> GTATCAAATTTATACCTTGTTTACTAGTAACCAAACGTATTAGATCCCATCCCGTTATAG
> GACTCAATAGAAACCACAGGCGACCGCATATTAGCGTAACTAGAAGGTCAAAAAAAACAA
> ATCATTAATTTCGAGCCTGAAAAAAAATAAAAGGCAAAATTAATTTCAAGTAAGATTATG
> ACTTCTTATGTTTGTACGGGCACTTAAAACAACGGTAGCGTCACATGCACCATTGGTACC
> CACTGTGGTTTACATTGTTTATCTACTGGTCTCGTTCAGAAATAACAACAAGGAACCGGA
> GTAGGTCAGGAAAGGATGCAGTTATAGTTCACAGTCGACATTATTAAAAACCTTTATGTT
> TCTTAGGGAAGGATGACGGTTCACTTACATGCTTTGCTTATGGTTCCGATGTTACTTAAC
> ATTTCTTTTTAAGGGAGGACCACCTTCTTTTATCGAATCTAGTGGAGTAGGTGCAATGGA
> AAATAATTGAATCCTCTCCGCAAACTATTATCACATTTTACGAGAGAGCAAGTTCTTTAC
> AATGCGAGCTTGAGCTTTCGTGAATTACAGTACTCGGTCTAATAGTGTTGTAGTTTAAGG
> TACGTTATTGTGCGGGTGATGCTCCTAAGTAAGAATGCACGATGATCGTGTTATAGCGAG
> CAGTTTTTTTTATTATGCATCTACTTATCTGTAATTTTGTCGATTTTACGTTTCTTCAAA
> GCAAATGATCGTTTGCAAATTTAATGGAACAGCAGTGAAATTATGAGGGTGGTTCATTGA
> GTAATAAAACAACATTTGAGACTCTCCCAACTGTATTACTGAGATGTGGAGTACTGCCAA
> GTTTCGTCAAACTTTTGGGCGATTCGAGGTATGTTGTGGGTTTCTAATCGTGTAATAATA
> TATTCCTCTTTATGATTTGGAGCCCTATCGCCCTCAGAAGCTAATATCATCTTTTAGTTT
> AAATATAATATAAACTCAATTCCTACGCTTGTTCTTAGTAAACCTTTTACGTTACAGATT
> GATGCGTGTGTATCGACAAGTCTGGTGCCACCAAGTTTTAAAGTTATAACAGTAGATAAA
> TGGCAAAATATTCAGCTTAAGGCTAGTGCTCTTGGTCCCTAAATACTGGCCAAAAGCCAG
> CTAAAGTTCTCATGAAGTTTGACACTACCGGCATTACGGCCCTTAAACCAGGACAATGAT
> TTGATTGCGTTTTCTAGTGCGCCGTGATTTTGAGACGTATTTAGAACATGTCAATAAATG
> TCGTGAACAAAGTACGTTCACCTGGTTATGCTCCCGACTATCAATAGTTCGATTATGTGT
> GCGGTTGTCAACATTTAGCCTTAACATACGCGTAGTCACCATCAGGCATATCTGCTCATA
> GATTAAATTTTTGAATCTTTGCGTTTTCGGACATTTAAGATTGAGAATCCGAAGTCCTAA
> GTTTGCAAGAATCGCTAAGGCTTCTTTGTCACATTGTACATATATAGCAAAACGACACTA
> TCATATAGTGTTGCATCGACAGCAGTTATTACGATGCACCCGTTAGTATAGTAATTAGAC
> CTACTTTGATAACCGTTTAGGCCATTTTAGAGCACTTAGCTTAACTTCTGGGGATCTGTA
> CTAAATTGAATATGTTTTTGGCCGAACTGCTGACTTCACTGTCGATAACATACGAGGGCG
> TTATTCTTATTGTTCCATCATAAACATGAATGGCGGATTCACACAGAAACCCTTTGCTAA
> AATTTTCTGGAGTACCTAAATAGTTCAAAGACTACTAGGGAAAGACTACGTTGAGAGACA
> TGTAACTCATTGTAATCGTCTTGTAAAATGGAATCCTTCTTTTGCCCACATTTTTACTTC
> TAATAAAGTTCGAGTACCTAGCCGAAAATTCGTCATTACAGGCAAGTGACCTCTATGTGT
> GAGATTGTACGACCATCTAACTCGCCGAGATTCATAGTTGATCGCACCGTACAAAAGGCC
> CGTATACTATCCACTTCGTCGACGCGTACAACTTCAAATCGACATTACAATCAAGGGTGG
> GGGTTACTGTGTATTGCATTGGAATCTGATTTCATCCTATGTCGGCAATTGACAAGAAGA
> ATGAAATCAAGATACCCGTGACTGATAAGTTTCTATTCCGCGCATCCTTTTGCCTTTTTT
> TCTTACTTGCGCAATCATGACCGCATTATTCACAAAATCATTTCTCGTTACTTTACTTTT
> CTAGAAGTTTCAATTTTAAATTTACCGTTTCTATCATAACAGCGAAAAGTAATCTATTAC
> CTTCATAGCGAAATTTTTGTATTTGAAAAGCAGGGGTCACCGCCCTACTCGGATCAAATG
> AGAGTGCGATCGTCAAAAAGCCCCACAAGTTGAAAACCAGGGTATGCCGGTAATGTCTTA
> TGTAAGGAAGGTAATATCATATTATTTAAAGCAGCTAAATACAATGCAACTATAGTGTAT
> GCCCCGAATTCGATGTATACCACCATCTCGTATATGTATAATAACTCATGTGCCTTTCGG
> CCTAAAGTAATTTACGTTTCTCTGTGTTTTTCCATGAAATACACATTCACTGTTTTAGAT
> CTTTTAGAGAGGTACAATTCTTAGATTAATGCAAAAGCGAGCTCTACCTGGAGTCCTCTG
> TGAAGGTCCCAAAACATCGGTCCACAGGATCTCGGTTGATAATCCAAAGAAGACAATCTT
> CTGGATTCACGGCGATATATACGACCGGTATTGTAAAGCAAGTAGTTCGTTTAAACAACT
> TTTATACTCTTGCTAACCGATGCACGCAGGTAGGACTCACTGCAACTTAATTTTTGAAAG
> TCATATTAAGATACCAAAACGGAAGTAAGCGTAATAGCCCTTCCGAGCACGAGGAATACA
> CGGTCTTGAGACAGTATTGTTAATTTGACTTTACAATTTCGATGATCTTAATATCCAGTT
> AACCCAATCATTTTAATACTACATGTATGGGCATTATAACGATACGTGCCAGGACATGTT
> GGAGAACCAGATATTTTACTCGAAGATGCATGACTTATATATTTATGTTAATGTAGAATT
> AATACATGTGAGCATCAATCTTAGAGTGCGTCTACAGAGCTTGGAGGAAGGTGGCAGAAA
> AAAGGCTGGGCCCGAAACTTCTATGCAGATCAAAATGAACTTCAATGGGAGATTGAGTAA
> CCGATTAAGGCATAAGCAGGGCTGGAAATATTGGCGTGTATTATTGTGCGACAGAGTGGG
> AAACTCTTCGGTTAAGATTCAATTCAATATCGTCCCACCACGAAAAAACTAGGGAAACTT
> ATTTATATATCAGTCTTGACTCAACTAAAAACAATTCTGAGTGCTTTTTGCTTGTTGAAT
> ATACATGGACCGCTACAGGATAAACGAATCTTAGCTAATAAACATAACTCCTACAAGATG
> GTTCAAGTCCTCATGCGGTAGGTAGATAATAAATTTCAGAGGTAGTCTCGACATAAAGTG
> ATTTGCGGGTAATTAAAAGGTTCCAGGTTTGACACAATAAATTAAGGATGCAACTATCGT
> GTTTTTTGTATCTAATTAGACTAAAGGCCTTATCTAGAAAATGCATGGTTTATCTAGTTT
> ATTCTTAAGACAATCCGGTAATGGGGGATCGCGAAGTCTTATAGACAAATCTAATCAGTG
> TGAGCCTTGTAATATTATTATAAATTAAATAGTTAGTTTTTATTCCTTGAGCAGTAACCT
> AAATAAAATTTAAAACTACGACGATACCCCGAGCTGTTTAGGGTCATTATGCTGCTTACC
> GGTATTTCTTGAAGAAATGTTATCGGTAAATAAAGGTACCGCGTATGGTGTCTTCACGAT
> GTTCTGATGTAGTTTAGTTGAAGTCTACTTGGTTTAAATACTTTTAGGAAACGATCTCAA
> CCCTATAATCCCCGGGCAATATCCCCACAAAGTAGCTACAGGGAAGCGACCGGATAAAGA
> TTCTGAATCACCATCGAACAAAGCCCAAAAAGAATTAGATCATGAACAGACTATTGTGAC
> AGGAGTACTGCAGCACGATCGCGATCAGAATAGCTAGTTGGGGATTAGTGTCTTGCTAAT
> GTTTGGATCTGTGGATGATCCATTTTCAAATGAGTCTTCTATCTTTTCACCGTTATTCAA
> AGTCTTGAAGTTTTTATTTACAATAGGTCACCAAGATCAATATTAATAAAAATTAGGAGA
> TTGGAGACGCAACCGGACTTAAACACCGATTATTCATCCAATCCTAATCTGCCGATATTG
> TAGTGGAATACCGAATCTAGTGAGAATTAGAATAGGTAGCCAAATTGCTATCTTGATCCA
> ATGTTGTTATGCCACGATCGTATATAACCGCTGTTTTTCCTCTGTATAGGACCACAGTGT
> ATTAACTTCTGAAAAGAAGGAACTCATGGGTTACCGACAAATAATGGCTCTAGGTTCGAC
> TTCCATTTTAGAGAATGCGCCGGGAAACCAGCGGTTGTTTTTGAATTGGCAAATTATCAG
> ATGAACTAGAAAAAATTTTCGTCTAGAATACTAGGGGTTGCTTTCACGTGCCATGATCAA
> CAACTCGAACGCGAACTTAAATAGGAGCGGTATGAAATTCACGACTGAAGATCTACTATG
> GAGACAGATCCACTGTCCTTCGTTACATATTAGTTGAAGCATACTGTAAAATAATGAACA
> TCTCAGTTAAACCGAACAAAGCCTGCCCTTAGTAAGACGGCCCTCTGAAATCGGGTATCC
> GATGTGCGGTATTTAATTTAGCAGGTGAATGTTTCTATTCAATAATAACCGGGCCGTCAA
> CTTGATATACTCAAAGTGATCGGAACAAGTTCTTACTACGATCCCCATGCACGTTGTTAA
> TCCGTAGATAGTTGGAATAAGAATTTTTGATGTGATTGGGAAACGGATCCGAGGCTTAAA
> GGGTTATTTTAGAAGTTAATATATCAGTCAAATTATTGAAAAACTTCACTCTGAGCTGAT
> ACGAATGCGAGTGTTATTAATCTTATCGGTTAATAGATCTCAGTCACGAAATGGGACCGA
> CTAGTTCAGTTAAAAAGGATACAATTGAGAGAATGCACGCCAGCTACTCAGTATATGCAT
> CTTTTTAGGATGCTAGATCTAACAAAACATTTATGAGTTTCACCTTAGCTCCTATGATCG
> GCCCATACCTAGAATTAGAAAATGTTTGACGGTTTTGTGTATTAGGTTCTGAATAACTGC
> TATGCGAGTGCTACTTTGATTTTTACCACTAGGAGACGTAAGAACTAAACTGCATAGCAT
> CCAGTTCACATTGATATGGGAGATTCGTATCCGTGGAGGGCGCTCGCAAATGTCTCGTCT
> ATCCCAATCGACGATAACTTAGAGCCCTAACCTTTCTCATTCTGTTAACGACCTTTGAAT
> ATACTGGTAAGTAAGGATTGGTAGTGCAGCGAAAAAGCGGCACAAAGCAAAAATGTTCCA
> AGGCATGTGTGAGATCCCTTATGTCCCAATGCACACGTGATACTTAAATAATCTGTATAA
> CTTGATCTGATGTCCGTCGTAAATTGCGTTATACGATGTGTCTTGATGGAACACCAACAG
> GACACTACGGCAACTACAGTGATGTATTCCTGACCAGTCAATGTACCAGGTCATTACACG
> GCAAAATCTTTTCGAGCGTTTTGTTTGACATTAAAATTGGTTACGTGAGTTTGCCTAGAG
> GGAGTCCGTGTTTCTTAGAGACGCCACCATGTCATATCTCCTGGCCACCCACCATTTGTG
> TTTGTCCCGATGTCATATATTTCTCCATTGTGAAAGGGCCGTTAGGTTAGGTATCAAATA
> ATAGGTGCCCTGAGGTTAGACGAAAATACTATCGGCAAATGATCGAGCATTGAAAAACTC
> TGTCTCCTGTGCTATTTATTGGGATCTATAAGTGGCTGTACAATGGTCATCCAAAAGGTT
> TATAGAGAGCGACTTACTGACTACAAACTTATCTCAGAGTGTTTTGTAGAGTCAGTAGTA
> CGCAGGCTAAAGTAATTGCACGCTCGAATCAGTATTCATATAGATGATGGTCCAGAGTTC
> TCTACTAGCATATATTATAGCTCATACTATCTTTTTGCCGATTTTGATTAAAGAAATCTA
> TATGAAGCTCAAAGGCATTAAGTAGCTTCGTTAGCAAATTACGCGGCCAATACTGTCACA
> TATCAGAAACATACATGGACCATCGTTATCTTCCCCCTGACTACATAGTTAAAGATACTG
> GTATCATTCAGCTTATTTCTATCATGAATGGCTATCATTTCTAACCAAGTTTGGCGAAAT
> GGTTACGAAGAACAGGCAATAATTTCACCCTGTATATTGTAACAGCGTATCTTCTCTGGG
> TACGCTTTCTGCGAAGTGGGTTACGGTTCTTCAGTACTGATCCATTTGAGTTCACATTAT
> CGCAATCTTAAGCTTGATGTCGAGTGAGCCGTACAATTTAATGAAAGTAATCAAAGGTTG
> CGCTGTGGTCGGTATTCTCTATCAATGTTCGGTGGCCTGTTTTTTAAGCTATTCGGCTCA
> TGCGACCTTATATCGAGTTACCTGCTACCACTCGGAAGTAGCGCTTATAAGACTGTAATG
> ATTGCTTAATTAATGAAAGAGCGATTCTCGGGCCACAATCCATGTTGTCATTATAACCAG
> AAATGCCGTAGAATCGTCCCGACCCTATAGACTAATTGGGATGTATCGCGAGCTCCAAGT
> TGCGCATTGACAAAATTCAAATAAAGCTATAGGGTCTTGTTGTCTTTAATGGTTGTAACC
> GTTTATAATTCGCACTGTGAAACAGATTTAGTACTGGCACCTTTACATGGCAGATACTAT
> GATTAATATACTAAAGTCAGACATCCAATAGGCAAGATAATATCGAATATAAGAATAACT
> GCTGAATACAGAACTATAGTATATTAACCTGAAGTTCGAGTTTTAGAGTCTTTTGTTCCG
> ACTAGACGTCCGTTGATGCTTGTAAGGTAGATAATATTGCTCTCGTCATGTCTACTGATC
> TTAGCACACGGTATAACTACAGCTCCAAATACACTGAGGTATAGCGCAATGGATGGGATA
> CGACGAATCAAGACTGAAGAGAGGCTTGATTATAAGTTAACCTTTCTGGCAAACCACATT
> CCAACTGGATATACAGCGATTATCGTCTGGTCATGTTAAATCTGAAATTATCGTTAACTA
> AACCAGTGTACAAAATGATGATATAACTTTAGTCAGCTCCACCAGTCTGAAACTAAAAGG
> TAATGGACTTGAATATACGATAGTTCTTGAAGTTCCCGCGCCTCGTCGAATACAAACAAC
> GAGATCGCCAAAACTTGTTGACATACGTTGCCGGTTTTATCTGCAACGTATCTCCTGGCA
> CAATGAATTCGCTTGCATCGCTGATAAGCTCGACTACTCTCCGGTATTAATCATGTTTAC
> CGTGAAACCGCATTGAGTCCGAAAAGATCTAGTCTGGATTACCCGCATTATTATTGCTTA
> TACTTCGGAGTGCTGTACATGTCGCGTCGTTTATGATACGGACGACAGGTACGCGAGGGA
> GCTCCTCGTTGACAATCTTTTGGGCATCAAGACAAGACGTCGGCAATTGGAGGATCTCAA
> TCATATATAATACCCATCACGTAGCAGTTCAACTATTACAAGAATTTCATTTATCGTCTA
> TTATCTCATTACATGTGAGGATTGGCCTTCAATCTGGTTAATTCCCCTAATAAGTAGGCG
> CATTTTGTATTTAAAAATATTCAATCTTTTCATTTGTCAATACTTACAAGAGCTTGTTTC
> ATGATATAAGTCTGAACATTTGTCGCCGTCACAATCTGCATAGCATTAGAACTATACTTC
> GACCGAAGATTCAGTGCATTATAGGTACTACTAGTAACCGCTCTTACCTTGTTTTGTCGA
> CTAATTGGCTTACTAAGACCGAAAAATCTGCGTCCGGTTAAGAGTTCTAATGTCTACCTT
> ATACTACTCTATCACTGACTAAAAGACCCTTATCAATTCAATTATACATTTAATACAAAT
> CATTATGCATCTTTGCTAATATTAGTATAAGAATAATCATATTTGTTACACACCTGGTCA
> ATCACCCAATGCTTCCCTGGTGGAGGCGCGATGTCTAAGATGTATGACCCCCTCTCTTGC
> ACAGGTTTTACGGGGGCGTGGTTCCCCAGAGGTCTAGCTAATAGTAGATAGGACCAAGTC
> ACCAGTATTTAACGAAGGAAGGAGCACAACCTTTAAATATGAACGGTTTAGTGCGAAGTA
> TCAACAATATGTACTATCGAATTGGGTTGTGCTATCGTTTTGCACACCCACAGTGATTTA
> AGAGTCATCATGTCAAGAAGCAATAATGATACACAGAGATCTCCTTCGTAGTGCCCGGCA
> GCAGATCTGCTTTTAGAAAAAAAGAATATTCACTTGGTCAGTACTACAACAAACCCAATC
> ACAAATTCACCGAGGATCCCTACATATTCCAGCCTATTAGGTTTTGAGACGTGAACTTGA
> AACCTCGAAAAGTTAGGTCCGCAGTGCTGTGTTAATTCAGCACTATGAGGTAGGCATTCC
> ATATGAGCCATTATCAATTTTTCGTTGATCAACGTATCTTTCAAAGGCACTAAGTTCCCT
> GAATATCCGAGGAAGTGTAAGCTTGCTTGAGCTCGATTGATCATTACAAATACTTAATAC
> TCAAAGGACATATGATTTCGTGGCCGAACTATCAGGCGTATTCTGCGACGCAAACGGGTG
> CTGTGGTCGGCTCATCTAGTTACTCTCACATTCCGTTGGTTCAATTCTATGCAACATGCG
> TCGGAATAAGCTAGGCGATCTGGTCTATCATTTGTAAACGTACGTCCTTGGGGGCTGTTT
> CATTATTCTTAGTAAATTCCAGGGTACCGAAACGGGGGACTGACCTTATATAAGACGGAA
> GGATACTAAAGAGACGTAAGAGTCTGGTGACTTTTTTCGGGGTAGAGTAAGCATTTGTAG
> AAAACTAATTGATCATCTGAAGTAAATGTATGTCCGAACTAACTACTGAGCTCTGGCGCG
> TCTCGCGCAGAGCATCCCATTGATAAGCGGCCGAATTAGTGGTGCCTCGCTATGTTTATT
> TTTGACTAGCATGTCTGTTTCTTAATTGCGTCCCCTTGTAGAGCGACTTTTAATACCTAG
> AGTGACATAAGTGTGCGGTGGCTGTTGATGAAAATATGGAAACTCGTGTACAGATACACC
> ACTTGAGAAACGAGCCGAATTCACCTACACCTTGCAATAAGTGAGTCTTAAAAGAAATTT
> TGGAGGGTGGCGGTCTTCAGATGAAGCATAACATTCGGATCTAATATAGTGACTAAGGTA
> ACTAGCCAACTTATCGCTCGAACCAACTAATATTGAGGACTTAAACCAAAGAGGAACTAG
> CTCAACAAAGCTGTAAATTATATAGTTAACCAGTAGAGAACCACAACGACCTTTTGGCGA
> GTTTTAAAGGAGCGTGTCCTATTACAATGTAAAATACTTAGGGGCTGCATAGCACGTCAG
> ATAAGGCATCTTGAGTTAGAATCAGAGAATTGGCTAAATCTCAAAACGATAAACATTAAT
> GTTCCGTTAATCAGCACTAACTAAGGTAGGATCACCAGAAGACATAAGCATCACATCGAG
> CGACCTTATGGTATACAGGTATCGATAATTCCCAATTTGCCTTGAGAATAAATTAGCAAG
> TTGCAAACCCGATCTTGGGACCTCTGAGTTGTGTTCTATCGAGGATAACTTAACTAGCTC
> GCTGAACAGATACTTTAAGTTATCCTTGTATACAACTACACATGGAAGCCGTTAACCTTA
> AATTGGAGCCGCTCTAATGACGTAACGCTTCATAAACCGGTAAAACAAATCGTGAAAGGG
> CGACAGACCAGTATATACTTTTATAGTTAAACTACTATTATAAGGGAACTTTGGTTCGAA
> GCTGCTTTCCGAGGCCCTTATGATATAACTCATACGGCTTTATCTAAACCTACACTTACA
> GTGACTGGAAAAATTGGCGATCGATCTCGCAGGATCGCTGGGCACTTACCTTGGTCAACT
> TTACTGGTCTACAATTACGACATAAAGTTTGGACGGCAATCGGAAAACAATCTACACTTA
> CAACATAAACTAGTATACATTTACTATGGGTCAACAAATCTGTTATCGATTCCACGAACA
> ACGATATAATATGGAAGACTTTAAGAGGGTTGGATTTACGACCTTATGGCCATTCACCTC
> CCAAAGATTCCCATTCGGCTAAAAAAGTACACTGAGGTTCTATCTCCTATCTCTAAGTCG
> AATAGTAAAAGGGTAATCAATAGACATTCTACATTTGGTTCATTGGAGATCGTTATTATC
> CGTCGGTAACGATAGCACATTCTCAAGCATGATTCGTAACACATCGGAGTCACCTATGAA
> GGGTTTGCCTAGAAAATAAACCTATTTTTCCTTGCGTCGTGTAATTAGTATAGGGCAGAT
> GACTGAAGGATACACCGGATCAGCTGTATACTTCTTACTCCTTCCAGGGCAGTCTTTTTA
> GACCACTTGTTCTAAGCGTGTGGTCTGACTAAACGGTTTAGGATATTTCTCATACACTGA
> TCACACTGACGATTCGCTGTGAACGACGAGGGTGAATAGAATAAATTCAATGCTTCTCTG
> ACCCATAGATGAACTGAAAAATAGAGAAGGGAATGTATCTTTCGCGGTAGTCGAGCTGGT
> TCAAACTTAACTAGAGAAATCTGGTAATAAGTGTCTTAATTATAATTTAGTAGAGCCTTA
> TTTTAAACAGCTGCATTGACAAATATAAATGAAACGGTTGATAATTTGTGTTTAATTTTG
> GAGTAGAATCAATTCGCGTAATAACAGAACGGGCGACTTTAAAAGTACGAAATAACCATT
> TAATTGGGACTTTTAGCTGGAAAGTTGGGTTTCATAGAGCCTCTGTAATTATTATACTGG
> TTTACAAGCTTGAATACTGCTTGCGAATGCGATTAGCTAGGCACCTATATATTGATAGCT
> TGAAGGTATTACCACGTGGGAGTTGCATACGTAGCTCCTATTGCTAAATGCTGGGTTTGT
> GCAGTACTACGTTCCGAGTTTACGAACTCCAGCGGTCCATTGTCATTGGGTGTGTTTGTA
> TAAGCAACTTTGGTTCTATTTGGCTACATACGGGGGTCTGGTTCCTCCACGTACAGCTGA
> TGTCTTCTAAGTTTCCAGAGGAATGAAGTGCGATGGCGTAACTAGATTACTGTATATATC
> CAGAGTTTCCTACGTCGTATATAATACCTCATTGATTCTTGTAATCCCATTACATTCATT
> CAGGTGATGTCTTTAGTGTTTAAGACTGCCATGTGTCCTGCTGTCCAACGAGACATAAAG
> TAGCGCTAGCGGATTATTGAAGTACCCATAATATCGAAATTCAGGATAAGTATTATTCTA
> AGACTGCATATCACTTGAACCTCGTGGGTGAGATATCTTATACTTACACTAGCTGAATAA
> ATCTACTGGGGGACGCACTGCCCTCCCTGGGCTCACTATCGTATTAAACAACTGTGTCCC
> TAGCTAATACACATCGACTCTAAGAAGTGTGTCTTTTCTTCGCCGAGGAGTCATAATGCT
> GGATGTTAGACAGGTGATACTCACGGATCAAATGGAGTAATGGTTGACTAGTATCCAAAC
> GTAGGAGATCAAAGCCACTTTTACCTCTAAAGAGAAACAAAACGCGACAGCTTAGTTGAC
> TTTCGAGAACCGAAAAAAAATAAATGAATGAATTTCGACCATCTTTTATAAGATATCGAA
> AAATTAATGGCATGTTAGTTGTGGAATTCGTTTCTGTGTAACGGAAATTAAAAATAAGGT
> AGCCTAAAATCAACCATGGGTTCACACTGTGCTGTTCATGGTTTATCTACTCGTATAGGG
> CACAAATAACAAAAACGAACACCACGACGTCAGGATACCTTCCTCGTTTACTGCACAGTC
> CACTTGATTATAATCATGGAGCGTTCGGAGCCTACCATCAACCTTCTATTAATTCCTTGG
> ATGAGGCTGCACAGCGTAATTAAAATTTCGTTGTTACGGACCACAAACTTCTTGTATCGA
> ATATTGTGGACGAGCTCAAATCCATAAGTAGGGAATCCGCTAAGAAAACGATTTTAACTT
> GGTTACACAGAGCTTGTTAGTTACAATGAGACCTGCACCTTGACTGAATTAAACTACTCC
> CGATTATTCTGTTCTAGTTGAAGGTTACTTATTGGGCCGGTCAGCCGAATAAGTAAGAAT
> CAACCATGATCCTGTTAGTGCCACAACGTGTTTTTAGTAGCCTGAGACTTATCTCTAAGG
> TTGTACAGTTTACGTGGCTTCAAACAAATTCATACGTTGCTATTTGTAGCCAACACATCG
> GAAATTTGCACGGTCGTGCAGTCTCGTAGAAAACTAATTTTGACTCGCTAACTAAGCTAT
> TACTGTGATCTGCAGTACTGCAAAGTTGACTCAATCTTTTGGGACTGTACAGGTTTGGTG
> TGCCTGTCGAATAGTGTAAGTATTGAGTACTATGTAGGTTGTGGAGCCCGTTCCCCCTAA
> GTAGATATTATCATATGTGACGTGTATGATAAGATTTTATCATTGCAGAAGCTGCTGAGT
> AGTAATAATTGTAACTTACACTTTGTGCACTGTCGTTAGACAAGTATGGTCACACCAAGT
> TTGATAGGTATTAAACTACATAAATCCAAATTTTGTCTGCTGTAGCATTCTGCTCTGGGG
> CCATATATAATGGCCATATGCCTGCTAAAGTTCGAAGGTTCGTTGACACTTCCCCCATTA
> AGCAAATTAAACCTGGTATATGATGTGATGGCGGTTTCGTGTCCGCCCTGATGTTGTGTA
> CTAGGTAGAAAATCTAAAGTTATGGCCGGAAATAAGTTCGGTCTCATCCTTATCCTAACC
> ACTTTCTATACTTCGATGAGGTGGGCGCTGGTCAACAGTTACCATTATCATACCCGGAGT
> CACCATCACCAATATCTGCGCATTGTTTTAAGGTTTGATTCGTGCCGGTTTCGCTATTTT
> AAGATGGTGAAGCACTAGGCATAAGTGTGAAACAAGCCCTTAGGATTCTGTGTAACTTTG
> TTCTTTTATAGCAAAACCAATAGATAAGTTAGGCTTGCTGCGTCACATCTGTTGAACATG
> AACCACTTAGTTTTCTAAGTACACATACGTTCTTATAACGTTTGGAAATTTGTCACATAT
> TACCGTTTATGCTGCCGAGCTGTTATAAAGTCAAGTGGGTTGTGCCCGAACTGCTCTCTT
> AAATCTCGTTAAAATTCCTCGGCGTTATGCGTAGTGTGCCATCTGTTACATGAATGGAGG
> ATGAACAAAGAATCACTTTGATAATAGTTGATCGTCTAACTATTTAGGGAATTGACGAAT
> AGCCAAACACGAACGTGTCTGAAATCTAACGCATTGTAATCCTATTGTAATAGGCAAGAC
> GTCTGTTGCCCAATTGTGTACTGCTTATTAAGTTCCACTTCCGACCCGATAAGTCCTATT
> TAAACCAAACTGTAATCTTTCTCTGAGATTGTACCACCATATTTCTCCCAGACATGCTTA
> CGTGTGCGCTACGTAAATAAGGACCGGTTACTAGCAAATGCCGCCAACAGTACATCGTCA
> TATCCACATTAAAATAAACGCTCCGGCGTACTGTGGATGCAATTCGAATCTCTGTTCATA
> CTTGCTAGCAAATTCTATTGTTCTTGGAAATCATGATACAAGTGAATGATAAGGGGCTTG
> TAAGCCCATCCGGTGCCATTTTTTTATTAATTGAGAAATCTGCACCCAATTAGTCAAATT
> ATATTTGCGAGTTAATTTACTTTGATTCAAGTGTCAAGGTGATATTGACAGTTTATATCT
> TATATCAGTTTTGTTATCTTGTACATTATGTCACAAAGTGTGCGATTTGAAAACAACGGC
> TCTCCCACCGAATCGGATATAATGAGACTGACATCCTCTTAAACCCAATCAACGGCAAAA
> AAACGCTATCCCGCTATGGTAGTATGTAAGGAACGGTATAGATTATGATTGTAACCAGCT
> ATAGTAAATGCAACGATTGTGGATGCCACCTAGTAGAGCTATACCAACTTATCGTATATC
> TATATGAAATCAGCGGCCGTTACCCCTAAAGGTATTGACGTTGCGCGCTGTTTTTCATTG
> AAATACTCTGTAACGCTTTTTCATCTGGGAGAGACCGACAAGTATTACATTATGGCAATA
> CCGAGATATTACGCGAGTACGCTGGGAACCTACATAAAATTCGGTCCAATGGATATCGGG
> TCATAATCATAACATCACTATAGGCGCGTTTCTCGGCGTTTGATAAGTACCCTATTGTAA
> AGCATGTACGTCGTTGAAAATAATGTTAGTCTCTTGATAAAAGATGCACCCTCCGAGCAC
> GCAATGCTTCTTAAGTTTTCAATGGATTTGTAACATAACTAATCCCTTCTAACCGTATTA
> CACATTCAGTGCACCAGCATTACACGGTCTTGAGACTCTATTGGTTAGTGCACTTTACTT
> TGTAGATGAGCGTTTTAGACAGTTTAACATATCATTTTTATAAGTATTCGATCCGAATTT
> GTACCATACGTGCCTGGAAAGCTTGGACAACCAGATTTGTTAAGCCAAGATGCATGAATG
> AGAGAGTGATCTTAATGTACATGGAATACTTCGGACCTTCAATATGAGAGGCCGGCTTCA
> CACAGGGCACCAAGCGCCATGATAAATGCATGGGCCAGATAATTATATCCAGAGCTATAT
> GAACTTATAGGCGAGATTGACTAAACCTTTTACCCAGAAGAACGCCTGCATTTATTCCAG
> TGTTTTAGTGTCACACTCACTGGCTAAATCTTCGGTTAACAGTAAAGGCTATTGCCTCCC
> TCCAACATAAATATAGCCAAACGTATTTATATTTCAGTCGTGAATCTTCGAAAAAAAATT
> CGCAGGGATGGGGGCGGCTTCATTTTACAGCGACAGATTAAGGATAAACCAATATGTCAG
> AATAAACATATCGCCTAATTCATGGGTCTTGTACGCTGGCCCTTCGTAGTGTATAAATTT
> CACTCGTTGTCTACAAAGTTTGTGATTTCCGGGTATTGTAAAGCGTACACGGTTGACAAT
> ATTTTTTAAGCAGCCTACTATCCTGTTGTTTGTATATATTGACAATATAGGCAGTAGCTT
> GAAAAGGATTGGTTTAGATACGTTATTAGTAACACAATAAGCTAATGGGCGATCGCGTTG
> GATGATAGAAAAATATAAGAAGTGTCAGACTTCTAATTTGATTATAAATTAAAGAGTTAC
> TGTGTATGCCTGCTGAAGTTACCTTATTAAAAGTTAAAAATTAGACCATAACCACTGATG
> TTGAGCGTCAGTATCCTGCTGTCCGCTATTTATGGAAGATAGGTTATCGGGAAATAAAGC
> TACAGCCTTGCGTGGCTTAACGATGGTCGCATGTTGTTTACTTCTAGTCTTCTTCGGGGA
> ATGACTTGTAGCATACGTTCTATACAATAGAATACCCGGGCTATATCAAAAATAACGTGA
> TTCTGCCATCCCAAACGATAAACATTATGAATCACATTCGAAAATAGCCATTTTAGAATG
> TCATCAGCTTCAGTATAGTCTCAAACCAGTAATGAAGCTACTTACAGTTCAGAAGAGAGA
> GTTGCGGAGGTGTGGCGGCATAAGGTTTGCATAGGGGCATGAGCAATTGTAAAAGGAGTA
> TGAGAGATTGGATCCCTTATTCATTGTCTGCAAGGTTGTATTTAAATGACCTCACCAACA
> TCAATATTAATAATAATTACGACTGTCGACAACAATCCCCTCGGAAAAACCGAGTATTAA
> TAATAGCCGATTCGGCCCATTTTCGACGGCAATTAAGAATAGAGTCTGTAGTTGAAGAGC
> TTCCAATATTCATAGCGGCAGCAAATGTTCGTATGCCACGAGCCTATAGAACAGCTCTTG
> TTCCTATGGATAGCAAAAATGTGTAGGTAATTATCATTACATCGAAATCTTGGCTTAACG
> TATAATTTTCCATCTAGGGTACTCGTCCAGTTTACACAATGCGCCGGCATACAACACCTT
> GTTTTTGTAGTCGAAAATGATATGATGAACTTCTTATAATTTGCCTCTAGATTACTACGC
> CTTCCGGTCACCTCCCAGCAGCATAAACTAGTAACAGAACTTAAATTGCAGCGCTTTGAA
> ATTATCCAAGGAAGATATACTTTGGAGAAAGATAAAATCTCCTTAGTGACTTATGTCGTG
> AACAAGTCGGTTATTTTATCAAAATATCAGTTTATCCGATAATTCCCGCCCCTTACTAAG
> ACGGCACTATCTAATAGCCTATACCAGGTGAGCGTTTTAATTGAGCAGCTCAAGGGGTCT
> TTTAAATATTATACGCGCCGGCAACTTGTTATAAGCTTTGTCTGCCGAAATAGTTATTAC
> TAAGTTCCCCAGGCTCCTGCGTATGAAGGTGAGTGGTGCAAGAAGTTTTTTTCTTGTGTT
> GGCCAAACCGATAAGAGCCTTATTCGGGGATTTTAGAACTGAAGATTTCAGTAAATGTAT
> TGAAATACTTCACTCTCAGATGTGTCCTAGGCGAGTGTTAGTAAGATGAGACGTTAATAC
> AGAGAAGTCTAGTAATGGCACAGAATTGTGCAGTGATATTGCAGTCAATTCTGAGAATCA
> AAGAAAGCTACTAAGTAGAGGAATCGGGTTAGGTGCCTACTGCTTAAAAATATTTTTTGA
> CTTTCAAATGAGCGCATAGGTTCGGACATTTACTACAAGTACTAATGCTTGGACGCTTTT
> GTGTAGTTGCTGAGGAAGAACTGATTTCCCAGGCCTACGTGCTTGGTTTCAACGACCAGA
> CCTTAGATCTATAAGCAATTGCATACTGTGCTCATGCATTTCGGTCATTCGGAGAACGCG
> AGCGCGCGACCAAAGGTAGCCTCGTTCCCAATAGACCTTAAATGTCAGCACGATCCTGTC
> TCATGCTGTTTACGACATTTGAATAGTAGGGGAAGTAAGGAGTGCTAGTCCAGCCAAAAT
> GACGCACAAACCTAATTTCTTCCTTGCAATGTCTGACATCACGTAGGTCCCTTTGAACTA
> GTCATAAGTAATTAAGCGGTATTTCTGCAGCTCAGCTCACTAGTTTATTCAGTTTTTCGA
> TCTGGCGTGAGGCAACTCCAACAGCTATCTTAGGAATCTACACTGTTGGAGTCCTGTACA
> GGAAATGTACCAGGGCAGTACACCGCATAAGATGTGAGAGAGGGGGGTTTCACATTAATA
> TTGGTTAAGTGAGTTGCACGAGACGCACGCCGTCTTTCTTTGACAAGACACCTTGTATTA
> TAGAAGCGCCTCCAACAATTGCTCGTTGGCCCCTGGTAATATATTTATCCAGTCTCAAAG
> GGACGTGACGTTACCGATAAATTAAGACGTGACCTCAGGTTTGTCGAAATTAAGTTCGGC
> AAATGTTCGAGAATGGAATAAAGAGGTAGCATCTGCTTTTGAGGGGGAGCTATATGTCCA
> TGTTCAATCCTCATCAATAAGCTGTAGAGAGACAGACGTAAGGACTAATATCTTTTCTCA
> CACGGTGTTGTTGTGTCACTAGTACGCTGGCTATAGGAATTGATACAGCGAAGCTCTAGG
> CAGAGACATGATCGTCCACAGTTAGCTAAGACATTATATTTTACAGATTAAGAGAGGTTG
> GCACATGGTCAGTATACAAAGCGATTGCTAGCGCTATGGCATTAAGGTCCTTACTTTGAT
> AATTACCAGCCATATTAGGTAACAGTTAAGATACATACAGCCTCCATCCTTATCTGCCCA
> CGGACGTAATAGTTAAACTTACGCGGTGCATTCAGAGGAGTGCTAGCATGAATCCCGATC
> ATTTAGAAACAACTGTCCAGTATGGCTGTAGAACTACAGGCAAGTAGTTAACAATCTAGA
> TGGTATAAGCCTAGATTCGCGGGGTTCCCTTGCTGAGAACGGCCTTACCCTTAGTCAGGA
> ATGAGCCATTTCTGGGCAATTTATCCCAATCGGATCCTGCATCGAGAGTCACCCGGTAAA
> TGGAATGATAGTTAGATAAGGTTCCCCTCGCGTCGCTATGAGATAGATATGGTACGTGGA
> CTCTTTTGGAAGATTTTCGGATAATCAGACATTTGATAGACTTACATGCTACCACTAGCA
> ACTACCGCTTTGATCAATCGTATCATTGAGTAATTTTGCAAAGAGCCATTATCGGCCCAA
> AAGACATGTTGGCATTTTAAACAGTAATGAACTAGTTTCGTCACGACCATATAGAATTAT
> TCGGATCTAGAGAGTCAGCCAAGTTGCGCAGGCAATAAATTCAAAGAAAGCTATTGGGTA
> TGCTTCTATTGATTCGGTGTAACCGTTTATAATGCGCTCGGTCAAAATCTTTTTCTAAGG
> GATCCGTGAAATGCAAGTTAATATCATTAATTTTATATACTCAGACATAAATTAGCCAAG
> AGTATATCGAATATAACAAGAACTGAGCATTTAACAACTAGACTATAGTTTACGCTACTT
> CCACTTTTAGTGTCTTGTGTGACCAATACACGTACGTTGAGGCGTGGAAGCTTGATAATA
> TTCCTCTACGAATCTATACTCAGATTAGCACAAGCTAGAACGTAAGCTACATATTAACTC
> ACGTAGACCGCATGCGATGGCAGAACAAGAATCAAGACTGAAGACAGGCTTGATTTTAAC
> TTAACCTTGATCGCATACCACATTCCAACGGGATTGAAACAGATTAGAGGCTGCTAATCT
> TAAATCTCATTTTATCCGTATCTTAACAACTGTAATTTATCAGGAGATATCTTGAGTCTG
> ATAATCCACTATGAATCGATTTGGTATTGCACTTCATTATAACTTAGGTCTTCAACTTAC
> AGCCCAGACTACATTTATAAATTCGTGATCGACAATAAGGCTGCACATACCGTGCAGCGT
> TTATCGGATAAGGATCTCATGGCTCTTTCAATGCGCTTGCATACCGGTTATGATCCTATT
> ATCGCCCCGTTGAATAATCTTTAACGTCTAACACCTTTGTGGCCGAATACATCGAGTCTC
> GATTTACCCAATTATTTTTGCTGAGAATTCCCAGTGATGTACAGGGACCGTCGTTTATCA
> TAAGCAAGAAAGGTAAGAGACGGACATCCTCCGGCTCAATCGTTTGCCCTGAAACTCAAG
> AAGTCGCAATTTGGTCCAGCGCAATCATATTTAATTCCAAGAACGTACCAGTTCAACTTT
> GACAAGTAGGGAATTGATCGTCTAGTAGCGAATTACATGTCAGCATTCCCCTTCAATATG
> GTGAATTCAACTATGTTCGAGCACCATGTTCTTTTTTATTATATGATATAGTGTCTTGTC
> TATATTCGTTAATGAGCGTCTTGCTTGAGTGAACTATGATAATTGGTACACGTCACTAGC
> TGAATACCATTTCAACTATACTGAGACAGATCTTTCTGTGATTTATAGGTACTACTTGGA
> AAACCGCTTACATTCGTTTGTAGAAGTTTTCGCTTTCGAAGAACGTTAAATATGAGGAAC
> CTGAAGAGTTCGAAGCTCTAACTGATACTAAGATATAAATCACTAAAACTACCGTATATA
> GGCAATTATTCTGTTTAGACAATGCTTTATGCATAGGTCCGATTAGTTGGATAACAATAA
> TAATATGTGTTTAACACCGGCTCTTGCAAACTATCATGAACGCCTCGACGAGCGTGGTAT
> ATGTGCTATCACACCCTCTCTGGAACAGGGTTGAACGCGCACTCGGTCCACTGAGCTCTA
> CCGTTGACGTGATAGCACAAACTCACCACGTTTGAAAGAAGCAACCAGCACTAACTGTAA
> ATATGATACCTTGTGGCAGAACTTGAAACTATAGGTTCTATCCAATTCGGTTGTGATATA
> CGGTTGAAAAACAACACGGAGTTAACAGTCAGCATCTAAAGTAGCAATAATCATAAACAC
> AGATCTACTTCCGAGTCCCACGAAGCACATCTCCGTTTAGAATAAATCAATAGGAACTGC
> GTCTCGACGACTTCATAAAAATTAACTAATTCACAGACCATCCATACAGATTACAGAATT
> TTACGTTTTGAGACCGGAACTTGATACCGACAAAAGTGTCCTAACCACTGCTCGGGGAAT
> TATCAACTAGGAGGTACGCATGAAATAGGAGACAGGATCAATTTTGCCTTCATAAAAGTT
> TCTTTCAAACGCACGAAGTTCAATGAATATACGTCGAACTCGATGCGTGATTGACCTCCT
> TTGATCATGTCATATAATTAATTAGCTAACGTCATTTGTTTTCGGCCCCCAAATTGCTGG
> AGTTTTATGCCTAGAATTACGGTGCTCGCGTCGGATCATCTTGTTAATATCACAGGCACT
> TGGTTCTAGTATATGATTCATGCCTCCGTAGTACATTCGCGATAGCCTCTATCTTGTCGA
> TACGTAAGGAAGGGCGCGAGGTTTAAGTTTGCGTAGGTAATTCCAGCCTTACGAAACGGG
> GCACTGACCTTTTATAAGACGCTAGGTGTCTTTTCAGACGTAAGTCTAGGGTGAAGTTGT
> TCCCCGTTGTGGATGAATTTCGTCAATAAGAATTGATCTTATCATCTAAAGGTATGTCCC
> TTCTAACTTCGGAGATATGGACCCTCGCCCGCAGTCCAGACAATTCATAAGCCGCACAAG
> TTGTCGTCCCTACATATCGTGAGTGGGCTCGAGAATGGAGGGGTCTTTTTTGCCGACCCT
> TGGAGACAGACTTGTAAGAACGAGAGTGACATTACTCTGCCGTGCATGGTCAGCTTAAGA
> TCGAAACGCCGGGACAGATAAACCAATTGACTTACCAGCACTTGTCAACGACTCCTTGAT
> ATATGTCAGTCTTTTTTGATATTTGCGAGGCTCCCGGTCGTCAGATCTAGCAGTTCATTC
> GCAGATAATTGTGTCTCTAACGTTACTTGCAAAATGTGCGATAGAAAAAACTAATTTTCT
> GCAATGAAACATTAGAGGTACGTCCGAAAAAATGCTGTAAATGATATACTTATCAAGTTG
> ACAACCTCTTCCAAAGGTGGGAGAGTTTGAAACGAGCCGGTACTTTGAATAGCTAAATGT
> ATGAGGGGCTGCAGAGCAAGTCAGTTAAGGATGCTTCACTGACAAGAAGAGAATTGGCTT
> AATCTATTTACCATAATCTTTAATCGTCAGTTATTATCCTATAAAGAACGGTGGATCAAC
> TGAAGACAGAACCATATCTGCGTCCGACCTGATGGTAGACACGTATCCATAATGACCAAT
> TTCCCTTCAGAAGTAATTAGCAACGTCCATACCACATAGTGGGACATATCTGTTCGGTTA
> GAGACAGCATTAATTTTCTACCTCGATCTTATGATTAGGGAAGTTATACTTGGATACAAC
> TACTCTGCGAAGCCGGTAACCTTAATTTGGACACCAGCTTATGACGTAACCATTAATAAT
> AAGCGAAAAAATATCGTGAAAGCCCCACAGTAAAGGTTATTCGTTGTGTCGTTAACTACT
> ATTAGAACCGAAAGTGGGTTAGAACCTCAGGTAAGTCCAACGTTGCAGAGAACTCTGACG
> GCTTTATCGTTTCAGAAAAGGAAAGTGACTGCAATTATTGGCGATAGTTCTCCAAGGAGA
> GCTGGGAAATTAAATTGGTAAACTTGAATCGTCTACAATGACGTCTGATTCTGGGGACCC
> CAATCCGAAATCATTAGACACGTAATACAGTAACTAGTATACAGGTACTATCGGTCATCA
> AAGCTCTTTTAGATTCAAACAAAAACGAGATTTTTTCGATGACTGTTTCTGCGTTGCTTT
> TTAGACATGATCCACAGTCTCCTAACAATGATTCCCATTCGGCTAATATAGTTCTCTGAC
> GTGCTTTATCCTTTATCTTTGGACTAGACTATAACCCTAAGCATTTCACTGTCTACTTTT
> GCGTAATTCCACTTCCTGATTATCCCTAGGTAACGTTACAAAATGATATACCATGTGGCG
> TATCACATAGGACTAACCTATGTTGGGTTTGCCTAGTATTTAAAAATATTTTTAAGGGAG
> GACTGTATTGACGATAGGCCAGATGTCTCAACGTTACAACGGATCTCATCGTTACTTCTG
> TCTCATGCAACCGCTCTATTTTTTGACAACTGGTTCTAACCGGGTGCTCTGACTAATAGG
> TTTAGGTGATTTCTCAGAATCTGTTCACACTGAAGTTTCGCTGTGAAACTCCACCGTCTT
> GACATGAAATGCAATCCTTCTAGGAACATTACAGGTAATGATAAATTGAGTTGGGTATCT
> ATAGTTCCACCTAGTCGAGATGGTTAAAACTTAACTTGTGATATCTCCGTTTAAGGGTCT
> TAATTAGTATGTAGGACTGAATTATTTTTAAAAGCGCATTGGAAAAATATAAATCAAAAG
> CGGCTTAAGTGCGGTGTAATTTGCCAGTTGTTTATTTTCGAGTATTAACACTACGGCAGA
> CTTTAATACTTAGATATAACAATGTTTTGGGGAAGGTGAGCGGGTTACTTCCCGTTCATA
> GTCACTATCTTATTATTATACGGCTGTACAACCTTGAATACTCATTGCGAAGGCCAGTAC
> AGAGGAACCTATTGATGGATTCAGGGTAGGGATGTAATACTCCGACTTGCATACCTAGAT
> CCTTTGCCTAATTCCTCCCTTGGTGAACTAATACCGGACCAGTTTTAGTAATACACCCGT
> ACAGGGTATGTGGCTGTCTGGCTAGAACCAACTTTGCTTCTAGTTCGCTTCAGAAGCCGC
> TATGGTTCAGAAAAGGACAGCTCTTGGATTATAACTGGCAACAGCATTGAAGGGAGTTGG
> CCTTACTAGAGTTATCTTTAGATCCAGTCTTTCCTTCGTAGTATTTATTAAATCATGGAG
> TCTTCTAAGCCATTTACATGAAGTCAGGTGAGGGCTTTACGGTTTTACACTCAATTCTCT
> CCTGATCTCCTACCAGACATTAAGTACCCCTACAGCTTTTTTCAAGTACCAATATTTTCG
> AAATTAAGCATAAGGTGTTTGCTTACACGGCATATCTAGTGAAAAGCGTGGGGGAGAGAT
> ATTATAATGACACGAGCTGAAGATTGAGTATGCGCCACGCACTCACATCCCGCCGCGATA
> TATCCTTTTTAACAAAGGTCTCCCTAGCTAATACACAGCGACTCTTACAAGGCTGGATTT
> TAGGACCCGAGCAGGCAGAATCATGCTGCTGAGTAACGGCTTAATCACCGTGATTTTGGA
> GTAAGGCTTGAAGACTTTACTAAAGTAGGACAGAAAAGAAACTGTTTCCTATATAGACAT
> ACAAAACCCCTAACCTTAGTTCACGTTAGTCAACCGAAAAAATATATATGAAGGTATTGA
> CACAATCTTTTATTTGATATCGATATTTTATGGGATTCTTAGTTGTGCAAGGCGTTTCGG
> TGGAACCCATAGTAAAAATTACGTTGACTATATTCAAAATTGGCTTAAATCTCGCCTGGT
> AATGCGTGATAGTCGCCTAGACGGCACATAGAAAATATACCAACACCTCGACCTCAGCAT
> TCCTGCCTCGTTGACTGATAACTACTATTGATTATAATAAGGGTGCGTGAGGTCCCTACC
> TGCTACCGTATATGTATGCAGTGCATGAGCCTGCACAGCGTAATTTAAAGGGAGTTGGTA
> CCGACCTCAAAAGGATTGGAGACATTAGTCGCCACGACCGCAAAGCCATAAGTAGGCAAT
> CAGATAACAAATAGATGTTATATTGGTTACACAGACATTCTTAGTGAAATGCACTCATGC
> TCCGTGACGCATTTAAACTAATACCGAGTTTTCTCTTCTAGTTGATCCTTACGTTGGGGC
> CCGCTCAGCAGAAGAAGTTACATTCAAACAGCTTACTCTTTGTGCCTCAACGTGTGGGTT
> GGTGCATGAGAATTTGCTCGATGGTTCGACTGTTTAACTGGCTTATATCATATTCATACG
> TGCCTATGTGTAGCCATAACATCGCTTATTTGCTCCCTCGTGATGTCTCGTAGATAACTA
> ATTGTGACTAGAGAAATAAGCGTGTACGCTCATCGCCACTAAGCAAATCTTGACTCAATA
> TGGTGCGACTGTACACGTTGCGTGTGCCTGTCGATTAGTGTAAGTATTGAGTACGAGGGT
> GGTTGTCGAGAAAGTTCCAAATATCTTCAGATGATCATATGGGTCGTGTTTGATTAGTTT
> TTATATTTGAAGTACCTGCGGAGTACTTATAATTGTTACTGACTCTTGGTGCACGGGCGT
> TACTATACTAGCCGCAAACAAAGTGTGATACGGATTAAACGTCTTATAGCCAAATTGTGG
> ATCATGTTGCATTCGCATAGGGCGACATATTGAATCCAATTATCAATCATAAAGTGCGAT
> GCTTCGGTCAAAATTAACCATGTAACCAAATTTAAACTCGTATTTCTGGGCATGCACGTG
> GAGTCGCACAACGCTTGGGCTCTACGTGGGACTAAATCGAAAGTTTGCGACGGATATATC
> TTAGGGATAAGCCGGTTCAGAAACACGTGATATACTTCCATGTGCTCGGACCTGCTCAAA
> AGTTACAAGTTTCTGAACACGTCGATACTGCACCATGATAGCAGCTTTCTGTTAAGGGGG
> GTTTCGGGCACGTTTACCTATTTTAAGTTGGTCTAGCACTTCGAATTACTGTCATTCATG
> ACCGTACCATTCTGTCTAAATTGCGTATTTGTTTCAATTTACTATAGTGAAGTTACGCGT
> CATGACTATCATCTGTTGAACAGCAACAACTTACTTTTCTTTGTACACATAAGGGCTGTT
> AACGTTTCCAATTTTGTCTCATAGGTCAGGTTAGGATCCCCAGATCTTATATAGTCAAGT
> GCGTTGGGCCACTAATCATCTAGTAAATCTACTGAAAATTACTCCCAGGTTGGAGGTGGC
> TGAATTATGTTAAATCTATCCACGTTGAAATATGTATAAATTTCAGTTTAGGTGATCCTC
> TTAAGATTTTCGGATTTGTAGTATACCCTAACACGAACGTGTCTCTATTCTTAAGATTGC
> TAATACGATTCTATTTGCCAAGAAGTCGGTTGAACAATGGTGTACGGCGTAGTTACGTCC
> TCTTAAGTCAACATATGGCCTATTGTATCCAAACTCTAAGAGTGCTCTCACTGGGTAACA
> AAATATTTCGCCCACTCTTGCTTACGGCTGACATAACTTAATATCCAACCGTTAATAGCA
> TATGACGCCAACAGTACTTAGTATTTGCCAAATTAAAATATACCCTCCCGCGTTATGTGG
> AGGCAATTCGAAGAGCTGTTAATAATTGCTAGCAAATGCTATTGTTCTTGCATATCATCT
> GACAAGGCAATCTTAACGGGATTGGAACACAAGAAGGTGCAATGGTGTTATGTATTCAGA
> TTTATGCAAACAAGTAGGCAATTTATATGGGAGACGTTATGGTAGTTGATTCAACGGGAT
> TGGTGTTTGGGTAAGGGGATTTATTATATCAGTTTTCGTATATTGTTAAGTATGTCACAA
> TGTGTGCGAGGTCTATACAACCCCTCTACCAACGTAGCCCTGATAATCACACTCACAGAC
> TATTTAACACAATAATCGGCATAAAATCGCTTGCCACCTATGCTAGGATCGTACGATCGG
> TATTGATTATGAGGGTTACATCATATAGTATAGCATAAGATTGTCGATCAAACCTAGTAC
> AGCTTTAAAAAATGATCCTATATCTATATGTAATATGCGCACGGTACCAAGTATGGTAGT
> GAACGGGAGAGCGCGTTTTAATTCAAATTCTATGTAAAGCGGTGTCATATGGGACACACC
> GAAAAGTATGACATTTTGGCATTTCCCTCATAGTAAGCCTCTAAGCGGGCTTCCTAAATA
> AAATGAGCTAATATCCATAGAGCGGCTGAAGCATATCATCAATTGAGGAGCCTGTATAGC
> ACTTTGAGAACTAACCTATTGGAATGAATGTACGTACTGGAAAATTAGGGTTGTAGAGTC
> AGTAAACATCATACCTCCGTGCAAGCAAGCCTTATTAAGTGTTCTTTCGATTTGGTACAT
> AAATTTTACCTTCGAACACTATTTCACAGGAACTCAAACACCATTAATACCTAGTGACTC
> TCGAGGCGTTTGGGCTAGTTACTTTGGACTTCAGCGTTTGTGAAAGTTTAACATATAATT
> TTTATAAGTATGCGATCCCAAGTTGTTACTTAACTCCCTCCAATGCGTCCACAACAACTT
> TTGTTTAGACAACATCAAGGAATGAGTGTGTGATCTGAATCTACATGGATGAATTCGGTC
> ATTAAAGATGACACGCAGGATTCTCACAGGCCTCCAACCGCCATCTTAAATGCAGCCCAA
> AGTTAAGGATAGCATCTGATTTTGGTAAGGATTGCCCACATGCACTAAAACTTGTACCAA
> GAACAACCCATCCTTTGTTTCCACGGTTTGAGTCTCACACTCACGGCCTTAATAGTACCT
> GTTCTGTATAGGCTTGTGCCTCAATAAAACATAAATAGACCCAAAAGGAGTGAGATTGCT
> CTCGTCAATATTAGAAAATAATTGCGCACGCATGGGGCAGGCGTCATTTGAATGCGTAAG
> ATTAACCTGAAAACAAGATGTCAGAATAAACAGATAGAATTATTCATCCGTATTCGAAGA
> TGCCCCTTCCTTCTGTATTAAGTTATCTCCGTCGATACAATGTTTCTCTTTGCCGCGTTT
> GGTAATCCGGAAACCGTGGACTATATTTTTGATGCTGCATACTAGACGCGTGTGGCGAGA
> GATTGACTATTTTCGAAGGTGCGTCAAATGCATGCCTGTAGAGACGTTAGGAGTAACTAA
> TTAACCTATTCGGCCATACCCTTCGATGATACAAAAAGATAAGATGGCTCAGAATTCTAA
> TTGGTGGAGTATGTATTGTCTTACGGGGTATGAAGGCTCATGTTAACTTATTAATAGGTA
> ATAAGTAGTCCTGAAAAACTCATCGTGACCCTAAGTTGCATCAGGTCACCTTTTGATGCT
> TCATTGGTTTGCCGGAATTAAACCTTAACACGTGCCTGGCTGATAGATCGGAGCTTGTTC
> GTGTCGTCTAGTATTATGCCGGGAATGAAGGGTTCCATTCGTGATATAAAATTGAATACA
> ACCCATTGTTCAAAAATAACGTCATTATCCCTTCACTAACCTTTAACTTGAGCAATAAAA
> TTAGAAAATACCAATTTTACTAGGTCAGCAGCTTAACTATAGGCTCTAACCTCTAATGAA
> GATACTTACAGTGATCAAGTGAGTCTTGCGGAGGTCTCGCGGCATATGCTGTCCATAGCG
> CCAGCAGAAATTGTAAAAGCTCGATGAGAGATTGGATAACTGATGATTTCTATGCTACGG
> GGGATGTTAATGTCCGAAACATCTTAAATTTGATTTATTTTGTCCACTGGCCTCTACAAT
> ACCCTAGGAAAAAAAGAGTAGTAATAATTGAAGTTTAGGAACAGTTGCGTCGCCATTTAA
> CTTTAGAGGCTCTAGTTCAAGTCCGTCAAATATGCATTGAGGCAGAAATTCTGCGGATCA
> AAACAGACGTTAGAACACCTCTGGGTCATAGCGATACCAAAAATCTCTTGGTAATTATCT
> TTACTTCCTTATATTCCCTGAACCTATAATTTTCCAGAGACCGTACTCGTACAGTGGACT
> CAATCCCCACGCATAAATCACCTTCTTTTGCTAGTCCAAATTGTGATCTTCAACGTCTTA
> TTATTGGCCGATACATGAATTCGCCTTCAGGTATACTCCAAGCTGAATATTAGAGTAACA
> CATCGTTTAGTGCACCCCGTTCAATTTATACAAGCTTGTTATTCTTGGCTCTAACTGAAT
> ATCGAATGACTGAATTAGGTCGGCAACAAGTAGCGTATTTTAGCTTAATATCACGTTTTA
> ACATAATTCCAGCCAATTACTTTCACCCCACTATCTAATAGCCGATAACTGCTCAGCGTT
> TTAATTGTCAACCTCAAGCGGGATTTTAATTTTGATACGCGACCGATTATTCTGATTAGA
> TTTCGCTGACCTAATACGGAGTAAGAACTGAACAAGGATACGGCGGATGAACGTGAGTCG
> GGCTAGTTGTTTGTTGCTTCTCTTGCCCTATACGAGAAGAGCATGATTCGCGGTGTTTTC
> ATCTGATGATTGAAGGAAATGTATGCAATTAATTAAAGCTCAGAGCTGTACTAGGACAGG
> GGGAGTTTGATGTGACCTGTATACAGAGAACTATACTAAGCCCTCACTATTCGGAACGGA
> TATTGCAGTAAATTCTGACATTCATACAAAGATAAGATCTAGAGCAAGCGGGTGAGCTGC
> CTTCTGATTAAAATTATGTTTTCACGGTCAAATGTCAGCATTGCTGACCAAATGTAATTC
> TAGGACTTATGCGGGGTACCTTGTCGCGAGGTCCTGAGCAAGAAAGCAGTTCCCTGGCAT
> TCGTGCTTGGTGTAATAGTCCACTACTTTCTTAGATAAGCATTTGATGAATCGGCTCTTG
> CATTTCCCTCATTCCGAGAACGCGTCCCACAGACAAAAGCTAGACTAGTGACATATACAA
> CTTAAATGTCTCCAAGATAAGGTAGATGGCGGTTTTAGAAATTTGTTTAGTAGCCGTACT
> TAGCAGTCCTTCTCATCCCAAAATCACCATAAAACATATTTGCTTAATTCCAATCTCTCT
> CATAACGTAGCGAACTTGGAACTACTCATAAGTAATTAAGCGCGAGTTATGCAGATCTGC
> GCACTACGTTTTTCACGTTTTACTTCGCGCGGCAGCCATCTAATTAACCTATATTAGGAA
> TCGAATCTCTTCGAGTCAGCTAAAGGATAGCTAAATGCGCAGTACAACCAATTAGATGTG
> ACTCACGGGGCTTTCAATTGATTATGGCTTAACGGTCGGGCAAGTCTCCCACGCACTCTT
> TATGTCACAACAAAAATTCTATGTTAGAAGCCACTAAAACATGTGCGCGGTGGAAACTGC
> GAAGTGTGTTATCAAGTCTCTAACCCAAGGGTCCGTACCGTGAAATTATGACCGCAAAGC
> TGCGGTCTAGAAATGAAGTTAGCAAATTCTTACACATTGGAATAAAGAGGTAGCAGCGCC
> TTGTGTGGGCGTGAGTGATCTCCAGCTTATATCCGCATCAATTACCTGGTGTCACACACA
> CGGAAGCAAGAATATAGTTTCTCACTCGGTGTTCGTGTCTATCGAGTTACATGCCTATAC
> GAAGTGATACAGACAAGCTCGTGGAAGAGACTGCTTCCGCAACACTTAGAGTAGTCATTA
> TTTTTGTCAGATTAAGTGAGGTTGCAACTGGGGCAGTATTCAATGAGTGTGCTTGAGCTT
> TCCCTGTATCGTCCTTACTTTGATATTGAACAGCAATTTTAGGGAACAGTGAAGATACTT
> AATGCCTCCATCCGTTGCTGAACAAGCAAGTAAGACGTAAACTGAAGCCGTGATGGATGA
> GGAGTGAGAGCATCTATCCAGAGAAGTTAGAAAATACTGGCCACTATGCCTGTAGAACTA
> CAGCATAGTAGTTAAAAAGCGAGTTGGTATAACACTAGATGCGCGCCCTTCCATGGAGGA
> GTACGCCCGGACCCTGAGGCACGTATGAGAATTTGCTGGGCTATTGTTACAATGAGGTTC
> ATGCATCGACACTCTCAACGTAAAGGGATGCTTTCGTAGATAACCTGCACATCGCCTCCC
> GATGAGAGAGATAGCGTACCGGGAAGCGTTTGGTTCATTGGCCGATATTCACTAATGTGT
> TACACTTTAATGAGTACTCGAGCTACTTCAGAGTTGTTCAAGCGTTTCTTTCAGTTATTT
> TGCAAACACACAGTAGACCCCAAAAAGACTGCTGCGATTGTTTTAAACTTTTCAACGAGT
> TGAGGCAACACAAGATTCTATTATGCGCTTCGTGACACTCAGAAATCTGCACATGGCAAT
> TTAGGAAAAGATACATTGTCCCTATGCTTCGATTGTTTCCGGCTAAAACTGTTGATTGAG
> CTCGGGCAATATCTGTTTCTAAGGCATAAGTGAAATCCATCTGAATAGCATGAATTTTAG
> TTTCGCACACATAATTGTCCAAACTGTATATAGATGATATCTTGAAATCAGCATTTAACA
> ACTAGTCTATAGTTTAAGCTTCGGCCACTTTGACTGTAGGGTCGGAACTAGTCTCCTACC
> TTGAGCAGTGGTTCCTTGAGTATAGTCAGCTACGAAGCTAGAATCAGATTTCCACTACCG
> TGTAAGTATGAGAAATTGTATATCACCTAGACCCCATGCGAGGCCAGAACAACATTCTAC
> AATCTTCACTCCATTCAGTTTAACTGATACTGGATCCAATAACAAATGAATTAGCGTTTG
> TATCAGTTTTGAGGATCCTAATCTTTAAGCTCATTGGTGACGTATCGTAAAAACTGTTAT
> TTATCTGGAGAGTTCTTGAGTATGATAATCCACTATGTTTAGTTTTGGTATTCCAAGTCA
> TTATTACTTACGTCTGCTTCGTAAAGACAAGACTACATTTATATATTACTCTTCCACAAT
> AAGGCTGCTCAGTACGGCAACCGTTGATAGGATAACGATAGAATGCATATTTCTAGGCGA
> GGCAAGACAGCTGATGATACTAGTAGAGCACCGTGGATTAAGCTGGTAACTCTTAAACAT
> GTCTCGAAGTTTACATAGACTATCCTGTTAACCAAGGTGTTTTCCGGTGAATTCCCTCTC
> ATCGAAAGCGACACGACTTTATCAGTACCTACTATCCGAACACACCCACAGAAGACGGCT
> CAAGAGGTTCCCATGAAACTATTGAACTACCAATGTGCTCCTGCGAAAGCATTTTTTTGT
> ACATGAAACTACAAGGTCAAAGTTGTCTACTTGGGAAGTGATACGATTGTAGAGAATGTA
> ATGGCTCCAGTCCAATTAATTATCCTGTAGTCAACTATGTTCGACCACCAGGGGCGTTTT
> TATTAGTTGATATAGTGGCTTGTCTATTTTAGTTAATCACAGTCTTGATTCAGTGTTCGA
> TCATAAGTGGTACAAGTCAATTGCGCAATTCAATGTCTAATAGAATGACAAACTTCTTTA
> TCTGATTTTGTGCGAAGTAGTCGAAAACCGATTAAATGCGTTGCTACAAGTTGTCCCTTT
> CGTACTAACTTTAATAGCACGAACCTGTTGACGGAGAAGCTCTAAATGATACTAAGATAG
> AAAGCAATTATACTAACGTAGATAGGAAAGTAGTCTGTGTAGAAAATGATGGAGCAAGAG
> GGCAGATGAGGTCGAGATCTAGATGATGAGGGCTTTATCAACGCCTCTTGCTAAATATCA
> GGAACGCCGCCACGACAGTGGGAGTTCTGCGTTCTCAACATCGATGCAAATCCGGTGTAC
> CCGCACGCGGTCAACTCTCCTAGACAGTTGACGTCAGACCTCATACTATCAACGTGGGAT
> ACATCCTACCTGCAATAACTGGAAAGATCTTACCTTGTGGCACAACTTGATAATTTTGCT
> TAGATCCTATGCGCTTCTCATTGACGGGTCAAATAAAAATCGCTGTTTACACTAAGAATC
> GAATCTTGCTATAATCAGAAAAACACAGAGAAGTACGACTCACACGAACAACAGAGCCGG
> GTAGTTTATATCAATAGGAAAGGCCTATCGTAGTCTTATTTAAAATGAACTTTGGAAAAC
> ACCTTCAAGACTGAGTAATCAATTGTTCGTGGTCTCAACGCTAAGTGTTACAGACTAAAG
> TGTCCGAACATCTCCTCGGGGATTGATCAAAGTGGACCGTCCAATGAATTAGCTCACTGG
> AGATATTGGGACGGCAGATAACGTGCTTTCATTCCATAGAACTTCAAGCAATATAACTCC
> AACGCGATGAGTCATTCTCATCCTTGGTTATTGTATTATAAGTATTTAGATATCGTAATT
> TCTTTGACGCCAACAAAGTGATCGAGTTGGAGGACTACAATTACGGTGATCGCGGACCAT
> CAGAGTCTGAAGATCTAAGGCACGTGCGTCTAGGATATCATTAATCACTACCTAGTACAG
> TCCCCTTAGCCTCTAGATGGTCGATTACGTACGAAGGGCGCGAGCGTGATGTTTGAGTAG
> GTAATTAAACCCTTAACTAAAGCCGCACTCAAATTTTATATGTCCCTACCTGTCGTTTCA
> CACCTAACTCTAGCCTCAAGGTGGTACCCGTTCTCGTTGAAGGTCGTCTATAAGTATTCA
> GATTAGCATCTAATGCGATCTAACTTATATATTAGCACATAGGGACACGCGACCGAACTC
> CTGAAAAGTCTGATCCCGAACAAGTTCGCGTCAATACATAGCGTGAGTGGGCTCGAGAAG
> GGAGGGGGCGTTTTTGACGAAACTTGGAGTCACTAGTGTATGTAAGAGACTGACATTACT
> CGCACGTCCAGCGTCAGCTTAAGATCGAAAAGCCGGGTATGTTAAACATATTCACTTAAC
> TGAACTTGGAAAAGTATCATTCATTTATGTCACGAGTTTTTCATTGTTGCCACGCTCCAC
> CGAGTATCTTCTAGCAGTTCAGGACCTGAGTATTGTCTCTCGAACCTTTCTTCAAAAATG
> TGAGAGACATAAAACGATTTGTCTCCTAGGATAAATTAGACGTACGTCAGAAAAATTGAG
> CGAATGGATTTTCTGATCATCTTCTCTTAATATTCCAAAGGTGCGAGTGGGTGTAACCAC
> ACGCGAATTTGAATAGCGAAATGTATGTCGCCATGCAGAGAAAGTAAGTTTACCATGATG
> CACGGTCTAGAACTGAATGCCATTATGATATTTAACAGATTCTTTAATCGTAACGGATTA
> TCATATAAAGTTCCGTCGTTATAATCTTCTAAGTTCATTATATGCGTCACAAAGGTGCCG
> TGAAACCGTGCCATATTGAACATTTGCAAGTCAGAAGTAATGAGATTCGTCATTAAAACA
> GAGTCGGAAATATCTCTTCGCTTAGAGACAGCATTAATTTTATTCCTACAGCTTATCATT
> AGGGTAGTTATACTTCGTGACATATACTCTGCCTAGCCGGTTACCTTATTGGCGACACCA
> GCTTTTCAACGATACATTAATATTAACCGTATTAATTTACTCTAACCCACAAACTAATCG
> TTATTAGGGGTGTCGGTATAGAAGATGTGAACCCAAAGGGCGGGAGAACATCAGGGAACT
> CCAAAGTTGCAGAGATAGATGACGCCTGTATAGTTTAAGTATAGGTATGTCTAGCCTATT
> AGTCCCCATACTTATCCAACCAGACAGCCGATAGGAAAGTCCGAATAGTGTATCCGCTAA
> ATTGTACTATGATTCTGGCCACCCCAAGCCCATTTCATTAGTCTAGTAATAAAGTTAAGA
> CTTGACAGGGTATTTCCGTCATATAAGAGCTTTGAGAGTAAAACAAAATCCAGTGTTTTT
> CGTTGAAGGTTTCTCCCTTCCTGTTTACTAAGGATCCAAAGTATAATAAAAATCAGGCCA
> AGTACGAGAATTTACTTATATCTCGTGAGTTATAATTGATAGTTGGACTAGACGATAACC
> CGTAGAATTTCACTGGAGAATGTGGCGTATTTCCTCTTACTGATTTTCACTAGGTTAACT
> GTCAAATTGATATTCAAGCTGGACTATATAATACCTCGAAAATAGGTTCCCTGTCAATAC
> TTTTGTTTAAGTGGTGTAAGGCAGGACTCGATTGACGATAGGCAACATCTCGCAACCTGA
> AAAAGCAGATCATCGTGTCTTATGTATAATGAATCCCATCTATTGTTTGTAATATGCGGA
> TTACACGCTGCGAGCAATTTTAGCTTTAGGTGAGTTCTAAGTATCGGTGATATATCAACT
> GTACAGGTCAAACTCCACCCTCTTGACATGAAATGAAAGCCGTATAGCTAAATGACTGGT
> AAGCATTATTTCACTTGGCTTTCTATAGTTACACCGACTCCACATCCGGATTTATTATCT
> TCTGTTATATCCGTTTAACGCGAGTATGGTGTATGTACGACTCAAGGATGTTTTTAACCG
> CATTGGTATTTGTGAAATCTAAAGCGGCTTATGTGCGGGGGTTTTTGCCACGTCTTTATT
> GTCCACTTTGAACACTTACGCACAATTTTATACTTACATAGATAAATGGTTTGGGGTAGG
> TGTGAGCCTTACTTCCCGTTAAGACTCACGATCGTATGATTAGAAGCCGGTAATACCGTC
> TAGACGCAGTCCCTAGGCCTGTACAGACCATCATAGTGTGGGATTCAGGCTTCCGATGTA
> ATACTCCCACGTCAATAACTTGAGCAGTGGCCTTTTTCATCCCTTGCTGAACGTATTACG
> GAACAGTTTTAGTAATACTCCCGTAATGGGGATGTCCCTCTCGGGCTTGAACAAAATGTG
> CGTAGTGGGCCATTAAGAAGCCCCTATGGTTAAGAAAACGAAACATCTTCGAGTAGTTCG
> GGCATCTGCTTTCTTCGGACTTCCACTTTATACAGTTATCGTTTGTTAAACTCGTGAATT
> CCTACGTTTTTTTTAAGAAGGGTGTATTCGTAGAAATTTTATGGAAGTAACGTGTGCGAT
> TGACGGTTTTACAAGCAATGCTCGACGCAGCTAATTACACAAAGTAACTACACATTCACC
> TTGTTTCATCGTCAAAGTTTTTACATATTAACCATTTGGTGGTGGATTTCAAGGAATAGC
> TAGTCATAAGACGCCCGCACAGTGATTATTAGGTCAAGTCATCATGTTTGAGTAGGCCCC
> TCCCAATCACATAAAGCCGAGATATTTACTTTGTATAAAAGGTCTAAATACAGTATACAC
> AGACAAGATTACAAGGCGCGATGGTAGGACACCTCCTCGATGATTCATGCTGCGGAGTAT
> CGGCTGTATAACCCTGATTTTCCTGTAAGGCTTCTAGACTTTAATATACTACGACAGAAA
> ACAAAAGGTGTAATAGATAGTCTTTAATAACCACTAACATTTCGTCAAGTTACTCATCAC
> ATATTTTTTATATGATGGTAGGGACTCAATATTTTTTTTCTTTTACATTTTTTTTGCCAT
> TCTTTCTTGTCCAAGGACGTGCGGTCGAAACCATAGGAATAATTACCGTCAATATATTAA
> AAATGGCCGTAAATAGCGCCGGGTAAGGCGGGATAGTAGCCGAGACCGATCTTAGTAAAT
> ATAACTTAAACTCCTACGATCCATTAATGAATCCGTGTAGCATATCGACTATGGTGGATA
> ATAAGCGTCACGGACGTCCATAAATGATAAAGTATATGTATGCAGGGCAGCTCCAGCAAA
> TCAGTTAGTTTAAGGGAGGGGGTTACCTAATAAAAAGGATGGGTGACTTTAGTCGCCAAC
> TCAGCATAGCCATTTCTTCGCAATAACAGAACAAATACTGGTGATATGGGGTAAAAACTC
> ATTCTTAGTGTATTGCACTCAGCATCAGGGAAGCATGGTAAATTATACCCAGTTGTAGCT
> TCGACGTCATCCTTACGGTGGCGCACCCTATGCAGAAGATCGTTCTTGCAAAATGCTGAC
> GCTGTGTCAATCAAAGGGGGGGGTCGTGAATCACTATGTGAGAGATCCGTCGAATCGTGT
> ACGCCAGTATATAATATTATTAACTGCATTTGGCTTCCATTATAATCCCTTAGGTGCTAC
> CTACGGATGTATCGTTCATTTATTATGGGCTCTAGAGAAATTACAGTGGTAGCTCTGAGC
> CTCTTAGCAATTCGTCAAGATTTAGGGTCCCAATCGACTCCTTGCGGCGCCCGGTACTTT
> ACTCTTAGTTGTCTCGAAGAGGGTGCTTCGCCTCAAAGTTACAAAGATCTTCAGTTGATA
> TGATCGGTAGTCTTTGTGTTCTGTTTATATTTCAACTACAGGAGCACGTCGTTTAAGTGG
> TAAGGTATATGGCTCCAAGCGACTGACTATTCTAGCCGCAAAAATACGGTCTTTCGGAGT
> TAACGTATGTTTGAAATTTTGTCGATCAGGTTCCAGTAGCATAGGCCCAAAGATTGAATC
> CAATTTTCAATCATTTACGGACATCCTTACGGCTAAATTAAAAATGGAACAAAATTTAAA
> ATCCTATTGCTGCGCATGCACCTGGACTCGCACAACGCTGCGGCTCTACGTCCGTCTTAT
> GCGATTCTTTGCCAACCTTATTTCTTACCGATAAGCAGGTGAAGAAACTAGTGATTTAAG
> TACTTGTCCGCGCACAGCCGATAATGGGTCAAGGTTATGAAAACCTCGATAATGATCAAT
> GATAGCACATGTCTGGTTACCGGGCTTTAGGCAACCGTGACATATGGTTTCTTGCTCTTC
> AACTTCGAAGTTCGCTCATTATTCAAAGTTCCAGGAGCTCTATATGGCGTATGTGTGTCA
> TTTTAATATACTGAAGTTACCAGGCATCACTATAATAGCTTCTACAGCATAAAAGTTCTT
> TTATTTGGAATAAGTAGGGCTGTTAACCGGTCCAATGGGGTATCATAGGTAAGGTTAGCA
> TCAACTCAGCTTAGTTTGTATTCTGCCGTCGCAAACTTAGCATATAGGATATCGACTGAT
> AAGTAATCCCACGGTGGAGGTGGCGCAATGATCTTTATGCTTGCCACCTGGATATATCTT
> TAAATGTCAGTTTAGGTCATACTATTAAGATTGTCCCATTTCTAGTAGTCCCTTAAAACA
> AACTCTATCTATTAGTAAGATTGCTTTGAAGAGGCTATTTGCCTACAAGGAGGTTCAAAT
> ATGCTCGAAGCAGTTGTTTCGGACTATTAACTAAACTTATGGAAGATGGTATCCATTCGC
> TAAGAGTGCTATCTCTGGCTTACTAAAGAGTTAGACAACTATTGATGTCCGCTCACATAA
> CGTAATATCCAAACGTGTAGACAATAGCAACACTAAACGTATTACTATTTGAAAAATGAA
> TATATTCCAGAACCACGTAGCGCCTGGAATTGCCAAGAGCTCTGATGAAGTGAGACAATT
> GGCTATTCTTATTGCATTGATTCTGAAAACGCTAGCTTATCCCCAGTGGAACAAATGAAG
> GGGAAAGGGTGGGAGGTAGTCACATTGATCATAACAAGTTCGATATTTAGATGGCAGACG
> TTAGGGTAGGGCAGTAATCGGGATTGGGCTTTGGCTAACGGGAGTTATGTTATAACTTTT
> CGTTGAGTCGTAAGGATCTCACTATCGCTCCGTGGGCTTTACATACCAGATAAAAAAGTA
> GACCTGATATGCTCTAGCACTGAATATTTTTAAAAATAATCGGATTTTAATCCAGTGCAA
> CAGATCCGAGGTGCGTTCCATCCCTTTTCATTAGCTGGCTTTCATCATATTGTATTGCAT
> TACTTTCTCGTGCAAAAATTGTACTCAGTTTAATAATGAGACGTGTGAGTTTTCTTATAT
> CCCCAAGGTAACAAGTTTCCTTGTGTACGGGACACCGCGGTGGAATGCATTGTATATCGA
> TAGCGGTGTAAGATGCCTCACAACGAAAAGGATGACTGTTTCCAATTTCACTCAGAGTAA
> GACTCGAAGAGCCCTTAATAAATTATATGACCGAATATCCTGAGACCCGATGTTGAATTT
> ATTAAATTGACCACCCTGGATACCACTTTCTGAACTAAAAGATGCGTTTCATTCTTAGGA
> CTGCTTTATTAGGGTTGTAGAGGCAGTAAACAGCATAAATAACTCCTACAAAGCATTAGG
> TTCTGTGATTTCCATGTCGTTAATTAATTTTAAATTAGTTAACTATTTCAAAGGAACTCA
> AAAACCTTGTATACCTAGTCACTATCGAGGCGTTTCGCATAGGGTATTGCGACTGCTCAC
> TTTGTCAATCGGTAAAATTTAAGGGTTTTTACTATGACTGAACAAGGTCTTAATTAACTC
> AATCCAATCCGGCCTATTAAACTTTTGGTTAGAATTCTTCATGCAAGGTCTCTCGGTGAG
> GTAGCGAAATCCATGTATTAGCTCATGATTGAGCTCTCCAACGATTATAAAACCCATACA
> TCCGAAATCTTATATCAAGCCCAAACTTTAGGATAGAATCTCATTTTGCTTAGGATTGCC
> CACTGGCAATTAAACTGGTACCATCTACATACAATCCTTTGTTTAAACGCGTGGTCGCTA
> AAAATATAGCCCTTAATAGGACCGGTTATCTATTGGATTGTCACTAAATAAAACATAATT
> AGACCAAATACGTGGGTGAGTGATCGACGCAATATTACATTTTATTTGAGAACCCATGGC
> CCACGAGTATTGTGTATCACTAACATTAACCTGTATACTAGAGGTCACATTTTTATGATA
> CAAGTATTCATCCCGATTCGAAGATGCACATTACGTCTGTTTTTTGGGATATACGTCGAT
> AATATCTTTCTCTGTGAACCCTTTGCTAATCAGGAATCCGGGCTATATTTTTTGGATCAT
> CAATTAGTGAAGCGTCGGGCGTGAGATGGTATAGTTTCCAACGTCAGTCTTTTCCATGCC
> TGGTCAGTCCTGTGGACGAAATATTGAACAGTTTCCCCCTGACACTTCCAGGAGTCTATT
> TGATATCATCGCTAACAATTCTATGTGGTGGTGTATGTATTCTCTTTAGCGCTAGCAAGC
> CTCATCGTAAAGTATGATTTGGGATTTAGTACTAATGTAAAACTCATCGGCTCACTATGG
> TGAAGCAGGTAACATTGTGAGCCTTCATTCCTTTGACCCTTTTAATCAGTAACACGTCCC
> TCCAGGATACTGCGGACCTGCGTCGTGTAGGATACTAGTAGGACCCCTATGAAGGCTTCA
> ATTACTGATATTAAATTCTAGAAAACCCATTGTGAAAAAATTTCGTCAGTATCAATTAAA
> TAACCTGTTAATGGAGCATGATAATGACATAATTCAAATTTTACTTGCTATGATGATTAA
> CTAGTCGCGATAAAATCGTATCATCATAATGAAACTGATCATCTCACTCGTCACCACCTC
> GCGAGCAAGTTCCTGGCAAGAGCGCCAGCACAAATGCTATAAGCTCGAGGAGTCAGGCCA
> TAACGGAGGATTTCGATGATACGGGGGTTGTTATTCTAAGATAAATCTTATTGTGGATGT
> TTTTTGTACACTCGACTATAAATTAAAATAGCTATATAACTCGTGGATGAATTCAACTTG
> ACCAACTGTGGACTAGCATTTTAACTTTAGTCGATCTTCGTCTTCTCAGTAAATTTTGAA
> GTGACCCTCAATTTCGGACGAGCAATACTCAAGTTTCAAAACAGCGGCGGAAGAGCGTGT
> CATAATATCGCTTCCTTATGAGCTTTTCTTACTTAGATGCCAGGAAACTATTATTTGAAA
> GAGTCCCGAATACGAATCTGGACTATTGCACAACCATTAAATAAAAGTCGGGTGCTTGGC
> CAATTGCTGATCTGCTAAGTATTATTTGTGGACGAGTCATGTAGTCCACGGCACCTATAA
> TCAATCATGATTATTAGACTAAAACTTAGGTTAGTCAACACAGTGCTTTGGATAAAACCT
> TCTGAGTATTGCCTCTATCTGAATAGAGAAGGACGCAATGTGCTAGGCAAAATCTACCGT
> TTTGTAGATTATTAGATCGGTTTAACATATTTAAAGCAAAGTAAGTTCTACCAAAGATAT
> TTTACAAGTGAAATGCTCACACTGTGTATTCTCATCATATTCCGCGATTTTAATGTTGTT
> AACACAACGATTATTCTGTTTACATTTCGCTCAACTTATACGGAGGAAGTACTGAAAAAC
> CATAAGCCCGTTCAACGTCACTCCGCCTTCTTCTTGGGGGATTCGCTGCCAATTTAACTG
> AACTCAATGTTTCCCCCTGGGTTCATATCATGTGTGAACGATATGGTTGCATTTTAGGAT
> AGATCTCAGCTGTACTTCCACTCGCGGACGTTCAGCTGAACTGTATACACAGATCTATAC
> TATGCCCTAACTAGTCGCATCGCTTATTCATCTATATGATCACATGCATACAAACAGAAG
> ATCGACTCCAAGAGCCTGTCCTCAAGTCTGAGTAAATTTATGGGTGCTAGGTATAATGTC
> AGAATTGCTGACCAAATGTAAGTATTGGTATTATCAGGGCTACATGGGCGCGACGTCCGC
> ACCTTCATAGCAGTGCAATCGCATTAGGCATGCCGGTAATAGTAATCTACTTTCTTAGTT
> TAGCATGTCATGAATCGCATATGCCAGTGACCTATGGACGACAACCACTCACACAGACAT
> TTCCTAGAAGACTGAAATAGACTAATGTAAGCTCTCAAACTTAAGCGAGATGCAGCTTTT
> ACAAATGGCTTGAGTACCCCTTCTTTCCACGCAGTCTAATCAAATAATCAACATATATAA
> TTTTTGAGTAATTCAATGCGCTCTATGAAACGACCGAAATTGCAAATACGATGTAGGTAT
> TTTCACCGTGTTAGCCACATATGCGAACGACGTTTGTAACGGTGTACTGCGCCACGCAGC
> ATTATAATTATCCTATAGTACCATTAGAATCTCTTCGTGTAAGCTAATCCATAGCGAAAT
> CCCAACTAAAAACAATTTCAGGTCACTCACCCGGCGGTATATGGATTATGCCTTTACGCT
> CGGGCAACTCTCCATACAACGAGGGATGTCTAAACAATAATTCTATGTGAGAACACAATA
> AATAATGGGAGAGGGCGAAAATCCGATGTGTGGTAGAAAGGATATTTCCCAACGCTACGT
> TCCGTGAATTGTTCTCCGCAAAGATCCGGTCTACTTTTGAACTGACCAATTTCTGACACA
> TTCCTTTTTAGACCGAGAAGAGCATTGGGTCCCCCTCAGTGTTCGCCAGCGTATTGACGA
> TTAATTTTCATCGTCTCTCTAACAACGTACCTAGTATTTAGGTTATATATACCTCTTCGT
> CTCGATCGTCGTACATCCAGTTTCGAAGGCATAAACACATGATCGTGGATCTCAATGCTG
> ACGAAACACTTACAGTACTAATGAGTGGTGTAACATGAACTGACCGGGCAAATGGGGATC
> TTTTCTATCACTGTCATTCAGATTTCCATGTTTCCTCATTAATTTCATATTGTACACCAA
> TTGTACCGATATCTGAACTTTATGAATCCATAATTAAGTTGATCAAAAAGCAAGTAAGTC
> GGTTTCTGTAGACCTCATGGATCACGTGGCAGTCATTCTTTACAGTGAAGGGACTTAATT
> ATGGACACTTTCCATGTACATATTATCCATTCTTGGGATAAAGAGTCTGCCGATAACAAG
> TCATGACACCCCGTACATGCAGCACTAAGCAAGGTAAAGGACGAACCTAGCACAATGTGA
> TCGGATATTGTGAAATTGACCTTAATGAAGCGACTCGATCAACCTATAGGCTTGCTTTCG
> TACATTACCGGAACAGCCACGACAGTTCACAGAGATTGCCTAACGCCAAGCGGGTGCTTC
> AGTGGACCAGATGCACTAATGTCTTACTAGTTAATCAGTAATAGACATTATTCACAGTTC
> TTCTAGACTTTCTGTCACGTTTTTTCATTTCTCAATGTAGACCAAATAAAGAATGCTGCG
> ATGGTTTTAAACTTTGCAACGACTTGACGAAACTAAAGTGTCTATTTGGACCTGAGTCAC
> ACTAACAATTCTGCACATCCATATTTTGGAAATCATTCATTGTCCCGAGCAGTAGAGGGT
> TTCCGGCTAAAACGGGTGTTTCACATACCGCTTTATATGTGTAGTAGCCATAACTCTATG
> CCATCTGAAGTGAATGATTTTTAGTTTAGAACAATTAATTGTCCAAACTGTAGTTACTTG
> TGTTATTCATATCACAATTTATATTATACTATATTCGTTAACATTAGGAAACGGGGTCTC
> GAGGCTCGCAAATAGTATACGAACGGCTCCAGTCGTTCATTCAGTTGTGTAAGATACCAT
> GCTAGAAGCACATTTCAAATACCGTCTAACTATCAGAATTTGTATAGAACCGTGACACAA
> TGACTGCCATGTAAAACTTTATACTATCTTCAATCCATGCTGGTGAAATGTTAAGGGAGA
> CATTAAATATTGAATTACCCTGTCTATAACTGGTCACCAGCAGATGATTTTTGAGCTTTG
> GTGAAGGTTAGTATAATCGCGTATTTAGATCCTGAGTTAGTCACTATCAGAATAAAAGAG
> CTTTACTTTTCCTATTCCTAGGCTTGTGTACTTTCCGAGGATTAGGAAACACAACAAGAC
> ATGTATTTATTACTCTGACAAATTAACCAGCCTAAGTAACGCAACAGTTGTTACCATTAC
> GTGAGAATCCATATTGCTTGCACAGGCATGAAAGCTGATCAGACTAGTAGACAACAGTGG
> TTTATGATGGTAACTATTTAACATGGCTCCAACTTTTCTGACTCTAGCCTGGTAAAAAAG
> GTGTTGGCAGCTGTATGAAATCGCAGCGTATGCCACACGACGGTTTATGTACCTACTATC
> CGTACACAACCTAAGAAGAAGGCTAATGACGGTCAAATGAATATATTCTACTACAATTGG
> CCTACTCACATAGATGTTTTTTGTAAATCATACTACATCGGAAAAGTGGTATTCTTCCGA
> TGGGTGACGATTGTACACAAGGTATTCGATCCTGGACAATGATTTAGCCTCTTGTAAAAG
> ATGTTAGTCAACAAGGGGAGTGTGTTTTTGTGCATTGACGGGATGGTAGATTTTACGTAT
> TCACACGCGTGATGCACTCTTCGATCTTATGGCCGACAACGATATTGAGCATGTAATGGT
> ATAATTGTAGCACTAACTTCTGTATCTCATGGTGTCCGTAGTAGTCGTAAAAACAGGTAA
> GGACTGGCTACTAGTTGTACATTTACTACTAACTTTATGAGCACCAACCGCTTCTCGGAC
> AAGCGAGTAAGCTGTAGAAGAGAGAAAGCAAGTATACTAAACTTGATACGATTGGTGTAT
> CGGTAGTATATGATGGAGCAAGACGGAACTTGTCGTCCTGTTATAGTTGATGAGGGCGGT
> ATAAAAGCATATTGATAAATTGAAGGAAACAAGACTACACACTCCGAGTTCTCAGTTCTA
> AAAAGAGAGCCAAATCCGGTGTACCACAACGACGGAAAATCTCAGAGAAACTTCTACTCT
> GACATAATAAGATAATACTGGCATACATCCTTAATCATATTAAGCGTTAGTTCTTACCGG
> GTCCAACTACGTCATTATTGTCCGTAGATAATTTGCCCTGCGCAGTGAACGGGCATATAA
> ATATACCTGGGTTATCGATGAATAGAATCTTCATAGTTGAAGTATATATCAGAGAAGTAC
> GTCGCAAAACAACATAAGAGAACGGGTCTTTTTTTATTGTCCAAAGCACGATACTACTAT
> TATTTAAAATGATATTTGGATAACTCCTTAAAGAATCTGTAATCAAGTGTTCCGGGGCTC
> AACGCTAAGTCTTTAACAATAATCGCTCAGAAAATCGCATACCGCATTGATAATAGTGCT
> CCGTACATTCAATGACCTCAATGGTGATTTGGGGACGGCTGATTACGTGAGTTATTTACA
> TACAACGTAAAGCTTGAGAACTACTAAGACTTCACGCAGTCTAATAATTGCTTATGCTAT
> TATAAGGATTTACATTTACTATGTGCTGGGACGCCAAAATAGTCATCCACTTGGAGCAAT
> ACAATTACCCGCATAGACGACCAGATGAGTCGGTAGAGATATGCAAAGTCCGTATAGGAT
> TTCATTATGCACGAACTTGTTAAGTCCACTGACAATATTGATGCGACTTTACGTACGAAC
> CCCCACACCGTGATGGTGCACTTCCTATGTAATCCAGTAACTAAACCCCCTAGCTAATGT
> TTTATCTACATTCCTCTAGTTTATCTACTATCTCGAGCCTCAACGGCGTACCCCGTCTCG
> TTCAAGGTCCTATTTTACTTTGCTGATTAGATTAGTTTGCGTTCTAACTTATATAGTAGC
> ACATAGCCACAAGACAAACAACTAATCAAAAGGCTGTTCACCAACTTCTTCGACGAAAGA
> AAGTGACTCTCTGGCCTACTCATGCGAGCCGGAGTTTGGCACCAAAATGCCTCTCACTAG
> GCTTTCTAACTCTCGCTAAGTTAGAGCACCTCAAGCGGAACCTTATCTGACTAAACAAGC
> CTATCTGTATAATAGGCAATTTACTCAAATTGGATAACTATAATTCATTTTTCGCTCGAG
> GTTTTCATTGGTGACACCATACACCGACTATCTGCTACAACTTATGGACATCAGTTTTGT
> CGATAGATACTTTAGTCAATAATGTGACAGACATAAATAGTTTTGGCTCATAGCATTAAT
> TTCTCCTAAGTAAGATTATTTCAGCGAATGCATTGTCGGATAATCGTCTATTAATATTAC
> TAACGGCCCACTCGGGCTTACCACAACCGAAGTGGTATACCGATATCTAGCTCCCCAGCA
> TCACATACGAACTTTACCATCATGAAAGCTCTTGATCTCAATGCCATTATGAGATTTAAA
> AGTTTATGGTTGCGTAACGGTTGATAATAGAAACTTCCCTCCTGATAATCTTCTATCTTA
> ATGATATGACTCACTAAGGTGCCGTCTATACGTGACAGATTGAAATTGGGAAAGTCTCTT
> CTTTGGACATTAGTCATTTAAAATGAGGCCCTAAGAGCTCGTAGCGGAGACAATCATTTA
> ATGTTATTAAGACAGATTATCATTAGGGTTCGGTGAAGGCCTGTATTAGAATATCCCTAC
> AACGGTTAATGTTTGGCCTAAACACATTTGCAACGTTAAATTAATATTAACCCTTTTATT
> TGACTCTTTCACACTATCTAATCCTGAGTACGGCTCTACGTATAGTAGTTGTCATCCCAA
> ACGCCCGGACTAAAGAAGCGAACTACAAACTTCCTCACATAGATGTACCATGGTGACTTT
> AACTATACCTATCTCTAGCATTTTTGTCCACATACTGATAAATCCTCACAGCCCATAGGT
> AAGTCCGATTAGGCTAGACGAGAATTTCTACTATGATTCGGCCCTAACATTGAACTTTTA
> ATTAGTATAGTAATTATCTTTAGTCGTGAATGCGTAGTGACCGAATATTACAGATGTGAC
> AGGAAAACTTATTACAGTGTTGTGCCTTCAAGGGTTATCACTTCCTGGGTACTAAGCAGC
> AAATCGATAATAAATTTCTGGAAATGGACCAGATTTTTCGTATAGCTACTCAGTTATAAG
> TGAGAGTTCCAATACTCGTTAAACCGTTCAATTTAAATCGAGTATGGGCCCTATGGCATA
> TGAAGCTGGTGAAAGACCTTTACTGTCAAATTGATATTAATGCTCGACTTTATAATACCT
> AGAAAATAGCTTCCCGGGCAATACTTTTGTTTAAGTGGTGGAAGGCACCAAGCGTTTCAC
> CTTACCAATCATCTAGATAACTGTAAAACCAGATAAGCCTGTATTAGCTAGAATCAATCC
> CATCTAGGGGTTCTAATATCCGGATTTCACGCTCAGAGCTAGTTTACCTGTTCCTCTGGG
> ATAACTATAGCTGATATAGCTACTGTACAGCTCATAATACAAACGATTCAATTGAATGCA
> ATGCAGGAGACCTAAATGTATGCTTAGCTTTTTTTCACTTCCCTTTAGAGAGTTACACAG
> TCTACTCATCCGGATTTAGGTTATTCTCTTAGAGCCGTTGTTCCCGAGGTTGGTCTTGCG
> ACCTCTCAAGGTGGGGTTTATCACAATTCCTATTTGTGTTTGCTTAACCCGATTTTCGCA
> CCGCGTTGGTGCATCGTCTTGATTGGACACGTTGTTAAATTACCAACTAGTTTTTTAGTA
> CATAGTTAAAGGGTTGCCCCTACGTCTCAGCCTTTAGGCAACGGATGTCTAAAGAGAGTT
> TGTGTTGAACCCGCGAATTCAGGCTAGAAGAAGGCACTTGCAATCTTAAGTCCATAAGAG
> TGTGCCTTTAACGCTTCCGTGGTAATAATACCTAGTCATGTAAGTCAGAAGTGCCATTTT
> GAATCACTGCCTCATAGTATTACGGAACACGTGTACTTATAATCAACGAATCCCGATCTC
> CCTCGAGCGAGTCTTCAATATGGCAGGAGTCGGACATTATCAACAACCGAGCCTGAACAA
> AACGTAACAGATGCCAGGAGTTCGCCAATCTCCTTGCTTCCCACTGCCAAGTTATACACT
> TATCGTGTCTTAATCTAGTGAAGTACTACGTGTGTTTTAAGATGCCTGGAGTAGTAGAAA
> TGTTATGCATCTATCCGCTGCGATGGTACCGGTTTATAGAAATGATCGAAGCAGAGAATT
> AAACTATGTTTCTTCAAAGTCACCTTGTGGAATCGTAAATGTTGTTACTTTGTATCAAGT
> TCGTCGTGCAGTTCTAGCATGAGATACTCTTAACACGCCCGCTCTCTGAGTTGTAGCTAT
> AGTCATCATGTTTGACTAGCCCCATACATAGCAAAGAAACACCACATAGTGAAGTGGTAT
> AATAGCTCGAAAGACAGTAGTAAATGACTAGATTTCAACGAGCGAGGGGACCAAAACTCA
> TCGATGTTTCAGCATCAGGTCTATACCATGTAGAAACCTCATTTGCCTCTATGCAGGCTA
> CTCGTTAATTTACGTCCTATCATATCAATAGGTGTAATAGTTTCTCTTTATTATAAAATA
> AAATGTCGTAAACGTACTATTAACATTTTTTTTATTGCATGCTTGGCAATAAAGAGGTGT
> TTTCTGTGACATTTTGGTTCCCATGAGTTCGGCTCATTCGACGTGAGCGCCTTAAAATTC
> GTTTTTTTACCGTCAAGTTTTGAATAATGCCAGTATATAGAGCAGCGTATGCCCGCTGAC
> TAGACGTCAACCATATTTCTTATTATTAATTATAATACTACGATCCTTTAAGGAAGACGT
> CTAGCATATAGAATATGCTGGTGTTTAACCCTCACGCACCTAAATTAATGATTAACGAGA
> GCTTGCAACGCAAGCTCAAGCATATCACGTAGGTTATCCCACGGCCTTACCTAATATTTA
> CGAGGCCTGACTTGTGTAGAATACTAACAATTCAATGTTCGTCCATTGAACAGATAATTT
> ACTGCTGTTATGCCGGAATATCTAATTAGGACGGTATTCATCTAAGCATAAGGCTACATT
> GGTTTAGTAGAAACTCGTGTAGCGGAGTCGGCTTAAGGTACGTCGCCAAACAGATCAACT
> ACTTCGTTATTGATTAATCCTGAAGAGGTCTCAATAATACGCGGCCGTCGTCAATCTCTA
> GGTCAGACTTCCGGAGAATCGGGTAAGCCAGGATTTAATTTGATGAACGGAAGTGCGCTT
> CAATTATAAGACCTTTGGTCATAAAGACGCATCGATACTTCTTTTATTTGGGGCTATACA
> CTTAGTACAGTCGTACAGCTGACAATAGTAGAAATTAGGCAAGATTGAGCCGCCCAATCG
> AATCCGTGCCGCGCAAGCGACTTGACGCGTTCTTGTCTCGAAGTCCCTCCGGCGACTCAA
> ACTGAAAAAGTTAGTCTGTGCTGATGAGCGCTACGCTTTCTGTTCTGTTTAGATTGCATC
> TAAAGCACCACGTAGTTTATGGCGTTAGGTATATGGCTCAAACCCACGGACTATTAGTCA
> CCAAATAATTCGCGCTTTCCCTGGTATACTATGTTTCAAATTTTCGCCATAAGCTTCAAG
> GACAAGAGCCACAATGTGTGTAGAAAATTTGCAAGCAGTTTCGCACTTCATGACCGCTAT
> AGTAAAAATCGTAAAAATGGTTTAAGCCTTTTGCTGCCCTGCAACCGCGACTCGAAAAAA
> GATGCCCATCGTACTCCGTATTTTGACATTCGGTCACAACCTTTTTTCGGACCGATATGA
> AGCTGAAGTAAATACTCAGTGTAGGACTGCTCAGACCACAGCCGATTATCGGTAAACGTG
> ATCTAAAACTAGATAATCATAAATCTGACAACATGTATCGTTTCCCCGCTTGACGCAAAC
> GGGAAAGTTGGGTTCTGCCTATTCATAGTACAAGTTAGCGCATTATTCAAAGTTCAAGGA
> GCGAGATATGGAGTATGTCTGTAATTTTAATAGACTCATCTGTACACGAATCACGATATG
> AGCGGCTAATGCTTAAAAGGTCGTGTAGTTCGTATAAGTACGGAGCTTATACGGGAAAAT
> GGGCGATATTACCTAACGTGTGCAGCAAATCAGAGTAGTTTCGATTCTCACGGCCCAAAA
> TTAGAAGATACGATAGAGACGCTTTTGGAATACCACGGTGCACCTCGAGCAATGAGCTTT
> ATGCTTGCAACCTGCATATATCTTTAAAGGGATCTTTTCCGCTGACTAGTTACTTTGTCC
> CATGGCTACTAGTCAATTTATACTAACGCGAGCTATGAGTTACATGCAGTTGAACTGGAG
> TTGTCCATTCTACGACCGGCAAATTGCCGCGTAGCACGTGTTTACGAATAGGAACTAAAA
> TGTTCGAAGAGGGTTTAATTTAGAGTACACTGAGAGATATCGCGTAATAATGTGGTACAA
> AAATATGCATGTACCCGCAAAGTAAGTTTTTTCATAACCTGTAGTCAATAGCAACAATTA
> TCGTATTACGATTTCAATATGGTATTGATTAAAGAAACACGTAGCGCCTGCATTGGACTT
> GAGAGCGGATGAAGTCAGACAATTGCATAGTCGGATTCCTTTGATTATCTAAACGATAGA
> TGTTACCCAGGCCTTAAAATGAACCGCAATGCGGGGGAGGTTGGCTCATTGAGCATAAAT
> TCGTCCATATGTTGATCCCACTACGTTGCGTAGGGCTGTATTAGCCATTCCGCTTTCGCT
> AACGCGTGTGATGTGTGATCTTGTACGTGAGTCGTAACGATCTAAATTTCGCGCACTGGG
> ATTTTAATAACAGAGAAAAAACTACACATCATTTGATATAGAAATCAAGATTTTTAAAAA
> TATTACCATTTTTTTACAGTCAAACAGTTCAGACCTGCCTTACTTACCGTGTCAGGTGCT
> GGCGTTAATAAGTTTCTATTCAATTACTGTCGACTGAAATAATTCGTATCAGTGTAATAA
> TCTGACGTGTGAGTGTTCTTTGATCACAAACCGTAAAACTTTCCGTCGCTAACGCACACA
> CCCGGGGAAGGATTTGTAGATCGTTACAGGGGTATGAGCCCTATCTAACTATTCGTGCTA
> TGGTTCCATTTTAAATCAGACTAACAATAGAACAGCCATTAAGAATGTTTAGGACCGAAT
> AGCATGACACCCCATCTTGAATTTATGATATTCTCCACAATGGATACAAAGGTCTCTTCT
> AAAAGTGGCCTTTCATTCGTACGACGCCTTTAGTTCCGGTCGAGACGAAGTTAACTGCAT
> AAATAACTCATACATTCCAGGAGGTTCGCGGATTTCCTTGTCCTTATGTAAGTTTAAATT
> ACTTAACGTTGTAAATGGAACGAATAATCATTGTATACAGACGCTATAGAGTGGACGTTC
> GCATAGGGTATTGCGTATGATCACGTTCTCTATCGGGTAAATTGATGGGGGTGTTCGATG
> ACTGAAATTGGGCGTAATGTAAGAAATCATTTCAGGAATATTAATATGGGCGGTACAATT
> ATGCATGCTAGCTCTCTCGCTGAGGTTGAGTATGCCTTCTAGGACCTAATGATTGTGCTA
> TACAACCAGTATATAACCAATAATTCACAAATATTTTTGCATCCAAAATCTGTTGCAGTC
> AATATCATTTTCCTTACCATTCAACTATGCATAGTTAAATGGTTAAATCTTCATACAAGA
> ATGGCTGGAATCCCGGGGTCGAGATATATATACCAAGTTAGAGGAACGCTTATCGATTCC
> ATTGTCAAGAAATAATAATGTTTGTCTAAATTTACGTCGCTCTGTGATAGACGATAGATG
> ACTTTTTATTGCACATCCCAGCCCCAACCACGATTGTGTATCACTAACTGTTTAATGTTT
> AATTCAGCGATCTTGTTTATGTGACAAGTATTATGACCGATTACAACAGCCAAAGGACGT
> CTCTTGTTTGGGATATACCTAGAGTATATCTGTAGCTGGCAACCCGTTCCTTTTAACGAA
> TACCGGCTATTTTGTTTGCTTCATCAATTAGTCAACACGCGGGCCTGACTGGCTATAGTT
> TACATCCTCAGTATTTTCATGCAAGCGTCACTACGGTGGTCGTTATATTGATAAGTTGAC
> CAATGAAAATGACAGCTGTCTATTTCAGTTCTTCCCGATCAAGGAGTTGTCCTGCTCTTT
> GGTTTCTCGGTACCCCGTGCAACCAGCTTCGTTAAGTTTGTTTTCCGTTTTTCGACTAAT
> CTAAAAATATGACGCTAAAGATCGTCAAGAAGCTAAAAGTGGCAGCCTTCTTTCCGGTGA
> ACCTTTGTTTCAGTAAAAACGCAAGCCAGGTTACTGCCCACATGCGTAGGCTACGATTCG
> AGTAGGAACCCTTTCTAGCCGTCATTTACTCAGATTAATGTCTTGAAAAAAAATTCTGAA
> TTTATTTACGAAGTATAAATTAAATAAAATGTTTATGCTCCTTGATAAGGACTTATTTCA
> ATGTTTTATTCCGATCATCATGATCTAGTCCAGATATAATCGTTGCTTCATAAGGTATCT
> GATATTCTCACTCGGCACCTCCTAGACACCAAGTTCAGCGAATGACACAATGATCAATGG
> CGATTTCATAGTGCACTCTGGCCTTAAAGCTGGATTTAGAGCATTACCCCCTGGGTTTTC
> TAACATAATTATGATTGTGCTTGTTGTTGGTACTATCGACTATAAATTAAAATACCTTTA
> TAACTCGTGGTTGAAGTCAACTGGACCAAATGGGCACTACAATTGTTAATTGTCTCCATA
> GTCGGATTCTAACTAATTGTGCATGTCACCATCAATTGCGGACCTGCAATAATCAACTGT
> CTTAAAAGAGGCCGAAGTGACTGTCATATTATAGAGTCCTTTGGTGATTTTATTAATTAG
> ATGCCAGGTTAATAGTTGGTGAAAGACTAACGAATACGAATCGGCTATATTGAAAAACCA
> TTTATTAAAAGGAGGGGGATTCGAATTTTGCTGTTATGCTTAGTATTTGTTGGGCAAGAG
> TATTGTAGTACAAGGAACCGATAAGAAATCATCATTATTACACGTAAAATTACGTTTCGC
> ATAACACTGATTTGGAGAATACATTCTGAGTAGGCCATATTTCTGAATAGACAAGCTCGC
> TATGTGCTACCATTATTCTACCCGTTTGTTCATTATGAGATCCGGTTAAATTATGGAAAC
> AAAAGGTAGTTATAAAAAAGAGATTTGACAACTGAAATCAGATCACTGGGTTGGCTAATC
> AGATTCACCCAGGGGTTTGTGGTTAACACAACCATTAGGAGGTGTTCATTTACATCAAAT
> TTTTACCACGTACTTAGGAAAATCCAGAAGCACCTTCAAACTCTCTACCCATTCTTCGTG
> GGGCATGAGATGCAAATTTAACTGAACTCAAGCTTGACACCTCGGGTATTAGCTTCTGGG
> ATCGATTTCGTGGCTTTTTAGGATAGAGATCACCGCTAATTCCACTCGCGCTCGTTCAGC
> TCTAAGCTTGTATCACATCGATTATTTGACATAAATAGGCGCATAGCTGTTTCATCTATT
> GGAGCTATTGAATTATATCAGTACATAGTCTCAATCACCCGCTCATCAAGTATCAGGTTT
> TTTATGGGTGATAGCGATATGCTAACAAGTCATCAAAAATTGTAAGTATTCCTATTTGCA
> GCCCTACAGGCGACCGTCCTAAGCTCATTCTTACAAGTGAAATCCAAGTACGCATGCCGC
> TAATACTAATCTAAGGTATTACTGTACAATGGCATCTAGACCATATGCATGTGACATATG
> GACCTCTAACACTAACAAACTAATTTCAGTCAAGACTGAAATTGAATAATGTTTGCTATA
> AAACTGAAGCGACATCCACCGGTTACTAAGGGCTTGTCTACACCTTAGTTCCTCGCAGTA
> GAATCAATTTTTAAAAATATTTAAGTTTTCAGGAATGAAATGCGAGCTATGAAACGTCCC
> AAATTCCTTAGAAGATGTACGTTTGTTCACACTCGTAGCATCAGATCACAAAGAAGTTTG
> GATAGGTGGAATGAGCCACGATCCATTATAATTATAAGATAGTTCCATGAGTATAGAGGC
> CTCGAACCTTATCCTTTGAGTAATCACATCGTATAAAATGTTCAGCGCACTCTCCCCCCG
> GGATATGGTTTTGCCAGGTTACCTACGCAAACTCTAAATACAAAGAGGGAGCTATATAAA
> ATAATGAGATCTGTCATCAAAAGAATTAATCGCACACCGCCAAAATCACTTCTCTCGGTG
> AATCGAGATTTACCTACCCTAAGGTAACTCTTTTGTTCTAAGCAAACATCACGTATACTT
> TGCTTCTGACAATTTGAGGAATAATGCCTTTTTACTCCGACAACAGAAGGGGCTCCCACT
> CACTCTTAGAAAGAGGATTGAACATGAATTTTCAGCCTCTATATATATACCTTCATAGTA
> TTGACGGGAGATATACCGCGGCGTCTAGATACTCGTAAAGCCAGTGTACTTCGCAGAATC
> AATTCATACTCCATCTCTATGATGACGAATATAGGTCAGTTCTAATGTGTGGTCTAACTT
> GTACTCACCGGCAATATCCCCATCGTGTATTTCACTCTCATTCACATTTCCATCGTTACG
> AAGGTAGGGCTTTTGGTAAACAAAGTGGACCGATATCGGATCTTTATGTATCAAGAATGA
> ACGTCAGCAAATACATACGATGTAGGTTTAGGTACACCGCATGGATCTCCTCGCAGTCAT
> GATTGAAACTCATCGGACTTTATTAGCCAATATTGCCAGCGTCTTATTATCCATTCTTCG
> GATAATCACTCTGCCGTGTTAAAGTCAGCACACCAAGGAAAGCCACCACTTACAAAGGTA
> AAGCACCATACTAGCTCAATGGGAGCCCATTGGCTGAAATTCACCTTAAGCATGACTCTA
> GATAAACCGATTGCCTTCATTTAGGTCAGTTAAGGAAAAGACAAGAAACTGCACTCTCAT
> TCACGAACCCCAAGACGGGCCTTCAGTCCAACAGTTGAACTATGGTCTGAATAGGTATGC
> ACTAATACACATTAGTAACACGGCTTATAGACGTGATGGAACGTTGGGGCATTTATCAAT
> CGACACCAAATATTCAATGCGCACATGCTGTTAATAGTTGCATAGTCTTGACCAAACTAA
> ACTGTATAGTTGCACATGACTCACAAGAACAATTAGGCACATCCATATTTTCGATTTCTT
> TCAGTCTCACGAGCAGGAGAGGCTTGAACCAGTTAACGCGTCTTGCACATACCGATTTAG
> AGCGGTAGTACCAATAACGCTTTGCAATCGCTAGTGATGGTTGTGGACTGTAGATATATG
> ATTTGTAAATTATCTTGTGACTTGTGTTATTCTTAGCTCATTGTATATTAGTCTAGTGTC
> GTTAACATTACGAATAGGGCTCTCGACGCGACCTAATAGTATAAGAAAGGCTCCACGCCT
> TAAGGCTGTTGTGGAAGAGAACATCAGTCTAGATCAGGTCATATAAACTCTTACTATCAC
> TATTTCGATAGATAAGTCTAAAATGCACTCCAATCTAATTCTTGATTATAGCTTATATAA
> AGGCTCGGGTTAGCTTAAGCCTGACATGTAATATGGAATTACACTGTCTATAACTGGTCA
> CCAGCAGTTGAGGTTTGAGATTTCGTGAACGTGACTTTAATAGCGTAGTGTGATCCTCTC
> TTAGGCTCGATCAGAATAATAGAGCTTTACTGTTCCGTGGAATACGATTGTGTTATGTAC
> GAGCATTACGTAACAAATCAAGTATTGTAGTTATTACTATGAATATTTTACCAGCATATG
> TAACGAAAAACGGGTGACCTGTTACTGACATGCAAGAGGGATTGCACACGAATCTAACAT
> CTGCAGAATTCTAGACAAAACGCCTTGATCAGCCTAAAGATTTAAAAGCGCTCCAACTTG
> TATGACTAGAGAATGGTAAAAATGCTCGGGGAACCTCTTGGAAATAGCTGACTATCACTA
> ACGAAGGGTGATGTTAATAATATAAGTTCAATAAATAACAACAACCATATTCACCGGAAA
> ATCATTAGATTCTTAGACAATTCGCAGAATCACATTCATGTGGGTTCTAATTCATAAGTA
> ATCGGATTAGTGCTATTATTCCCATGGCTGACGAGTCGTCACTTGCTATGCCATAATGGA
> AAAGGATTGAGAAGCTTCGAATAGTTCTGACTCAAAATCCGCACGGGGTTTTTCTGCAGT
> GACGCCATGCGAGATTGTACGGATGCTAACGAGGCATGATCGCTTACAGATGATGGCCGT
> AAACGATAGTCACCATGTAATGGTATTAGTGTAGCTCTATATGAGGGATAGCATGGTGTC
> CCTACTACGCCTTATAACAGGTATGCACGGCCGTATTCTGCGAAAGGTACTTATAACGTT
> TTGTCCTACAAAAGCTTCTCGGACTTCAGAGTTAGCTGTAGTACTGTGATACATAGTTTT
> ATAAACGTGAGTCCATTCGTCTAGCGGTTCTATTTCATCCTCAATGACCGAACTTCTCGT
> ACTCTTATTCTTGTTCTCCGAGGGATATAACCAGAGTCATAAAGTGAAGCATACAACACT
> ACACACTCCCTGTTCTCACTGATAAAAAGACAGCATTATAACGGCTAACACATACACCGA
> AAATATCAGACTAACTGCTACTCTCTAATAATTAGATAATACTCCCTTAATTCATTAATC
> ATATTTAGCGTTTCTGATGAAAGGCGCCATATTAGTCATTAGTGTCCGTAGTGAATTGCA
> CCGGAGCAGTCAACCGGAATATAAATATACATCGGTTATAGATCATGAGATTATTCATTG
> TTGATCTATATATATGAGAACGAACTAGAAAAACATCATATCACAACGGGTCTTTTTTGA
> TTGTCCATACCACGATACTACTATGATTTAATTGGATATTTGCATATCTAATGAAAGTAT
> CTGGTATAAAGTCGTACGCCGCTCTAACATTAGGCTGTAACAATTTTCGCTAACAAAATA
> GAAGACCCCTTGGAGAATAGTCCTACGTACATGCAATGTCCTCTATCCTCATTGGCGCAA
> GCATCATTAAGTGAGGGATTTACATACTTAGGAAAGCTTGTGAAATAATTAGACTTCACG
> CTGGATAAGAAGGCCTGATGCTATTTGTTCGTTGTACAGTTACGATGTGATGGCACCAAA
> AATTTCTCAGACTCGTGCAGCAAGACTTTTTACCGCAGACACCACCAGATGACGCGGTAG
> AGATATCCATACGCCGGATTCCAGTGAAGTATGAAAGAAATTCTTATCTACACTGACAAG
> AGTGATCCGACTTTAAGTTCCTTCCCACACTCACGCTTCGTGCACGTCCTTTGGAATAAA
> GTAACTTTACAACATAGATAAGGTGTGTTCTAAATTCAGCGACTTTATATACGTTATAGA
> CAAGCTTCGGCCGAAAACGGAGACTTCATCGGACTATTTTACTTGGATGATGACATTAGT
> TTCACTGAGAAAGTAGTTAGGACATCAGACCCAAAACACAAACATCTAATCTAATGGATG
> TTAAACAAATTCGGACACGAAAGAAAGTCACGCTCGCCCAGACTCATCCCACCCCCACGT
> TGGCAACAAAAGGCCTCTATCTACGCGTTCTAACTCTAGCTATGGTAGACCAACGCAAGC
> CGATCATTTTCTGACTTTACAACCCTATCTGTTTAATAGGATAGGTAATCAAAGTCGATA
> ACTAGAAGGAATTGTTCGATCCAGGTGGGATGTCGGCACTACAGAAAAAGACGATATGAG
> TCATCTTATCCACATCACTTGTCGCGAGAGTTAAGTTAGTCAATTAGCTCACACTATTTA
> TTACTTGTGGAGAATACCTTTATGTTCTACTTACTAACATTATTGCAGCCTTTGCTGTGT
> AGCTTAATAGTATATTAATATTAATTACCGCACTCTCCCGCTTTACTAAACACAAGTGCT
> AGTCACTTTTCTTGCTACAAAGCATCTCATACGATCGGTTAAAGCAGGATAGCTATTCAT
> ATCTTGCCAAGTTTCAGTTTTTAATCTTTATGGTTGACGAAAGCTGGATAATAGTTTCTT
> AACGACTGATTATATTCTATCTTAATGTTAGCACGAAATAACCTGAAGTCTATAAGTGAA
> TGTTGCAAATTGGGAAACGATCTTCGTTGCTCATTACGAATTTAAAATGTCGACCTATGA
> GATAGGACAGGACTCTATCATGTTAGGGTAGTAAGAATCATTATCTGTACCCTTCGGTGT
> AGGCCTGTATTAGTAGATCAATTCAACCGTTAAGGTTGCCACTAAAATCAGTTGCTAACT
> TAAAGGATGTTGTAAACTTTTTTTTGACGATTTCAAAATATCGTTTACTGTGTACGCCTC
> TACCTTTACTAGTGGTCTTAAATTACCCCCCGACTTAAGAACCCTAAGAATAACGTCATC
> TCTTACATCTACAAGCGTGACTGTAACTATTCCTATCGATACAATTGGTCGAAAATGTAG
> GAGAAATCCTCACAGCCCTTTGCTATCGACGATTAGGCTAGACCAGTATTGCTAATATCT
> TTAGCCCCTAAAATTCAACTTTTATGGACTATACGTATTATCGTTACTAGTCTATCCGTA
> GTGACCGATTATTTCACAGGTGTCTGGAATTATTATTACTCTGGTGTGACTTCTAGCGTT
> AGCAAGGAATCGGTAATAACCTGAATATCGATAAGATATTTATGCAAATCGACCACTTTT
> GTCGTATAGATACGCACTGTGAAGTGAGACTGCCAATTCTAGTTTTAAACTTCATGGGAT
> ATCGACTAGCGCCACGTTGGAATATGAAGCTGGTGAAAGACCGTTACTCTAATTTGCAGA
> TTAATGATCCAAGTTATATGTAATAGTTAAGTCCTTACAGGGAAAGTCTTTTCTTTTTGT
> CGGCGATCCATCCAAGCCTGGCTACTGTCCAATATGCGACATTAATGTATAACATGATAA
> GACGCTAGGAGCTAGAAGCAATAACATAGTGGCGGTCTATTAGCACCAGTTAAACCGCAG
> AGCTAGTTTACAGGGTCCTCTCGGAGATCTATACCGCATATAGATAATGGAAACCGATTA
> ATAATAACGATTCTATTCTTTGCATTCAACGAGACCTAAAGCTATCCGTTCATGTTTGTC
> TCGTCCATTGAGTGTCGGAAAAAGTAGAATAAGCCCCTTTTAGGTTAGGATCTTTGAGAA
> CTGGTTACCGACGTTCCTCTTGCGTACTAGAAACGTGCGGGTTTTAACAATGCCTATTTC
> TCTTTGATTTACACCATGTTCGCACCCCCTTGGGCAATCCTATTGTTTCGAATCGTTCTT
> ATATTAACAACTAGGGTTTTAGTAATTTCTTATTGCCTTGCCCCTACCGCTCACCCTTTA
> GGAAACGGATCTCTATACTGAGTTGCTGGTCTACAAGCGTATTAACGATTGTACATGGAA
> ATTCCAATCGTATCTCAATAAGTCTCTCCCTGTAACCCTTCCCTGCTTTGAAGAAATAGG
> AATGTAAGTCACAACTGCAAGTTTGAAGAAAGGCCGCTTAGTAGTAACCAAATCGGGTAC
> GTAGAATAAACGTATCCCCTGCGCAAGAGAGCCAGTCTTAATTAGCGCACGAGTCGCACA
> GGATCTACAAAAGAGCCGGATCAATAACTATAAGATGCCACGAGTTACCCAATATCATTG
> ATTACCTAGGAAAAGTTAGTCTCGTTGAGTGTCTGAATAGACGGAAGGAAGTCGTGTGTT
> GTAACATGCCTCGAGGACTTCAATTGGTATCCTTCGATACGCTCCCAGGGTACCGGGTTA
> TACAATTCAGACAACATGAGAATTAATATATCTTTAGTAAAAGTAAAAGGGTGGATTAGT
> AATTGTGGTGAATTTGGATAATGTTCCTCCTGCAGTTATACCATGTGATACGATTTACAC
> GAAACATCTCTGAGGTGTACCTATACTAAGCTTCTTTCTCTTGCAAAATACATAGAAAAG
> AAACAACACATTGTGAAGTGCGTTATTACCGAGAAAGTCACTTGTATATCAATAGAGGTA
> TTCCACACAGCGGACCAAAAATCATACATCTTGATGCAGCACCTCGTTACCATCTAGATA
> ACTCTGTTGCCTCGTTCCAGGATACTAGTGAATTTTAGTCCTATCTTTTCATTACCGCTA
> AGTGTTTCTATTTATTTTAAAATTTAAGGTCGGATACGGTCGATTAACTTTTTTTTGTTT
> GCTTCCTTGCCTATAATGAGGGGTGTGCTGTGAATGTGTGGTGCACATGAGGTAGGCGCA
> TTCCACCGCACCGACTTAAATTTCGTTTTTGTTAACGATAGTTTTGATTATTCCAACGTT
> ATAGACAACCCGATCCACCCTGACTACAACTCTACCATATGTCTTATTTTTAATTATAAT
> AATAACATAATGGAAGCAAGAACGCTACCAGTTAGTATAGCCTCCTGTTGTTCCCGCAAC
> CAACTAAAGTAAGCATTAACGAGTGCTTGCATCCCATGCTAAACCATATCACGTTCGTTT
> TCCCACGCCCGTAAATAAGATTTACCAGCCCTCAATGGTCGACAATACTAACATTTCAAT
> GTTAGTCCATTGATCACTTATTTTACTCCGCTTAGGCCCGTATATATATGGAGGTCGCTT
> TTCATAGATCCAGAACCCTACATTCCTTTAGTAGTAACTCGTCGACAGGAGTACGCTTAA
> GGTACCGCCACAAAAAGATCATCTTCTTACTTATTCATTTATCATGTAGAGGGCGAAATA
> TTACCCCCCCCGCCTCATGATCTTGCGCACACTTAACGACTATCCGCTAACAAACGTGTT
> ATTTGGATGTAAGCAAGTGCCAGTCAATGATATGACAGGTCCGCATAAAGAACCATCGAG
> ACGTCTTTTAGTTGGCGATAGACACTTAGTTAACTCGTACAGATGACAATAGTTCATTTG
> ACGCTACATTGACCCGAAATAGCCTATAAGGCACGACAAAGCGACTTGTAGAGTTCGTCG
> ATCCTACTCCCTCAGGACAATAAAACGGAATTACTTAGGATCTGCTGATGTGACCTACGC
> GGGCTCGTCTGGGGTGAGGGCTTCTTAAGCACATCGTACTTGTTCGCCGTACCTAGAGCC
> AGAATACACACGGTAGTTTAGTCAACATATAATTACCGATGTACCTGGTTTACGATGTGT
> CAATTTGGCGACAGATGCGGAATCGACAAGACCAACAATCTGTCTTGAAATTGTGAATGA
> TGTTTAGCACTTAAGGACCCATATTGGATAAAGCCTTAATTTGGTTTTAGAAGTGTCAGC
> ACATGCATACGCCACGACATAAAACATGCCCAGAGTACGACCTAGTTTCACTTTAGGTCA
> CAAAATTTGTTAGGAACCTGTTCAACCTGATCTTAATACGCAGTGTACGAATGCTCAGAC
> ATAACCAGATTTTCGGTAATCGGGATCTTAAACGACTTTAGCATAATTCTGTCAACATCG
> AGCGGTTACCCCATGGACCCAAACGGGTAAGTGCCGTTAGGCAGAGTAATAGTACATGTT
> ACCGATTTATTCAAACGTAATGCACCGAGTTTGGCACGAGCGCTCGAATGTTTATTGTCT
> CTTCGGTAAACCAAGCTAGTTATGACAGGCTTATCATTAATACGTAGGGGAGGTCCTATA
> TCTACCCAGCTGTTACCCGAATTTCCGCGAGATGTCCTATCCGGTCATGAAAATAACAGG
> TGTGTCGATTAGCACGGCCAAAAATTTGATGAGTCCTTTGACAAGCTTTTCGAAGAAAAA
> CGTCCACCTCCAGATATGAGCGGTTTCAGTGAATAATCCTTATTGATTGATAGCGATCGT
> GTCCGCTGAAGAGGTTCTGGGTACCTTGGAGTCTTCTAAAGTTATACTTACGAGAGATTT
> GACTTTCATGCAGTTCAACTGCAGTTGTCAATTCTTCCACCGGATAATTGCCGCCTACAA
> CGTCGTTACCAATAGGAACTATTATGTTCCAAGTGCCGTTAATTTACAGTTCTCGCAGAG
> ATATCCAGTTATATTGTCGGACAAATATAGGCAGCTAACAGCAAAGTAAGTTTGTTAATT
> AACGCTTGTAATGTGCAAAAATTATACTATGAAGTTGTCAATTTGGTTTTGTTTAAAGAA
> AAACCGAGACACTCCATTGCAATTCTCAGCGGATGTACGCAGTAATTTCCAGTGGAGGAG
> GCATTTGATGATCTATTACATTCAGGTTACCATCGCCTTAAAATCAACCGCAATCCCGCC
> CTCCGTGGATATGGCAGCATTTATTCGTCCATTGGGTGTGCCAACTACGTTCCCTACCCC
> TCGATTACCCTTTCCCCTGTCCCTTTACCCTCTGAGGTGTGATAGGGGACGTCAGGCGGT
> TCCTGCGATATTGACAGAACTCCCAGTGTATTAAAACAGAAATAACTTCAAATCTGTTCA
> TATACATATCAAGTGGTTTAAATTGATTACCATGTTTTTAAAGTCAAAAAGTGCACTCCT
> CACTTAATGAACGTGTCTGGTCCTCCCGTTAAGAAGTGTCGTTTCAATTTATGGAGACTG
> AATTAAGTCGTATAACTGTAATTTGCTCAACTCTCACTGTGCTTTGATCAAAAACCGTAA
> TTCTTTAAGTCGCTTACCCTCACACACCGCGATGGATTTGGAGTGCGTTACACCGCGATC
> TGCAATATATAACTATTCCTGCTATGGGGCAATTGGAAAGATCTCGTTCAATACTACACA
> AAGTAAGTTTGTTTTGCAAACTATTGAATGTCAAAACATCTTCATGTTATGATAGTCTCC
> ACAAGCCAGAAAAAGGGCTCTTAGTAAACTGCACTTTATTGAGTACGTAGCCTTTTGTTC
> CCGTCGACTCGATCTTTTATCATGTAAGAAATAATAAATTCAAGGTCCTTAGCGCATGGA
> ATGCGCCTTATGTTAGTTGAAAGGACTTAAAGTGGTATATCCTTAGATTAATAATGGTAG
> AAAGACGATATAGACTCCACGGTCCCAGTCGCTAGGCACTAGCATAACGGGCGCTATACG
> GTTATGTGTTCCCGGTGTTCGTGCAATCAAATTCCGCGTTATGTAAGAAAGAATTGAACC
> AATATTAATAGGGGCCGGTCTATTATGATTCATTCCTCGAGCCCTCACCTTGAGTATGCC
> TTCTAGGACAGAAGCATTCTGATATAAAAACAGGAGATATAAAATAATTAACAATGAGGT
> TTGAATCAAAATTATGTTCCTGTCAATAGCAGTGTCATTTCCTGGCAAATATCCATAGTT
> TAAGCCGTAAATCTTATTAAAAGAAGGGCTGGAATACAGGCCTCCAGATATAGATACAAA
> GTTTGTCCAAACCTTAGCGTGTCCAGTCGAAAGAATGAATTATGTTTGTCTAAATTTTCC
> TCCCTCTCGCAGACAAGATTGAGGTCTTTTGTTTGCACATACATGCCCCATACACGATGG
> GCTATCAAGATATGGTTAAGCTTTAATTCTGCGATCTTGTTTATCTGAATAGTTGGATGA
> ACGTGGACTACAGCAAAAGGAACGAGCGTGGTTCGCAGAGAACGACAGTATTTCGGGAGA
> TCGCAAAAAGTGCAGTTTAACCTATAACCCATATTGTGGGGCCTGAAGAATGTAGTCTAC
> ACGCCCCACTCTCTGCCTATTCTGTAATTCCTAACGATTTTCATGCAAGCCTCTCTAAGC
> TCCTACTTATATTGTTAACTTGAAAAATGAAAAGGACTCCTGTATTTTTCTGTTCTTACA
> GATATTGGAGTTCGCCTCCTCTTGCGTTTCTAGGTACCCAGTCCTACCAGATTACGTAAC
> GTGCTTGTCCCTTTTTCGTATAAGCTTAATAGATGACCCTAAAGATCGGCAACATCCGAT
> AAGTCGCTCCATTATGTCAGGTCAAAATTTGTTTAAGTATAAACGCAAGACAGCTTTATC
> ACCACATCACGACGCTACCAGTAGTCGAGCAACCATTGCTACCCGTAATGGAAGCAGTGT
> TTTGTCTTGTATAAAAAGGCTGATTTTTGTTACGATGGAGAAATGAAATTTAAGCGTTAG
> CCTCATTGATATGGAATTTTGTAAATGGGGTATTCAGATCATCAGGATAGTCTCCACAGT
> TAAGAGTTGATTAAGTAGCTATAGCTTATTCTATCTAGGAAAATCAGAGACACAATCTTC
> AGCGAATCTCACAATCATAATTGCCGTTTTCATACTGCTCTCTCCAATGAAACCTCCTTG
> GACTGCAGTACCCCCTGCGGTTGCTAACTTAATGAGGATTCTCCTTCTTGTTGCTAATAG
> CCAATATTATTGAAAAGTCATTTTTATATCCTCCTTCTTGTATTATGCACAAAATCGGCA
> CTACAATGGGTTATTGTCTACAGAGTACGATTATAACGATTTGTGCATCGCACCATCATT
> TGACCACCTCAAATAATCAACGGTCTTATAAGACCACCAACTCACTCTAATTTTTGAGAG
> GAAGTTGCTGAGGGTATGAATGTCAGCAAACCTTAAGTGTTGGGGAATCACTAACCTAGA
> CCAATCGCCTATATTGAAAAAAAATGTATGATAAGGACCCGCAGTCCAATTTGCCGCTGA
> GCATTACGAGGTGTTCGCCAACACTATGCTAGTAAAAGGATCCGATAAGAATTCATCATG
> TTTTCTAGTTATATGACCTTTCGAATAAAACGCATTGCCTGAATTCAGTATGTGTAGGCA
> ATATTTATCTTTTCACTTCCTACATTGGTCAGACCATTATTCGACACGTGGCGTCATTTT
> GTCATACCGGGTAATGTTGGAAACAAAACGTACTGATAAAATACTGAGTTGTAAACTCTA
> ATCAGATAACGCGCTTGGATATTAAGATTCACACAGGGGTTTCGGCTGTAAAAAAACTTG
> TGGAGCTGTTCTGGGACAGATAAGTTGTACCTCGTACTTAGCTAATTAATGAACCAACTG
> ATTACGATAGAACAATTCTGAGGCCGCCAGGACAGCCAAATTTTAATCTTATAAAGCTGG
> AAACAGCCGGTATTAGCTTCTCGCATACTTTGCCTGCATTGGTACCTTACAGATATCAGC
> GTAGTCATATACACCTCGGTCTCAGCTAAGCTTGTATCTCTTAGAGTAGTTCAAAGATAG
> TGGACAATACCTGTGGAATCGATTGCAGATATGGATTTATTTAACTACTGAGTCTCATTC
> ACAAGCTAAGCAAGGAGCACGTTTTGGTGCCGGCATACCGATTTGCTATCATGTCAGCAA
> ATTTGCGTTGTATTCCTAGTTGCACCCATTAAGGCCACACTCCGAACCTAATTATTACAT
> CGCAAAGACATGTACGAAGGACCCGATGTCGAATAGAAGGGAGGACTGTTCATTGGAAGC
> TAGACCAGAGGAATCGCAAAGATGCAACTCTTACAATAAAAATCTAATTTCAGTCAACAC
> GCAATTTCTATAAGGTTTCCGATAATAATGAACCGTCTTCCACAGGGGAATTTGCCATGC
> TCGTAAAAGTAGTTAATCCAAGTAGAAGAAATTTTGATAATGTTTTAAGTTGGCACGAAG
> GAATTCAGAGAGATCTTACCTAACAAAGGCATTAGTAGATGTTCCTTGGTTCACACTCGG
> TCAATCAGAGCACATACTACGGGCGATACCGGGAATGACACAACATCAATGAGATTGTTA
> AGTGAGGTAATTGACTTTAGAGGACTCGATCAGTATACTGTCACTATGAACATCGTATTA
> ATTGTTATCCGATATATACACCACCGATTTGCTTGTGCAAGGTTACAGACCCATTCGATA
> AATACAAACACGGAGCGATATTATTTAAGGAGTGCTGTCTTCAAAAGAATTATTCCCACA
> CCGACATAAGAACTTCGCTCCGTCATTCCAGATTTAAATAACATAACGTAACGCTTTGCT
> GATAACATAACATAACCGAGAATTTGCTTAGGAAATTTGGAGCAATATTGCATTGTTTCT
> CAGTCATCACAAGGCCCGCCAAAGAACTCTGAGAATCAGGATTCAACATGATTGGTAAGA
> CTCTATATATATAACTTAATTCTTGTGTCCGGAGATAGAAAGAGGACGAGAGATACTACG
> AAAGAAAGTGTACTTCGATGTATCAATTCAGACGCCTTCTCTATCATCAACATTATAGGT
> CTCGTATATGCTCGGCGCGATCTGCTTCTCTCCGCCAATAGCCCCATAGTGTATTTCAAG
> CGCAGTAACAGTGAAATCGTTACGAAGGTAGGGATGTTGCTTATAATTGTCGTAACTTAT
> CGCTTATGTATCTTTCAAGAATGAACGGCAGCATATACATACGTTCTACCTTTAGCTACA
> AAGCATCCATATACTCCCTCTCATGATTGAAACTCTTCCCTATTTTGTAGCCAATAGTGA
> AAGCGTATTAGTATAAATTCGTCGGTTTTTCACTCGCAACTGTTATACTCTGCAAACAAA
> CGAAAGCCTCATAGTACAAACCTAAAGCTACATACTTCATCATTGGCAGACCAGTGGCGG
> TATTTCTACGGAAGCATCACTATAGATATAAAGTTTCCCTTCATGTACGTCTGTTAACCA
> TATCACAAGAAACTGCTATCTCTGTCACGTAACAATTCACGCGCCTTATCGCCAAATGTT
> CATATATGCGCGGTATACGTATGAACGAATACTAATTAGTATAACGGAGGATTCACGGGA
> GGGATACTTGGGGCATTTATAAATCGTCTAAAAATTTTCTATCAGCACTTGCGGGTTATA
> GTGGATTACTAGGCAACATAATATTCTGTATTGGTCCAAATGACGCTATAGATAAATTAG
> CAAAATACATTGTTTCCATTTATGTAAGTCGAAACTCCAGGACTCCCGGGAACCAGTTAA
> ACCGTCTGGAAAAGACACATTGTGAGCGGGACTTCAATGATAGCTTTCAATGAGCTTCTC
> ATGCTTGGGGTCTGTACATATATGTTGGCGAAATTATCGTCTGTATTCTGTTATGCTTTG
> ATCATGGGTTATTAGTATAGTGTCCGGTTAAGTACCAATACCGCTAGAGACCCGACCTAA
> GTCGATAACTAACGATCATCGACGTAAGGATCGTCTCGATCAGTACTTCAGTCTAGATCT
> GGGAATAGTAACTCGTTAGTGAACTATGTCGTGTCATAACTCTAAAATGCAATCAAATCT
> TATTATTGAGTATTGATTATATAAAGCATCCGCTTAGCTTTACCCTCAAATGTTATATGC
> AATTTAAAGCGCTTGATATCGTCTACTCAAGTTCAGGTTTCACATGGCCGCAACGTGACG
> TTATTAGAGGTGGGTCATCATCTCTGAGGCTAGTGATGTTGAATACTCATTGAATGGGAA
> GTGGAATACCATGCTCGTAGGTAACAGCATGACCTATAAAATATACTATGGGTGTGTGGT
> AGATCAATATTGTTCAAGCATATCGTAACAATAACGGCTGAAATGTTACTGACATGAAAG
> AGGGAGTCCAAACCATTCTAACAGCTGATCAAGTCGTCTAAAAACGCCTGGTTCAGCCTT
> AAGAGTTATAAGCCAGACAAATTGTATCAATAGAGAATCCGTAAATTCCTCGGCCAACCT
> CTTGCAAAGACATCACTATCAATATACTACCGTGATCTTAATTAGTGAACTTATATAAAT
> ATCTACAACCAGATTCAACGGAAAAGCTTTAGTGGATTAGAAATTGCCAAGAATCACATT
> CATGTGGGTTCGAATGCTTTAGTAATACCATTTCGCCGAGTAGTCACTTCGCTGAACTGT
> CGTAAATTGCTATGACATAATCGAAAAGGATTGTCAAGAGTCGATTACTGCGGACTAATA
> ATCCCCACGGGGGTGGTCTCATGTCTCCCCAGGCGAGTGGGGACGGTTGATAAACACGCT
> GCATCGCGGACTGATGTTCCCAGTATTACATAGTCACATTGGATTGCGAGTAGTCTACCT
> ATTTATGAGCGAGAGATGCCTCTAACTACTTCGACTTTTAAAACCTTTCCACGCCAGTAT
> TCGGCGAAAGGGAAGTATTAAGGGTTGTCATAATTAAGCTGATACCACTTCAGACTTTGC
> TCTACTTCTGTCTTTCATTGGTTTAGTAAAGTCTGTCCATTCGTCGAGACCGTCTTTTGC
> AGCCTCATTCTACCAACTGCTCCGACTCTTAGTCTGCTTCTCCCAGCGTTATAACAAGAG
> GCATTTTGTCATCCTTAAAACAATAATAAAGAACTCGGAGCACTGATATAATGACTGAAT
> TAGAACCGCTTAAAAATACAACGAATAGATAAGACTATCGGATAAGATCTAATATGTAGT
> GATTAAGCCCTTTATTAATTAATAATAGTTACCCTTTCTGATGTAACGCGACATATTACG
> ATTTAGTGGCACGTCTGAATTGCAAAGCAGATCTCTACCCGATTTTTATTATAAATCCCG
> TATACATCTTGACTTGAGTAATTGTTCATCTTTTTATATCTCTTCGTACTACAAATAATT
> AATATCTCAACCCGTATTGTGTGATTCTAATTACCAACAGAATACGAGGAGGTTTTTGCT
> TAGGGCCATATATAATGAATCTATCTCGTTTATTCGCGGAACCCGAGATAACATTACGAT
> GTAACTATTTTAGAGAACTTAATACAAGAAACATTGCTGATTACTCATAACTAAATGCTT
> GGTAATATATCCTCAGTGCCCCTACCATCTTTTACGCAGGGATGTAATTACTTAGGATTC
> ATTGTGTAAGAATTACAATGAACGATGGATATGAAGGCATGTTGCGAGGTGTTCCTTGGT
> ATGTGAAGTTCGCAGGGCAACAAAAATTTCGCAGAATAGGCCTCAAAGTATTGGTAAAGA
> AGACAACTAATCATCACGAGCTTCTGATATCAATACGAACGAGTCCTGTGATGGATGAAA
> GAAAGTCGTATCGAAAATGTCAAGAGTCTGCCCAATGTAACTTACTTCAAAAAATAACGC
> TTCCGCCAAGTACGTTCGAATAAACGTAATTTTAAAAATACATAAGGGGTGTTAGAAAGT
> AAGCGACGGGATATAAGTTAGACTCAAGATTCCGCCGTAAAACGAGACTGATTCCGAAGA
> TTGTTCGTGGATCTGGTCATGACTTTCACTGAGTAAGGAGTTTCGACATATGTCAATAAA
> CACAAAAATAGAAGCTATTCGATCTGAAAAATATTAGGACAAGAAACTATCTCACGCTAG
> CCCAGAATATTCACTCACCCACGGGCGATACTAAAGCACTATATAGTCGCGTGATTACTA
> TACATATGGTACACATAAGAATCACGATCAGGTTCTCAATTTTCAACAATATATGTTTAT
> TTGCATAGGTAATATTAGGCCTTTAAGAGAAGGATGGGTGAGATACTCCGGGGATGGCGG
> CAATAAAGAAAAACACGATATGAGTAATAGGATCCTAATATCTTGGCGAGAGACTTAAGG
> TACGAATTTTGCGCAATCTATTTTTTACTTGGCCAGAATTCATGTATGGTATAAGTACGA
> ACTTTTTTGATCACTTTCATGGCTACCTGATTAGGATAGTTTGAGGAATTTCCCAAATAT
> ACCGATTTAATATACACTAGGGCTTGTCACTTTGAGTCAGAAAAAGAATATAATTACTTA
> GGGTAATGCTGCATACATATTCTTATATTGCAAAGGTTCTCTGGGTAATCTTGAGCCTTC
> ACGATACCTGGTGAAGTGTTTAGTAACGAATCATTAGATTAGATCTGATTCTGTGCAAGA
> AATATCCTCAACTATTTAACTCAATGTGGCTAATTGCCATTCGATATTCGTTGCTAAGGA
> CGAATGTTTTATCTCGAAATTTGTCAGACGACACGTCTATATAATGGTTGCGGAGGAAGA
> ATCAGGTGATGGTCCCTTACCTCTACCACTCTATTACTAGAGCAATTAAAACGTTAAGCT
> TGCCAATATAATAAGGTCATAACTTTATGGTTGTTGTTAACTTGTTTGGCTAGATTTAAA
> TATATAGTTTAAGGTCGAACCCGCGACCGTTACTACTGCTCTTAAATTTCCCAACCTATT
> ATCATCCCTTAGAATTACGGCATCTCTTTCTGCTAAAAGCCTCAAGGGATATTGTCCTTG
> AGATACAAGTGGTCGAAAATGTAGCAGAATTAATATAACAAATTTCCTTTCGAACTTTAC
> CATTCAACACTATGGCGAAGTGCTGGACCCAATAAAATTCAAATTGGATGGTCTATTCGT
> TGTTTAGTTTCTACGCTATCCCGTGTCAAACATGTTTTCACAGCGCTATCGTTTTATTTT
> TAATCTCGGCGCAATGATACCCGGAGAAAGGAAGCCCGTAGATCATGAATATCGAGTAGT
> TTTTGATCCAAATCCAAAACTTGGGTACGAGACATAAGCTCGGTGATCGCTCACGGACTA
> GTCTACTGTTAAACTTAATGGGATAGACACTAGCCCAAAGTTCCAATAGCTACATGCGCA
> AAGTAAGGTTAGCGATTTTGCTGTGTAATCAGACAAGTGATATGTAATACTTATGTCAGG
> AAACCCAATGTAGGGGCTGGTTCGCCGCCTTCCATACTACACTGGCTACTGTAAAATATG
> AGACATTAAGCTATTAAATCAGATGACGCTAGGAGCGACATGCATGAAAAGAGTGCCGGG
> ATATTAGCACCTGGTAAACAGAACACATAGTTGTAAGGGTAAGCTCCGAGTTCGTGACAG
> CATATTGATTAGCGAAACAGATTTAGAATAAACAGGATATGCTTTCCATTCAACCTGTCA
> TTATGCTATCAGTTCATGTTTGGATAGGAAAGTGACTCTCGGAATAACTAGAATATGAAC
> CTTTTACGTTAGGAGATGTCTCAACGGGTTAAACACCTTCCTCGTCAGTAATAGATTCCT
> CCGGGTTTTAAAATGGAATTTTTCTCTTTCATTTTAACCAGGTGAGCACACCCTGCCGCA
> ATACGAGGGTGGCCAATACTGCTTATAGTAAAATATACGGTTGTACGTATGTCTTTTTCC
> CGGCAAAAGTCCGCTAACAAGGTAGCAAACCCATCTAGATACTCACGTGCTGGTCTACAA
> CAGTAGTAACGAGTCTACATCCAAATTCAAATCGTATCTAATTATCTCGCGCCATGGATA
> CAGTAACTGCGTTGTAGAAATACGAATCTAACTATCATCGCCAAGTGGCAAGAAAGCCAG
> ATTACTTGTAACCTAATAGGGGTAGTTGTAGAAAACTATACACTGAGAAAGACACCCACT
> ATTATTTTGCCAACCACTCCCAATGGTTCTTAAAAAGTCAAGCATATTTTACTATAAGAG
> GAATCCTCTTACCCATTAGAATGGATTACATAGCAAAACGTAGTATCGGTGACGCTATGT
> ATAGACGCATGGAAGTACGCGGTGGTTTCATCCAGCCTGGACTTCAATGCGTTTCCTTCG
> ATAAGAGCACAGCCTACACGGGTATACATTGCAGACAACATCACAAGTTATATATCGTTA
> GTAAATCGATAAGGCGCCATTACTAATTCTGGGGAATTTGGTTAATCTTACGCCGCCTCG
> TATACAATGTCAGTCGATTTTCTACAAACATATAGCTCGTCTTCAGATACTAAGATGCTG
> GCTCGTCAAAAAGAAATACATATCTAACAAAAATGTCTCTACGGCGTGTTTTCAGACAAT
> CTAACGTCTATATCTATTCAGGTATTACACACTGCCGTCATATAATAATACTTCTTGATC
> AAGCACCTAGTTAAAAGCGTCTTAAAGCTGGGCAATAGTTCAACCAGTATACGGTTGTGT
> ACTAATATATTTTATTTACCGCGAAGTCTGTATATGTTTGTTAATAGTTATGCTACGATA
> AGGTAGATGAAATTTGGTGTGTGTGATTCAGTCCATATATTCAGGGGTGGGATGTGAATG
> TGGCCTGCAATGGACGTAGCAGAATTCCTACGCACACACTTAAATGTACTTTTTGGTAAC
> GATACTGTGCATTTTGCAAACGTTTGTCACAACACGTTCAACCATCTCGTCAACTCTAAA
> TTAGGTAGTTTGTGTAAGTTTAAGAAGAACTTAATGGAAGCATGAACGAGACATGTTACT
> AGTGCATCCTGTTGTTCAAGAAACCTAAGAAAGTAAGCAGTAAACTGTCCGTGCATCCAA
> TCATAAACATTAGAAACTTCCGTTTAAATACCAAGTAAATAAGTTTTTCCTCCAATCTAT
> GCTCGACAATAAGAAAATTTAAATGTTAGTAAATTCTTATCTTATTTGTATCCGCTGTGC
> AACGTATATAGATGGACCTACCTTTGCATAGATCAAGATCCATACATGCCTTTACGTCTA
> AATCGGCGACACCACTACCATGAACGTACCGACAAATAAACATAATATTCTTACGGATGC
> ATTTATAAGCTACACCGAGATAGATTAACACCACCGACGAATGATATTCCGCTCACTGAA
> CCACTAGACCCTTACAATCCTGTGATGTGCAGCTAACCATGTGCCAGGAAAGGTTATGAA
> AGGTCCGAAGAAACAACATGAGAGAAGTATGTGTGTTGCCCAGAGTATCTTTGTTAACGC
> CGTCAGATCAAAAGACGTCATTTGACCATACTGTGTCCACAAATAGACTATAACGCAACA
> CAAACACTAGGCTACACGTAGTCGAGACTTCTAACGAAGCACAAGATTTAGCTATTTCTG
> AGGATCGGCTCTGCTCACAGTACAGGGATCGTAGCGGGTCTGGCATTAGTATCAAAATAC
> TACGTGTTCCACGTACCTTGAGCCAGAATAAACAAGCTAGTGGACTCAACATTTTTTTAC
> ACATGGAACTCGTTTACGAGCTGTAAATTTGGCGAATGATCAGGAATCGACATCTCAAAA
> TTTCTGGCTTCAATTGGGGATTGATCTTTACCTATGAAGGAACCATTTTCGTTAATGACT
> TAATTTCCGTTTTGAAGTGGCAGCAAATCAATAACCCTAGACATATTACAGCAACAGAGT
> AAGAACTAGTTTCACTGTAGGGCAATAAAGGTGGGACGTAACTGTTCAACAGCATCTTTA
> TTAGCTGTCTACCTATCAGAACAAATAACAACTGTTTACCGATTACGGTGATTATAAGAC
> TGTTGATTAATGATCTAATATGCGAGACGGTAACACAGGCTACAATAACCCTAAGTGCCC
> TGAGCAAGAGTATTAGGAATTCGTACACATGGATGATATCGGAATCCTCACACTTTGCCA
> CGTGCGAGCGATGGGGTAGTGTAGCTTAGCTAAAACATGATAGTGATGACAGCATTATCA
> TTTTTACCTACGCGACGGACTATTTCGTACCAGAGGTTAACCGAATTGCCCAGAGATGTC
> AGATACGGTCATCAAAATATCACGTCTGGACTTGAGAAACCAAAATTAGGTCATCAGTCC
> TTTCACTAGCTGTTCGTAGAAATACCGCATACGACACATTGCTGAGGTTGCAGGCAATAA
> GCATGTGTGAGTGTTTCCCATAGGGTACCATCAAGACGTTCTGGCGAAATGGGAGTAGTC
> TAAAGGTATTATTAACAGAGAGTGCACGTTATGCCACTTCTACTCCACTGGGAAATTATT
> ACTAACCATTTGTGAAGACTTCATAGTCGGGAACTAGACGTTAGATTAGGTGACTACTGC
> CGTGAATTGACAGTTCTCGCACACATAGACACTTATTTTCTCGGTCTATTAGAGCATGCT
> AACAGATATGTTACGTTGTGAATTTAAGCTTCTATTGTCATAATATTATACTTGGTACTG
> GGCTATTTCCTTGTCTGGAAACAAAAAACGTCACAAGCAATTCCAATTCTCAGACCTTCT
> TCGAACTAATGTCAAGTGGAGGAGGAATGGCTGGAGCTTTTACATTCAGCTGAAAATCGA
> ATTATATTCTTAACAATTCCCCCCCTCCGTCCATATGGCTGAATTTATTACTACTTTGGG
> TCTGCAATATAACGTCCCGTCCCATCGATTACAATGGAACAGGGCCAGTTACCCTCGCTG
> CGGTGATAGGGGACGTCTCGACGTTCCTGAGATAGTGACACAAATCCCAGGGTATGAAAA
> CTGTTATTTAGTCTAAGATGTGCATATACATATCTACTGGGGGATTTTGTTGAAAATGGT
> TTGAAACGAATTAACTGAACTAATCAAGTAATGAAAGTCGATGCTCATCCAGGGATGATC
> TGTAGTGTCATGTTATCGACAAGCATTTTAGGAGTATAACGCGTTGTTGATCTACTCTCT
> CTCGGAGGTCTGAAAATTACCTAATTAGGGAAGGACATTACCATATAAAAACCCCTTGCA
> TTGCGTGTGACTTTAACCCCGATCTCAAATATATAAATTTTACTCCTAGCCGGAATTGGG
> ATAGATCTCGTTAAAGACTTATCAAAGGAACTTTGGTTTGCTAACTTGTGAATCTCTAAA
> AAGAGGCTTGTGATGATTGGCTAATAAAGCCTGTAATAGCGATCTTAGTTAACTCCAATT
> GATGGAGTAACTACCAGGGTGGTAACCGAGTCTCCATCGTTTATCATGTATGAAAGAAGT
> ATTTCATGGTCCGTACCCCAGGGAATGCGAAGTATCTTTGGGGTAAGGACTGATACTGCG
> ATTTCCTTAGATTTATAATGCTTGTAACTCCATAGTGACTCCAACGGACAAGTCCCTTGG
> CACTAGCATATACGGCGATTTACCGTTTTGGCTTCCCCGTCTTAGTGCAAGCAAATTCCG
> AGGTAGCTTACATTGAATTGAACCAATATGTTTAGCGCACCGTATATTAGCATGCATTCA
> TAGAGACAGCACCGTCACTATGAATGCTTGCAAAGATGCTTGCTCAGATAAATAATCGTG
> ATATAAAAGAATTAAAAATGAGGTGTGAATAAAATTTAGGGTCATCTCATGAGATGGGGC
> AGTTCCTGGAAAATATCAATACGTTTAGCCGTAATTATTATTAAATCAAGGGCGCCAATA
> CACGCCTACACATATTGATAAAAAGGTTCTCCTAACAGGAGACTGTAATGGCGATACTTT
> GTTTTATGTTTGTCTAAATTTTACTACATATCGCTGACTACATTCTGGTATTTGGTTGCC
> TAATAAATCAAAAATAAACCATGCGCGTGAAAGTTATCGTTAAGCTTTTATTATCAGATA
> TGCGTGTTCTGTATTCGTGGATCAAACTGGACTTATGAATAACGAACGAGAGTCGTGCCC
> TGAGAACGACTCTATTGAGGGACAGCCAATAAACGGAAGTTGAAACTTGAAACCATTGTG
> GCGGGCCTGAAGAATGGTCTATACAAGACCCACGCTATGCAGAGTCGGGAATTACGATCG
> ATTTGAATGAAACCCTATAGAACCGCCTACTTAGTGGCTTAACTGCAAAAAGCTATAGGA
> ATCATCTATTTGTCTCTGATGACACATATTCCACTTCGCAGCCTAGTGCCTGGAGACCTA
> AAAACTCATTAAAGATGACGTTTCGTGCTGGGACCTGGTTCGTAGTAGAGTTTTAGATCA
> CCATAAACTTACGCATCATCAGTTAACGCCATCAAGGATGGAACCGCTAAAGTGCTTGAA
> CGTTATACGAAACAATCCTGTAGCAAATAAGCACGACCCGACCAGTACTCGTCCAAAAAT
> TGATTCCACGAATGGTAGATCTGTTTTCGATTCTTTTAAATGGAGCTTTTTTGTTAAGAT
> CGTGAAAGGATAGTTAAGCGTTAGCATCATTCTTTTGCTATGTTGTATTTGGGGTAGTCA
> GATCTGAAGGTTAGTCGAAACAGTTAAGACGTCATTATGTAGCTATAGCTGATGAGATAG
> ACCAAAATAAGACAATAAATCTGAACACAATCTAAAAATCATATTTCCACTGTTAAGACT
> CATAGATCCAATGTTACCTCCTGGGACTCAAGTAAAAACGCCCGTTGAGAACTTTTTGAG
> CTTGCGCATGCGTGGGCCGAATAGACAAGAGTATGGTTAAGTAATTTTGTTAGACTCCTT
> CTTGGATTAGGCTAATTAGCGCCAAGAAAAGGCGTTAGGCTATAAAGAGTACGAGTAGAA
> CGATTGGGCAATCGATAAATATTTGCACCAAATCATTGTAGATACGCGATTTTATCACCA
> CCTTCTCAATCTAATTTGTGACACGAAGTTCCTCAGGGGAGGAAGGTCTGCAAACCTTTA
> GTGTTCGGCTATCTATAAACTAGTACTTTACCATAGATTCATATTAAATGTTTGATAACC
> ACCCCCAGTACAATTTGCAGCTGAGCATTTCGAGGTGGTCCCATACTCTATGCGTCGAAA
> ACCATAACTGTACATTTAAGATGGTGGTCTAGTTATAGGTACGGTCGAATATAACGCAGG
> GCCTGTATTAAGGAGCTCGTCGCAAGAGTGAGCTTGTCACTTCCTACATTGCGCAGAACA
> TTATTAGTAACGGGGCGTAAGGTTCTCTTACCGGGTTATGTGGGATTAATTTCCTACGGA
> TTAATTTCTCAGTGCTAAAAGCTTAGAACATAAAGCCCTTCCAGATTAACATTAAAACTC
> GCCTTGCGGCTGTTAAATTAATGGTCCAGCTCGTATGGGAAAGATAAGTTGTACCTACTT
> CTTAGCTTTTTAATGTACAAAATGATTAAGATAGAAAAAGTAGGAGGCCCCAAGCACAGC
> AATAGTGTAATCTTATAATCAGGGAAAAAGCCCCGATGACATGATCGCTTACTGTGACTC
> CATTGGGTCCTTTCTCAGATAAGAGTAGTAATAGACACATACGGATCAGATAACAGTCTA
> TATATGACTGTAGTTCAAAGTTAGTCGACATGACATGTGGAAGAGTGTCCAGATATGCAT
> GTATTTATCTTCTGACTATAATTATAAACCTAAGAATCGAGATCGTTTTGGTGCCCGCAT
> ACACTTTTCAGATATTCGAAGCTAATTTGCGTTCGAGGACTAGGTGAACAAAGTAACCCC
> AAACTAAGAACATAAGTATTTCATCGCATAGAAATCGTACATGCAACCGTTGTAGAAGAG
> TACGGAGGTAGGTTAATGCGATGCTTGAAATGTGCAATCGCAAAGATCCTAATATTAAAA
> GAAATATATATTTTAACTATACTAGCTTTGTCTAGTAGCTTTCAGAGATTTATGTTCACT
> CTGAATCACCGGTATTTCCCAGGCTAGTAAAAGGACGTAATACAACGACATGATATGTTG
> ATAATGTGTGATGTGGGCACCTTGGAATGCACACAGAGCTTTACTAAATTTGGCATTTGT
> ACAGCGTACTTGCTGATAACGCGGTCAATATCAGAAATTACTACGGGCCATACCGCGTAG
> CACAATACATAAATGTGTTGGTGAAGTGTCGTAATGGTCTTGACAGCAATACTTAAGTTT
> AATGTCACTTTGAAATTACTTTTAATTGGTATCACATAGATAAAAAACCCATTGCCTGGT
> CCAACCGTAAAGACCAATTAGAGAAATAATTACACCCTGAGATATTATTTTTGCACTGCG
> CTATTAAATTGTTTGTTGCCAAAAACCAATTTTGAACTTAGCGCCCTCTTTACACAGTGA
> AATTACAGAACCTAAAGCTTTGCTGATAACATTTAAGAAACGAGTATTTGATTAGCTAAT
> TTGCAGCTATATGCAATTGTTTATAACTATTAACATCGCCAGAAAAAGATAGCTGACAAT
> CACGTGTCAACTTCTTGGGTAACACGAGAGAGATATTACGTAATTCTTGGGTCCGCTCTT
> AGAAACACCACGAGACTGAAGACGTATGAATCTGTAATTCCATGTATATATTATGACGAA
> TTAGATAGCAGCAACTTTATACCTATCGTAGATGCTCGCCGCGATATGCTTAGATAACCA
> ATTAGCAACAGACGGGATTGATAGAGAAGGATATGGGAATGCCTGAAGATCCTACCGATG
> TGGCTTATAATTGGCGTAACTTTTAGCTTATGTTGCTTGAAAGTTTCTAAGGATCATTTT
> TAATTAGTTCTACCTGGAGCGTAAAAGATGCCTGATAATACATCTATTCAGGCAATATAT
> TCCCTATGTTGGACACAATAGTGAAACAGTATTAGTTGAATGTAGTACCTGTTTAAATAG
> CAACTGTTATTCTATCATATAAAACGTATCCATCATAGTAAAAACCGTAACCTAATTAAG
> TCATATTGCCCAGAAATGTGCCGCTATTGCTAAGGATCAATCAATATACAGATTAAGTTT
> CAATGCAGGGACGTATGGTAACCATATCAAAACTAACTCATATCTATGGAAACTAAAAAT
> TCAACCCAAGGATCGCCTAATCTGCATAGTTCCGAGCTATACCGTTCATCGTTGTATAAG
> GACGATATCCGAGGATTCAAGGCAGCCATACGTCCGGAAGTTATATATACTCTAAATTTT
> TTATTGCACAAATGCAGCGGTTTAGGGCATTACTAGGCTACTTTAGTTTATCGAGTCGTC
> CAAAGCACGATATAGATATTTGACCATATGAAAGTGGGGCCTTTTATGTATCGCGAAACT
> CAACCACTCCAGGCAAAAACTTTTACCCGCTGCATATGTAACATGGTGAGCCCGACGTAA
> ATGTTACAGTTCAATGAGCTTCTCATCCTTCGCGTCGGGACTTATTGCTTGGCGAATTTA
> GAGTCTCTATGCTCGGAGGATTTCATAATGCGTGAGTTCTAGACTCGACGGTTAAGGACC
> TTTACCCCTAGACTACACACATTAGTCGAGTACTTACCAGAATACAAGGAACGATCGGCT
> CCATCTCTAATTCACTCTTCATATCCGATTTGTAAAGAGTTAGTGATATTGGGAGTGTCA
> TAACTATATATTGAAAGCAAATATTATTATGCTGTATTCAGGATAGAATCCAGCCGCTTA
> CCTGTTCCATCAATTGTTTGTTCCTTGGTAAAGCGAGTGTTAGCCGATAATCAACTTCAC
> CGTTCTCAGGGCCGCTAACGGTAGTTTTTACACGTGGGTCAGAAGATAGGTCCATACTGA
> TCTTGTTTACTCAGGGTAGGGGAACTGCAATTCCAGGCTCGTAGCGAACTCCAGGACCTT
> TATATTATACTATGCGTGTGTGGTAGAGCTATTTTGTTAAACAAGTTCGTAACATTATAC
> CCGCTAATGTTAATCTCTTCAATGTGGCAGTCATATCCATTCTATAAGCTGATCTAGTCG
> TCTATTAAAGCATGCTTCACACGTTACAGGGTTATGCCAGAATTAGGGTATCTATAGTCA
> AGCCGTTTATTCCGCCGCCATAAGATTCCTAAGACATCACTTTAAATATACTACCCGCAG
> CGTAAGTAGTGAACTTATATAAAGATATTCTAAAAGTTTATAACCAATTGATTTAGTGGA
> GTACTAATTGCCAAGAAGATATGTCTGCGCGCGGCGTTTGATTTACTATGACCTTTTCGC
> AGTGTAGGAAATTCCATCTACTCGACTATATTCCGTTCACAGAATCCAATTCCTTGCTCA
> ACAGTCCTTTTCTGAGGAAGAATATTCACAACGCCCGTGGTCGCATGGCTACACTGCACA
> CTGGCGTACGTGGATATACACCATGCATAGAGGAATCATGTTCCAACTATTACTGTGGAT
> AATTCGATGCCGAGTTCTCTTCATATTTAGGAGCCTGACATGCCGCGAACTTAGTCGAAT
> TTTATATCCGTTCCAACCCACTAGTAGGCCAATCCGTAGTAGTTAGGGTTCTCATAATTA
> ACAGGAGACCTATTAACTCTTTCATCTTCTTATCTCTTTCATTCGTGTAGTTTACTCTGT
> AATGTACGCGTGACCGTAGTTTGATGACTCATTCTAACATAGGATACGAATCTGAGTCGG
> CTGATCACACCGTGTTTTAAACTGGATGTTTGGCATCATTTAAACAATAATATAGAAATC
> GGAGAACGCAGTTTTTCTCTCAATTTGAAACCAGTAAAAATACAAACTTTTGAGATCTCT
> ATAGGATAAGAGATAAGTTGTACTGTTTAAGCAATGTATGAAGTAAGATTTGGTTCACGT
> TCGCAGGTAACCAGAAATATTACGATGGTGGCGAACGTCTCTAGTCAAAACCACATCGCT
> TAACCATGTGTTTGTGAAAGACCGGAGACTTATTCACTTGAGGATGTCTGCATCTTTTGA
> TATCTCTTCCTAAGACATTTAATTATTATCTAATACCCTAGGGTGTGATTCTAATTTAAA
> ACTGAAGTAGTGGTGGGTTTTGCTTTGGGCCTTTTAGAAGCTTTCTTGATCCTTGATTCG
> ACGAACAACAGATTAAAGTTCCAGGGTTATAGTTGACAGAACTTATGACATCAAAAATGC
> CTGATTTCGAAGAACGAATGCATTGCTAAGATTGAATATGTCCCCATACAATCTGTTACG
> CTCGCTGGGAATGTATTACCTTTCAGGCTCTTAGAAGTACAATGATACATCCAGATCTAG
> CAAGCTGCAGTGGTCTTCCTGCGTATGTGAAGTGCGCAGCCATAAAATTATTTCGATGAA
> TACGCCTCATAGTATTGGTAAACATCAAAAATAATCTTCTCGACCTTCTCTGTGAATTAC
> CAACCTGTACTCTCATGGTTCATACTAAGTAGGATCGAATAGCTAAACTCTCTGCACAAG
> GGTACGTAATTAAAAAAATAACCCTGACGCATACTAAGTGCCTTTAAACGTTAGTTTAAA
> AAGTCATTTCCGCTCTGAGTAAGTAAGAGTCGGGATATTACTTAGACTAAACATTACCAA
> CTAAAACGAGAAGGATTACCAAGAGTGTTAGTCCATCTGCTCATGACGGGAAAGCACTTA
> GGTCTGTCGTAATATCTCAATATAATATATATTAGATGATTTTCCAGCTGATAATTATTA
> CGACAACATTCTTTCTCAACATACAAAAGTATATTCAATAAAACTCCGGCCATAATTTTC
> CAATAGATAGTACACTGAGTTATAGACATTTCGGACAAATAACAATCAACATAAGGTGAG
> CAATTTTATAAAAGTGAGCTTTTTGTCCATAGGTTAGATTAGGACTTTTAGTGTTCCATG
> GCTGACATAATCCGGGGATGGCCCAAATAAACAATAACTACTGAGCAGTATTAGGTTCCT
> AAGATCGGCGAGACAGTCTTAACGGTCGATTGTTCAGATATCTATGTTTTTCTGCGCCAG
> AAGTAATGGTTGGTATAAGTTAGATATTTTTGGATCACTTGCATCGCGACCTGTTGACGA
> GAGGTTGTGGTATTTAACAAATAGAACCAGTTAATATAAAATTCGCAGTGTAACTTTGAG
> TCAGAAAATCATTATATTTACTTAGCGTAATGATCCATACAGAGTATTAGATTCCAATCG
> TGCTCTGGGTTATCGGGTGCCGTCAACTTACCTGCTGATGTCTTTAGGAAAGAAGCTGTT
> GAGGAGTTAGGATGCTGTGATAGATAGTTAAGCAACGATTGAACGCTATCTGCATTTTGC
> CCATTACAGAGGAGTTCCTATGGAACATGGTTTTAGCTACAAATTTCTCAGACCAAACCT
> ATATAGAATCGTTCCGGTCGATCTATCAGGTGATCGTAAAGTACCTCTTCCAAGCTTTGT
> CTTGTGAAAGTATTAACGTTTCCTGGACAATATTATATCGGCATTAAGGTATCCTTCTGG
> TTAAAGTGGTTGGCTACAGTGAAATATTTAGTTGAAGCTCGTACAAGAGAACGTGTCTTC
> GCCGATTAAATTTACAAAACTAGTATCATAACTTAGAATTTACGAATATATGTATGAGTA
> ATCACGCTAGGGTTAGTGTAAGTGACAGTAAAGTGGTACAATATGTAGCTCTATTAATAT
> ATCAAATGTCATTTCCAACTGGTCCAGTCAACTCTTGGCAGTAGTGATGGACAAAATTAA
> TTGCTAAGGGGTTGCTAGTGTACTTGTTGAGGGTCGACGCTTTAACGTCGCAAACTTGTG
> GTATCACCGCTATCCTTTTATGTGGTATAGCGGCGCAAGGATTCACGGAGAAACCAAGCC
> CGTAGTTAATCAATTGACTGTTCTTTTGGAGCCTTTGCCTAATATTGGGGACGTGTCAGA
> ACATAGCTCTTCGCTCTAGGAATAGTAGACGGTTAAACGGATTGCGATTGACTATTGACC
> AAACTGCCAAGAGCTACAGCCGCTTACTAACGTTAGCGATTTGCATCTGGATTCAGAATA
> CTGTGTTCTAAGACTTTTCTCAGGAAACCCATTCTAGGGGAGGGTTCGCCCACTTAAATA
> ATACACGGCATAATCTAAATTATCAGTCATTAAGCGTTTTAATCTGATCAAGAGTCCTCA
> GTCTTCATTGAAATGACTCCCCCGAGTTGTCAACATCGTATAAACAACTCATTCGGGTAA
> CCCGAAGAGACCTCTTAGTGTCAGCTGTGTCATTAGCCTATAACATTTAGTATAAACAGG
> ATATGATTTCATTGAATACTCTAAGTTTGCTAGAAGGTAATGGTGCGATAGGAAAGGCAC
> TCTACCTATAACGACTAGATCAAAATGGGTCCTGTCGAGAGGTCTCAAAGGCGTAAACTC
> CTGACGAGTCACTAAGAGATTCCGCACCGGGTTATAATGCAAGTGGGCGCTTTCAGTTTA
> AAATGCTGACAAAACACGGCCCAAATACGAGGCTGGACTATACGGCGTTTAGGTAAATAT
> TCCCGTGTACGTATGTATGTTTCAAGGCAAAAGTAACAGATAAAGGTACCAAAACCTTAT
> AGATTATCACGGGCTCCGCTTAAACACTTGTATACAGTCTTAATCCATAGTAATAGACTT
> TATAATGTTCTCGAGCAATCGATAAAGGAAAGCAGTTGTACAAATACCATTCGTACGATA
> TTCGCAATCGGGCATCAAACCAACATTACGTCGTAAATTATACCCGTAGTTCTTGATAAC
> TTGAAAATGACAAACACACAAACGAGGATTTTCCCAAACTCGACAAATCGTTATTAAAAA
> CTCAACCTTATTTTAAGTTATCAGCAATCCTCGGACAATTGAGAAGGCAGGAAATAGCAA
> TACGGTCTATACGTCACGCGAGCTTGAGAACCTTCGTACTACGCGCGGCGTTATTCAAGA
> CTCCAAGTATTTGCCGTGCATGACTTAACAGAAATCCCGAAACCCGTATTCATTGATCAC
> TTAATCACTTGGTATAGTGCGTTACGATATCGATAAGCCGCCATGACGTTTTCGGCGCTA
> TGTCCTTAATCGGAAGAAGCATCGGATTAATTCTCTGTACATGTTATACAAAAAGATAGC
> TCCGCGTAAGTTTAGATCATGAGGGATAGTCAAAAAGTATTTCATTTCTTTAAAATATGT
> CGCTACGCCGTGTTTTAACACTTTCTATCGTCTTTTTATATTCTCGGATTAAAAAATCAC
> CTAATATTAGAAGAATGAGGCATCAAGAAAATAGTGAAAAGAGTCTTTAAGATGGGCAAG
> ACTTAAACCAGTATACGCTTGTGTACTAAGAGATTTTATTTTCACAGTTCTCTGGAGAGG
> GTTGTTTATAGTTATCCGACCATTACCTAGATGTTATGGGGGGGCTGTCATGAAGGCCAT
> AGTTTCTCCCCGCGGAGCGCTATGGGGCCGGAAATGCACCGACCACAATTAATACCCTAA
> CAATTTAATGTACGTGTTCGTAACGATTCTGTGCTTTTTGAAAACCTTTGTCAAATAAAC
> TTCAAACATCTAGTATAATATTAATGTGGGAGTTGGTGGTAGGTTTTGTAGTAATGAAGC
> GTTCATTCTAACAGTAATGTGACTTGTCAAGCAGCGGCTTAAAGATACATAAGATTCGTT
> GATGTTTACTCTCAGTCATTAAAATCAGAATCATTTGATACGTCCGGTGAAATACCAACG
> TAAGTTGTTGTTAATCCAAGATAGGCTACAAAAGTAGATATTGTATTGCGGACGAAATTC
> TTATCTTATTGGTAGCACATGTCCAACCTTGTTAGATCCACCTACAGTGGAATAGTTAAT
> GTTACATTAAGGCCGTTTCGTCTTTATACGACTAACCTCGAACAGGAACCTTACGAAAAA
> TTAACTGATTATTAGGAAGGAGGCTTTTTGAAGCTTCACCGAGATTGTTGTACAAAAACG
> AAGATTCATAGTCAGATCTATGAACCAATTGACCAGTACAATACTGTGTTGTCCTGCTTA
> CAATCGCACACGATTGGTGTTCTAAGGTCACATGTAACTACATGACTCTACGATGGGTCG
> TCCACAGTCTATATTTCGTATAGACGTAACAGCTAATGACGTAATTGGTCCATTCTGGCT
> AAACAAATTCACTTGAACCAAACACATTCACTAGGCTACACGGACGCCAGAATTATAAAG
> AACCAAAAGATTTACCTTTTTCTGACGATAGCATCTGCTCAAAGTACACGCAGAGGAGCC
> CCTCTGCCATTAGTTTCATAATACGACGGCTTCCACGTTCAGTGTCCAACATTTAAATAC
> CTAGTGGACTAAAATTTTTTGGAAACAGCGAAAGCCGTTTAGTGCGGGATTTGGCCACAA
> TCATCACGATTACTAATCTAAAAATTTCTCGATTCTATTGCGCATTCATCGGTACATATG
> AACCTAAAAGTGTCCTTTTTGACTTATTTTCCGTGTTCAACTCGCAGAAAATCAATAACA
> ATACAATTATTTAAGCAAAACACTTAGAAAGAGGTGCTATGGACCGAAATTAAGGTCGGA
> CCTAAATCTTATTAAGCTTATTTTGTACATCGCTTCCTAGCAGAACAAATATCAACTGGT
> GACCGTTTACGCTGATTTTAAGAATGTTGATGTTTGAGCTAATATGCCACACCGTAAAAA
> AGCCTAAATTAACCCTATCTCCCCGGAGCAACAGGATTTCGAATTCGGACACATGGTGGA
> TTTACGAATCATAACACTGTCCAAACTCCCAGCGATGGGGTTGTCTAGATGACCGAATAC
> ATCATACTGTTCTCACCAGTTTAATGTTTTACGACCCCTCGGAAGTGTTCGTAAATCAGC
> TTTAACCAATTGACCACTGTTCTAAGTTAACCTAATCATTAGATCACCTCGGGACTGGAC
> AAACCAAATTTAGGTCATCTCTACTGTCTCTACAGGTGACTTCTAATAACGAATAAGAAA
> CATTGCTCACCGTGAAGGCAATAAGCATGTGTGAGGCTTTCACATAGGCTAACATCTAGT
> CGTTAGCCCGAAATGCCAGTAGTCGATTGGTTTTATTTACACTCAGTGCTAGGTATGCAA
> CGGATTATCCACTGCGAATGTATTACTAACCATTTGTCAACAATTAATACGACGGAAATT
> GTCCTTAGTTTAGCGGAATTCTCCAGTGTTTGGTAACTTATACATCTCAGAGAAACGTTG
> TTGCTACCTATTTTAGTGCATCCGTAAACATATCTTACGTTCGGAATTTAACCGTCGATT
> GTCATTATTGTTTACGTGCTACTGCGATTGTGCCGTGTCTGGTATCTTAATAAGTCACAA
> GAATTGCATATGATATCACCTGCTTACATCTATTGGAATCTCCACCTCCAATGGCTGCAG
> ATTTTAAAGTCAGCTGAAAATACAATTATTTGATTAACATTTAAACACCTCAGTCCATAT
> GGATCATGTTTTGACGAATGTGCCGCTCAAATATAACGTAAAGTACAATACTGGAAAATG
> GAAAAGCGAAAGTTAAAATCGCTCCGCTCTTACCCCAACGCTCCACGTTACTCACTTTGG
> GACACATAGAACAGGGGTTGTAATCTCTTTTTTAGTATAAGATCTGCAGAGTAATTGATT
> CTCCGGGTTTTTCTGGTAATGGGGTTGTATCGATTTATCGCAAATAAGCAAGGAATGTAA
> CGCGATCCGCAGAAACGGTTGATCTCGACTGGAATGGTAGCCACAAGCATTTTTCGACTA
> GATCGCGTTGTTCATCTACGAGATCGCGCAGGTCTGATAATTAACTTTTTAGGGAACGAC
> AGTAAAATATATAAACCCCTTCCATGGCGTCTCACTGTATAACACTGCTCAAAGATAGTT
> AGTGGACTCAGTGCCGCAATTGCGTTAGATATACTTATAGACTTATAAAAGGTTCTTTCG
> GGTCATAAATTGTCAAGCTATAAAATGAGGATTCGGTGCTGTCGATAATATACACTCTAA
> TACCCAGAGTACTTTTCGCCAAGGGATGCACGTACTACAAGGGTCGTAAACGACTATACA
> TAGTTTAGAATGTTTCTTAGATGTATGTAATCCTCCGGACACATGGCAATCCCAAGGTGC
> GTTCGGCTTTCCTAGGTTACGCCGTTTTAATTACATGTTGATGCCGTGTAACTACATAGT
> CTATAAAACCGAAATGTACCGTCCCAATAGAAGATACCCAGATTGACCCGTTTCGCTGCC
> CCCGCGTACTCATAGCTTATTAACACGTTGCGTACATTCATGTGATAAAAGTGGTTTAGC
> CCACCGTATTGGAGCATGAATTAAGAGAGAAAGATAAGTCACGTGCAATGAGTCCTAAGT
> TCATGGATCAGAGAATTAATCCTGTTTTAAATGTTGGATATTTCAGCGGGCATTAAAATT
> TAGCGTAATCGATTGAGATCGCGAAGGTAATCGAATAGAGCAAGTCGTTTTCAACTTTTG
> AGTATGTATTCATGCCAGCCTTTAAACCAAGACACTTTGTGTGTAAATCGGTCTAATAAA
> AGGTGACTGGAATCGACATTCTTTCTTGTTTCGGGCTAGATTGGGTAAGAAAGATACATG
> ACTACAGTCTCCTAGGGGGTGGCATATGAAATCAAAAATAATACTGCCCAGTGATAGTTA
> TCCTGATGAGGGTTGGATCACTTAGGCGGGTGAGCTATTCGTCCTGCAAACTCCAATTAT
> CAATTTCCTACGACACGCGGGACCTGTCTAACAATCTTGTGACCCACAGCCATTAAACGC
> AACTGGATAATTGTAACAAGTGTCGCCCCCAGGATGATTCGTCGATTAAACACAAAAGAT
> ATCAAGTGTCGCGAATTAAGATACAGGGGAATCAAACAAGATAGTACCGAATACGTTGTG
> GCTTTTCGGCAAATAGCTATACCAATCATCGAGTGGGATCGGATGAAACTGATTCCTCTG
> ACAAGAAGAGGGACGGGAGACCGTAAAACGCATTAATCATGACCGTTCCTCCGGGGAACT
> GGGTACTAGTTGAGTTTTTGATCTAAAGATACTGACGATTCATAACTTATCGCCATAAAG
> GATCGAACCGATAAAGGGCGGGATCGTTATTACATACAATCATGTAGCAAATATGAACCA
> ACAGTACTCGACTCCTCATAAAAGGCAGTAAACGATTCGTACATCTCGTTTCGAGGCTTT
> TAAATCGAGCTTTTGTCGGTACATCCTCATTGCTTTGTTTAGCGGTTGCATAAGGCTGTT
> CCTAGGTGCGATTTCCCCGAGGAACTGATGATCCTGACTAGAATCTGTGTTGACGTCATG
> ATCTTCATTTACATGATGAGATAGACCATAATAACACAATAATTAGGAACACATGCTAAA
> TTGAATATTGCAACTGGTAAGAATCATAGATCAAATCTTTCATAATGCCAATCATGGAAA
> AAAGCACGTGCAGTTATGTTGGTGCTGGCGAATGCGGCGGCAGTATTCAATAGTGTTTGC
> TTTTCTAAGGGTGTTAGAAGACTGCTTCGATTAGCATAATTTGACCATAGTAATGGCCTT
> AGGCTAGAATCACGAACAGGAGATACTTTGCGCATTCGATAATGATTGGCAAATAATCAT
> TGTAGATTAGCGATTTTATCTCAAACTTATAAAGAGATGTTGTCACACGAACGTCCTCTG
> CCGTGCTAGGTCTCAAATCAGTTACTCGTCCCCTTTATAGAAACTTCTAATTGACAAGTG
> TGGCATATTAATGCGTTGTTTTCCAACCCAACGACTATTGGCAGATGAGAAGGTACTCCT
> CGGACAATTATAGAGCAGTCGTATTCCTTAACTGTTCTTTGATGATGCTGGTATACTTTT
> AGGTACGGGACATGATATACAAGGGCATCTTTTAAGGAGCTCGTCCAAAGAGTGAGATTG
> TATATTAATAAATTCCGAACTAAAGGTTGACTAAACGCCACGATGGTGCTCTGAAACGCT
> TATCTGCCTTTATTTTCCGTCGGAGTAATTTCTCTCGGCTATTAGATTTGAACATATACA
> CAGGCCAGATGATCTGGAAAAATCCCCTGGCGCAGCTTATATTAATGGTCCACAGCGTAT
> CGCAATCATTAGGTCTAAATACGTAGTACATTTTTAATCTTAATAAGCATTAACAGACAA
> AATGGAGGACCCACAATCCAAACAAATTGGGTTAGATTAGATTCAGCCTAAAAGACCCGA
> TGTCAGGAGCCATGAATGTCACGCAAGGGCGTCATGTATCTGATAACACTTCGAATAGAA
> AAAGACGGATCAGATTACAGGCGTGATATGACTCTACGGAAATGTTAGTCCAAATGAAAG
> CTCCATGACTGGCCTCATATGCTTGTATTTATATTATGACGAGAATTATAAACAGAACAT
> TCGTCATCCTTGGGCTCAACCAAGTAACTGTTCAGATATTCGAACATAATTTCACTTCGT
> GGAAGTCGTCATAAAAGTATCCAAAAAAGAACATCATAAGGATGTAATACCTTTGAATTC
> GTACATCCAACACTTGTAGTTGAGTTCCGAGCTAGCGTATTGCCATGATTCAAATCTGCA
> TTCCCTAACTGCATAAGATTTATAGATATATATTTGGGAACTATTATACATTTGTCTAGT
> TCCGTTAACTGATTTAGCTTAACTATGAATAACCCGTAGTTCCCAGGAGACTAAAAGGAC
> GGAAGAAATCGACTTGATTTGTGCATTATGTGGGTTCGGCCATACTTCCATTGAACTCAG
> TGCTTTACGAAATTTCCAATTTCTACTGCGTAAGGCCGGATAAAGACCTCATTATCTGAT
> ATTTCTAACCGACTTAAACCCTAGCTAAATAAATAATGGTCTTGGTGATCTCTCCTAATG
> CTAGTGTCACCAAGACTTAACTTGAATGGAACGTTGAAATTACTTTTTATGCGGATCACA
> TAGATAAAAAAAACTGTGCAGGCGCAAACCGTAAAGAAAATTTAGAGTATGTATTACTCC
> CTCACAGTGTATTGTTCCACTCAGCTATTATATTCTTTGTTGACATATAACAATTTTCAA
> ATGAGAGACCTATTGAATCTGGGAAATTAAAGTAACGTTAGATGGCAGGAGTAAATTTAT
> GAAAACACTAGGGCATTACCTAATGGGCACCTAGATGCAAGGCGGTATAACTATTATAAT
> CCACAGAAAAAGATAGAGCACTTTAACCTGGCTTATGCTTGCGGATCAAGAGAGAGTTAG
> TAAGTAAGTAGTCGCTACCCTCTGTGTAACACCAACACACTGTAGACGTATCAATCGCGA
> AGGACATCTTTATATGATCTAGAATGAGATTGAAGATAATTTTGACCTATAGTAGTTCAT
> CGCACAGTTATCCGTAGATAACCAATTTGAAAATGACGCGTGGGATAGACATCGATATCG
> CAATGACGGAACTTCCTTCCCATCGGCAGTTTATTTCGACTAAATGTGACATGAGCGTGA
> GTGATTCTTGCTTACGATCATTTTTAAGTACTGAGAACGGGTCAGTATAACATGAATGAT
> AAGAAATAGATGCAGGCTTTAGATTACCTAGGTTGGTCAATTTACGCAATCACTAGGTCG
> TGAATGGACGACCTGTTTATAGAGCAAATCTTATTCGATCATATAAATACTTTCAATAAT
> AGGTAATTAAGTTTCATAATTAAGTAAGATTGCCATCAAATGTCCAGCTTTGGATAAGCT
> TCATGATATAGACTGTTTAACTGTAAAGGAAGCGTACGATCGGAACATTTTCTATACTAT
> AGCATATAGATCGAAACTTAAAATTATACACAAGGATCCAATAATCTGCTTAGTTCACAG
> CTAGTCCGTTCATAGTTGTATATGGTCGTTATACCAGCTGTATACGCTGCCATAAGGCCC
> CATGGGAGATTGACTATAATTTGTTGATTGAACAAATGCACCGGTTGACGGCATTTATAC
> CATAATTTAGTTTAGCGAGTCCGAATAAGCTAGATATACTTATTGGACAATATGAATGTC
> GGGAATTTGATGGATCGACAAACTCATCCTATCAAGCCTAAAACGGTTAAACGAGGCATA
> TCTAAATGGGTCTCACCCTCGTAAATCTTACAGTGCATTGACAGTCGATTCATGCCCCTA
> GCGTATGAGTGCTTGCAGATTGGAGACTCGCTAGGAGCGGTGGAGGTCATATGCCCTGTG
> GTCTAGTCGCGACCCTTATCGTAATTGTCCCAGACACTAAACAAATTTGTAGTGTACTTA
> ACAGAATACAAGGATCCAGAGGAGACTTATCTTATGATCTAGTCTGATCCGATGTGTATA
> GAGGTACTGATATTGCGACTGTCTTTAAGAGTTATGCATAGAAATGAGTTGTAGGCTGTA
> GTCAGGAGTGAATCCAGAACAGTTCAGGTTAAATCTATGCGTTGTGCATTGGTAAAGACA
> GTGTTAGACGATAATCATCTGCTCCGGGATCTGCCAAGATTACGCTAGGGTTGTCACGTC
> CCGATGAAGAGAGCTCCATACTCATCTTCTTGTATCAGGCTAGCCCAACGCCATGTAATG
> CAGCGTTCCGAACTCATGGTACTTTATTTTATTCTTTCCCTCGGTCCTACAGATATTTGC
> TTAATCATGTGAGTTAAATTATACCAGCTAATCGTAAGCTATTCAATCTCCCTGGAATAT
> AAATGATTTAACATCATATTCTACTATATTTTACAAGGCTGATCAAGTTACTCGGTTTTC
> ACACAATTAGGCGTGATAGACTCTAGACCTTTTTGAAGACCACATAAGAGTCCTTTGACA
> TAAAGTGAAATTTAATACCCGCTGAGTATGTAGTGAAAGTATATTAAGTTATTATTAATC
> TGGATAACCATTTCATGGTCTGGAGTACTATTGCAAAACTTGATATGGATGCGCCCGGAC
> TTTGATGTACGTTGAACTGGTACCAGTGGACGAAATGACAGCTAATCGACGATATGCAGT
> GCAATGATGACTTTTCCTGGCTAAACAGGACTTTTATCACCTAGATTTTTAAAATACCCC
> CGCCGAGCATCGCTACAATCCACTCTCGCCTACCTGCATATAATCCATCCAGACAGGTAT
> CAGCTGAAAACTTTTACTGTCGATAATGCGTTGCACTGGTCGAGTAATAGTTTGCTCCCT
> CACATCCCGAGAAAGTAGTACAAGTTTTTATACGTTCATACCAACTAGTACCACTATCCC
> TAGGAGTTACCGTGCTAATAATTTTCAGGAGAAATAGGATCTCGTTCAGCGTCGTATCTA
> TTTATGTCGGGTTCTTTACGATCGAATGGACGACTCACACGAGTGGCATCAAGAATTATA
> AATTAGCAGAACAAGAGGTGGAGGATGAGAAAACACTGTTTTAATCTCCATGTTTCGCTT
> AATTTATTATAGTATATACAAATAGCACATAGCTGTTTTTCTATCAATGTGAAAACAGTT
> ATATTTATAACTTTTCAGATCTATTTACCAGTACAGAGATGTTGGTCTGTTGTACAAAGG
> TAGGATGGTTGATGTCGTTCAAGGTAGCAGCTTTCCACAATTAGTTACATGGTCGCGAAA
> CTAGCTTGGCATAACAACATCGATTAAACATGTGTTTGTGTAAGACAGGTGACTGATGCT
> ATGGACGATGGCGGATTAGTGTGTGAGATATTACTTAGAATTTTTATGATGTTATATTAA
> ACGAGGCGGGCTGGCGAATTTAATAATCTAGTAGTCCTGCGTTTGCATGTCGGAATGTTA
> GTTGCTTTAGTGAGACTTGATTCCACGTACAACAGAGTTAAGTTACAGCGTTATTGTTGA
> CACTTATTTTGTCTTCTAAAAGGCATCTTGTAGAAGAAAGTATGCATTGCGAAGATTGAA
> GATGGCCAAATTAATGATGGTAACATCCCTGGGTATGTAGTACCTTTAAGGCTCTTACTA
> GTTATAGGATACATCCAGTTCTTCCAAGCTGCACTGCTCGTAATGCCTATCGGTACTGCC
> CACCCATAATTTTTTGTACATCAATACCAATAATTCTATGCCTTAACATCTATAATAATA
> TGATACACAGTATCTGTGAATTTACAAACTCGAATCGCATCCTGCATTCTTACGACGTTA
> CTATAGCTATTCTCGATCAAATAGCGTAAGTAATTAAATATATAAACATGACCCATACGA
> AGGGCCTTGATTCCTTAGTGTAATATGTCAGTTCCCCGCTGAGTATCGAACACTACCCTG
> AGTACGGACTATAAACAGTAACAACTTTTAACACAAGCATGAACTACTGGCGTAGGCCAG
> ATCCTATGCTCGGGAAAGCACTTTCCTCTGTCCTAAGATCTAAATTTTATATTTATGACT
> TGATTTTACTGAGGATTATTTGGACCAATACTTTCTTTCGATACAGACAAATCTAGATGA
> AATAAAAATACCCACATTATTTTCAAAGAGTTAGTACACGGAGTTAGAGAAAGTTCCGTC
> TAATTACATTAAACTTATCCTGAGATAGGTTATTAAAGTGAGCGTGTTGTCAATTCCGTT
> GATTTCCAATGTTAGTCTTCCATCGCGCACTGAATACCCCCAGCGACCATATAATCTTTA
> AATACTGAGCTCGATGACCTGAATATGATAGGCCACACTCTATGTACCGTACATTGGTCA
> CATATATAGGTTGGTAGGCCAATCATGTAAGGGTTCCGAGAACTTACTTATGGTGGCATA
> AATGGAAGCGCGTCATCTTGACCAGTGGTTCTCCTTGTTAACAAATAGAAACAGGGTAGA
> TTAAATTCCCAGTCTATAGGGCACTCAGAAAATCATGAGATGTAATGACCGTAATCATCA
> TGTAAGTGGATGAGAGTCAAATCCGGATATCCGGTTGAGGCTCCAGGCTACTTAAAGCCT
> CTTCTCGTTAGGTAACAAGCTGTTCAGGAGTGAGGTTGCTCTCATACTTAGTTAAGAAAA
> GAGTGTAAGATTTCTGCATTTGGCAATTTACTGAGGACGGCATATGGTACTTGCGTTTTG
> ATACAAAGTTCTCTCACCTAACCTAGATTGATGCGTTCCCCTCGTTCTATATCCTCAGCC
> TAAAGGACCGATTCCAAGAGTGGTATTCTCATAGGATTAACGGTTCCGGCAAAAGTTTTT
> ATCCGCATTAAGGTTTCCTTCTGCTTATAGGGGTGCGCTACAGGGATTTTGTGACTTGAA
> CCGACTAAAACACTAACGGTAGTAGCAGAGGTTATGTAAAAAAATAGGTTCTTAAATTAC
> TTTTTACCATGAGAGGTATCAGTAATCAAGCTACCCTTAGTGTAAGTGACAGTAATGGCC
> GACAATATCTACCTCTTTGAAGATATAAAATGTAAGTTACAAATGGTACAGTATAATAGT
> GGCAGTACTCATCCTCAAAAGTTTTGGATTAGGGCTGCCTAGTGTACGTCGTGACGGTAG
> ACGATTGAAAGTCGATAAATTCTGGGATATCCCATATACTTTTTGGTGGTATAGACCACC
> TAGCATTAAACCTCATACCATCAAACTAGTTAAGCTTTTGACTCTTCTTTGGCAGAATTT
> GACTAATAGGCGCGACCTCTCAGTACATACCTCTTCCATATACCAATTCGAGTAGCTTTT
> TAGGATTCCCTGTCAATAGTCACAATACTGCCTTGTCATTAAGCCGCTTTCTAACGGTAC
> AGTTGTGCATCTCGTTGAACAATACGCTGTGCTAAGTATTTTCGAACCAAAAAAATTCGA
> CGCCAGGGTTAGAACAATTAAATAATTCAAGCCATTAGCGAATTGAGCACTATGGTACAG
> TTTTAAGATCTTCTACAGTCCTCACTCTTCATTGTTATCTCTCAACCCAGTTGTCAAAAT
> CGGTTAAACATATAAGTCGGCTAACCCGAACAGACCTCTTAGTCTAACATGTGTCAGTAC
> ACTATAACATGTTCTTGTTAATCCAGTGCAGTGCATTGATTAATCTAAGTTTCAGTGAAC
> GTAAGCGGGCCAGACGAAACGCTATATACCTTTTTAGACTAGATCAAAATGGGTCCGGTC
> CACAGCGATCTTACCCGGAAAATAAGGAAGACGAACTAAGTCATTAAGAACCCGGTGATA
> TTCCAAGTGGGAGAGGGATGGTTATAATCCGGACATAAAAAGGCACATTGAACACCCTGC
> ACTATACGCAGGTGTCGTAATTAGTACCGGCGTCCTAGCTAGGTTGAAACCCAAAAGTAA
> CAGATAAACCGTCATTTACATGAGACTTTATCTACGCAGCCGAGTAATAACTTGGTTACA
> GTAGTATTACATAGGAATTGACGTTAGAATGTTAGACAGAAAGCCTTAAACGAAAGCACT
> TCTTCTTAGTACATGAGTTAGATATTACAATTCGGCCTTCTTTCCAACATGTAGTCGTTA
> ATTTGACCCCTACGTCTTGTTTAATTGAAAATCACAATCACTAAATAGAGGTTTGTCACA
> TACTAGAAATATCCTGATTATTATCTCAACATTATTTTAAGTGATCTCCAATACTAGGTA
> AATTGTGATGCCAGGAAATACCAATTCCGTCGAGACCTCTACAGAGCTTGACTACATTCC
> TACTAAGACCGCCGTTATGAAAGACTCCTAGGATTTCCCGTGAATGACTGAACAGAAATC
> AAGTAAACCCGTGTATTTCATCTATTAATATCTTCGTTTAGTGACGGACGTTTTAGTTAT
> CCACCATGGAAGTTTGAGCCCCTAGGGCCTGATGCGGAACAACAATACGTGTAATGCGAT
> CTACTGGTTATAAAAAAAGAGAGATCCGAGTAAGTGTAGATCATGAGCCATACTAATATT
> GTATGTCTTTTATTTATTATATCTAGCTTCCCACGGTGGTAACTCTTTCTATAGGAGTGT
> GATAGTATCCGTGGAATAAATCAACTAATTTTAGATGAATGAGGCTTCATCATAAGACTG
> TAATCAGTCTGTTACATCCCCAAGACGGAATACAGTAGTCCCTTCGGTACGAAGTGATGT
> GATTGTAACACTTCTAGCGAGTGCGTGGGGTTTTCTTTTCCGAACTGTACCTACTGGTTA
> TGGGGGCGCTCGCATGAACGAAATTGTTGATCCCCGCCCAGCGCTATCGCCCCGCAAATC
> CTCCGACCACATGGAATAACATAACAAGGTTTTCGAAGGGGGCCTTAACATTAGCGCCTG
> GTTCAAATACTGTCTATATTAAACTGAATAAAGCTACTATTAGAGTAATGTGCGAGGTGC
> GCGTTGGTGTTCTAGTTATGATGCCTTCATTCTAACAGTAATCTGTATTCTCAAGAAGCG
> GCTTAAACATAAATAACTTTCGTTCATCGTTACTCTCACGCATTAAATTAAGATTAATGT
> GATACGTACCGGGAAATAAAAACGTTAGTTCTGGGTAATAAAAGATTGCCGACTATTGTA
> GTTATGGGATTGCGGACGAATGGCTTATAGGTGGGCTAGAACAGCTCAAAACGTGTGAGT
> TCCTCCTAAAGTGCATGTCTTAATCTTAAAGTATGCAAGGGTAGTCTTTAGACCACTATC
> ATAGAAAAGCTTACGTAACAAAATTTATATGATTAGTAGGAACGTGCATGGTTGATCATT
> ATAACACATTCTGGTAAAAAAAACAACATTCAGAGTAACATATAGCAAAATAGTCAACAG
> TTAAATACTCGCTTCGCATGCTTACATTCGCAAACGATTGCTGTGCTATCCGAACATCTT
> TCTAAATCACTCTACGAGCGGTCGGCAAAAGTCTATAGGTCGTATACAAGTATCTGATAT
> TGTAGTATTGGCTACATTATGGCTAAACATATTCAAGTGTACCATAAAAATTAAATAGCC
> TACACGGACGACAGAATTAGAAACAACCAATAGATTTACATTTTTAGCTCCTGAGCAGAT
> GAGAAAACTACACCCAGACGACACCCTCTCCAATGACTTTAATAATAAGTACGCGGAAAA
> CGTAAGTCTCAAACATTTAAATACATTCTCGTCGATTATGTGTTGGAAAAAGCGTAAGAC
> GGGTACTCAGCGATTGGGCCACAATCTTAACCATTACTATTATAAATATTGAGCCAGGAT
> TTTCCGCTTTCTTAGGGAAATAGCATCCTAAATGTGTCCTTTTTCAAGGTTTTGCCCGGT
> TCTACGCCATCAAATGAATTTACAATACTATTTTTTATCAAAATCTCGTACAAAGTCGGG
> ATAGGGACCCATATTAAGCGCGCTCCTAAATCTGATTAACATTAGTTTGTACATCGCGTA
> ATTGAACATATAATTTAATATGGTGAAAGTTTAACCTCAGTTTTACTATCTTCATGTTGC
> AGCTATTATCACTCAACGGAAAAAACCATAAATTTAACATTTCGCAAAGGACAAACTCGA
> TGTCCTATGACGTAAATGCCTGCATTTACGTTTAATAACTCGGTCAATACTCACACACTT
> GCCCTTCGCGACATGACCGTATAATTCATTCTCTGCTAACCAGGTGATGGTTGTACGTAC
> CCTCCCAAGTGTTAGTAAATCACCTGTAAACTTGGCAAAACTCTGCGAACTTAACCGAAT
> CTTTTGATATACGAGCGACTGGACATAACAAATTTTCGTATTATCTAAGGGCTATTCAGG
> GGACTTCTTTTAAACAATAACAATAATTCATCACCGTGATCGATTTTACAAGGTCGCACG
> CTGTAACTGACCCGAACAGCTTCTACGTAGCCACTAAGCCCACTACGAGTTTCGGTGTAG
> GTACACTCTCTCCTACGTATCCATCGGATTAGAATAGCCCATTGGAGTAATAACCATTTG
> GCAACAAGTAATACGACCGTAATTCTACTTACTTTTGCGCAATTAGCAACGCTTGGGTAT
> CGGATACATATCTGTCAAAAGTTGTTGAGACCTATTTTTCTCAATCAGTAATCATTTCGT
> TACGGCGCTTGTTTACAGTAGATGCTAATTATTGGTGAAGTCCTACTCCCATTGTGCAGT
> GGAGCGTTTATTTATAACTAAAAAGAATGGAATAGGATATCAAATGATTACATATATGGG
> AATCTCCACCTCCATGCGATGCTCAGTTTAATGTATCAGGTAAATACAAGGTTTTGATTA
> AAATTGAAAAAAAGAACGAATGAGCCATCATGTTTGGACGAATGTCCCGATCAAATAGTA
> CCGAAACTAAAAGACTGGTAAATCCAAAACCCAAACTGAAAAGACATCAGCGCTGACCCC
> TACGATACAACTTAATCACTTTGGCAAACATAGAAATCGCGTTGTTTTATCTTTGTTACG
> ATTTCATCGGATGTGTATTTGATTCTCCCGGTTTTGCTGCTAATGCGGGGCTATACATTT
> TTAGCATAGAAGATACGTAGCTAACGCCAGCAGAAGAAACCGTTCTTAGCGACGCGATTC
> GTAGCCACTAGATTTGTTCGACGTGATACCGTTGTTCAGATTAGAGATAGAGCACGGATC
> ATATTTAAAGTTTTACGCAACGAAAGTTAAATATATATAAAAATGCATGGGACTCTCAAG
> GTATAAAACTGATAAAAGTGTGTTAGTGGAAGAAGTGACCCAATGCCCTTTCTTAGACTT
> ATTCTAGTATAAATCCTTCTTGCGGGTCATATATTCGCTTGAGATATAATCAGGATTCGC
> TGCTGTCCAGAATATTCAATCTATTTCCCAGAGGTCTTTTAGCAAAGGCATGCACGTAAT
> TCAAGGGGCCGAAAACACTATAATTACGGTTGATTCTTTCTTACATGTATGGATTCCTAA
> GGAAACATCCCTAGCACAACGTGCGGTCCCCTTTCCTAGGTTTCGCCCTGTGAATGTCTT
> GTTGTTGCAGTCTTTCTACAGTCTCTAGAATACCCAAATCTAAAGTCCAAAGTCATGATA
> CCCACAGTGAAACGTTGCGATGAAACCGCGGACTCATAGATTTGGAACACCTTCCGTTAT
> TTCTTGGCATAATTGTGGTTGTCCCCAAACGATTGGTGCTTGAAGGAAGACACAAAGATA
> AGGATAGTGCAAGCAGTCCTATCTTCATGGAGAAGTGTATTAATCCTCTGTGAATTCTTG
> GTTATTGCTCCGGGCATGATTTTTGACCGGAATCGATTCTCATCCCCAACGTAATCCATT
> TGTGAATGTAGGTTTCAACGTTTGAGGTGGTTTTCTTCCCACAATTGTAAACAAGAATCT
> GTGTCTGTAATTCCGGCTAATTTAACCTCAATCGAATCCACATTCTTTCTTGGTGCGGGC
> GAGTTTGGGTAAGAAAGAGACATCTATAATGTATCCTAGGGGCTGCAATATGTATTCAAA
> ATTAATACTGCACAGTCATACTTAGCCGGTTCAGGGTTGGAGAACTGAGGAGGGTGAGCT
> ATTACGCCTGCTTAATCCTATTATCATTTTCCTTACTCACGCCGGAAATCTCTTACTATC
> GTGGCACCCTCTCAAATTATACCCAACGGCTTAATTGTTAAAAGTCGCGCCCCAAGCATC
> ATTCGTAGATTATACAAAATAGATAGCAAGTCTACCCTATGAACATACTGGGCATGCATT
> AAAGATAGTAAAGAAGAAGGTCTGCAGGTTAGCATAATTGATTTTCCTAGAAGAGTGGGG
> GAGAGGAGCAATATGTGTACTCGGACAACAAGACGCAAGCCACTCCGTAAAACGAATTAA
> TCTGCAACGTTACGCAGGCGAAAGGCGGACTACTTCAGGTTTTCTGATAAAGTTTATGAA
> CATTATTAACTTTTACAAAGAATCCTGCCAAACCATTAAGGCCGGGTTACTGTTTACATT
> CTATAAGGTAGATAATATCAAACTACACTAATCGACTACTAATTAAAGGCAGTAAAACTT
> GCCTACATATCGTGGACAGGAGTTTTTTTCCACATTGGGTCGGTACTGACTCTTTCCTTT
> CGTTTCACGGTCAAGATGGATGTGCATAGGTGCGTTTGCCCCGTCGAACTGATGATCCTG
> TCGAGAATATCGGTTCTAGGCAGGATCTTCAGTGACATCTGGACATACTAAATAAGAACT
> ATATAATGAGCATCAATTGAGATATTGATGATGGCAACTGGGATCTAGAATAGAGAAAAG
> CTTTAAGAATCCCTATCATCGTAAAAAGAAACGGCACTTATGTTGCTCCTGGACAAGCAC
> GCCCAACTTGTCAATTCTCGTGGCTTTTCTAAGGGTGTTAGAAGAAGGATTCCATTACCA
> TAATTTGACAATACTATTGCACGGTCCAGAGAATCTCGAACTGGACTTACTTGGCGAATG
> ACATAATGATGGCATAATAAGATTTGTTGATTACAGAGGTGTTATAAAAATTAGATAGAG
> TTGGGGTCTATACAACGGCAGATCCCGTCCTTCCGATCATTTAAGGTTCGCGGACCATTT
> ATAGTTAATTCTAATTGAAAAGTCTGGATTTTTTATGCGTGCTGTTAATAAACATCGAAT
> TGGGCAACAGCTCATGGTACTCCGCCGACAATTATAGTGCAGTACTATTAATTAACTCTT
> CTTTGATCATGCTCCTATACGTTTTGCTAACCGACATGTTTTACATGGCAAGCTTGGATC
> CACATACTACAATCTCGGTCAGTCTATATTAAGTAAGTCAGAACTAATGGTGGACTATAC
> GCCACGATCCTGAGATGTAACCCTTTGCGGCCTTTATTTTACGTACCTGTTTTTTATCTC
> GGAGATTAGAGTTCATCTGATACACAGGCAACTTGTTCTGGATAAATACCAGGCACCAGC
> GTATATTTATCCTCCTCAGCCGATCCCTATCATTTCGGCGTAAGAAGTAGGTCATTTTGA
> ATCTTAATAAGCAGGTACAGACTAAATCGACCACCAAAAATCCTATCAATTTCGCTTAGA
> GGAGATTCAGCCTATAACAAAACTGCTCAGCAGACATGAAGGGCAAGCATGGCCGTAATG
> TATCTGAGATCACTTCGAATTGAATAAGAACCAGAACAGTTCACGCGTGATAGGTATCGT
> CGGATTTCTGTCGACTAATGTAAGCGCCATGACTGGCATCAGTGCATTCGTGGGATAGTA
> GCTAGAGATTGATAAACAGATCATTACTCATACGGGGCCGCAAACATGTAACTGGGCACT
> TATGCCATCATTTGTGCACTTACTCGAAGTCCGCATAAAACTTTAAAATATAGAACTTAA
> GATGGAGGTATTACATTTCAATTCCTAAATCAAAAACTTCTACTTGTCTTACCTCCTAGC
> GTATTGACATCAGTCTAATCTCAATGACATTTCTGAATTAGAGGTATACTTTTTTAGTTG
> GGATAGATTATACATTTCGAGTGTTCAGGGAACTCTTTTAGCTTAAATATCAATAACCCC
> TAGTTAAAACCAGACTATTACGTCCGATGAATTACTATTCTTTGGGGCTTTTTCTGGGTT
> CGCCCATACTTCCTTTGATATCTCTGATGTAAGATATTTCCAAGGTCTTATGAGGAAGGC
> CGGATATAGACCTAATGATCTCATATGTAGTACCCACTGTAACACTTCATATATAATGAT
> TGCTCTTCCTGTTCTCTACGAATGCTAGTCTATCATAGACTTATCGTGAAGCGATAGTTC
> ATATGAAGTGTTTTGCCGATAAAATTCTGTAAAATAAATGTCAAGCCGCAATCCGGTAAC
> TAAATGTACTCTTTGTATTTATAAATCACTGTGTTTTGTTCATCGCACAGATGATTTTCT
> TGGTGCAAATATAAATATTTTCATAGGACACAACGATTGAATATCGGTTTGTAAACTTAA
> GTTACAGGGCAGCAGTTATTTTATCATAACTCTAGGGCAGGACATTTTGGCATCATTGTT
> CAAAGGCGGGAGAAATATGATATTCCAAACAAATACATACAGCTATTGATACTCGATTAT
> GCTTGCCGTTCAACACTGTGTGTGTAAGGATGTAGGCGCTAACCTCTGTCTAACACCTAC
> ACTATCTAGAACTTTCATTAGCGTAGGAAAGCGTGATTGGATCTACAATGAGAGTCATCA
> TTATTGTGTACGATACGACTTCAGACAACACTGAGCAGGACAGAAAAATTGTCAAAATGA
> AGCCTGGCATACACATCCATATCCCTTTCAAGCTACTTCAGTACCAGCGCCAGTTGATTG
> CCACGAAAGGTGACAGGAGCGTCAGTCATTCTTGCTTACCATCATTTGTATGTACGGAGT
> AAGGGTCAGTATTACATCAATCAGAAGAAATAGATGATCGCTTTAGATGAAAGAGGGTCG
> TAAATTGTCGCATTAACGAGGTCGTGATTCGACGAAATGTGGATAGACAAAAGCGGTTTA
> GATAATATATTTACTTTAAATAATACGTATTTAAGTTTAAGAATGTACTAAGATTCAAAT
> CAAATCGCCACATTTGCATAACCTTAATGATAGTGTATCTTTTACTGGAAAGCATCCCTA
> CGAGCGGTTAATTTTATATTATTTAGAATAGAGAGCGATACGTTAAATTATAAACAACCT
> GACAATTAGAGCATGTCTGAACACCGTGTACCTGAATACTTCTAGATCGTCCTTATAACA
> CCTGGATACCCTCACTTAACGAACCATGGGTGTTTGACTATTTTTTGTGGATTCATCATA
> TCAACCCCTTGTCCCATGGTAGACCATAATGTTGTTGAGACTCGCCGAATATCATACATT
> GTCTTATTGCTAATTTTCAATGTCCCGAATGGGAGCGTTACACTTTATAATAATAGAAAC
> CATTAATCGGTTTAAACAGCAATATCTAAATGGCTCTCAAACTAGGAATGCTTAAAGGGA
> TTGCTCAGTAGATGCAGGACCCGACCCTATGTGTGCTGCCACTTTGGTCACGAGATAGCA
> GAGCTCCAGGTATGATGCCCTGTGGTAGAGTCGCGAACCGTATCCTAATTGTAAAAGTCA
> ATAAACTAAGTTCTACTCTTAGTTAAAGATTAAAACCTTCCAGACGAGAATTATCTTAGG
> ATCGAGTATGAGACCTTGTCGTTACACGTACTCATAGTGCCACGCTATGTTAGAGTTTTG
> CATAGAATTGAGGTGGTGCCTCGTGTCTCCTGTCTTTCATGAACAGGTCAGCTTAAAGAT
> TTGCGTTGTGCATTCCTATACACACGCTGACAACAGAATATTAGGATCACGGATATGCCA
> ACATTAAGCTACGGTGGTAAACGCCCGATCAAGAGACCTAAAGAATCATATGCTTGTATA
> ACCCTACCCCAAAGCATTGTAATGCAGACGTCCGTAATAATCCTAAGTGATTTGATTAGT
> GCACTCGCGCCTTCTCATTGTGGCGGAATAATCTGACTTAATTTTTAAAAGCTAAGCGGT
> AGATATGAATTCTCCATCGAATATAATTGAGTTATCAGCAGATTCGACGATATTTTACAA
> GCCGGATAAACGTTCTCCGTGTTCAATCTATTACCCGTGATAGTCTATTCAACGTTTGGA
> AGAACAATTAACAGGAATTTCTATGATAGTGATAGTTTATTAAAGCTGACGTTCTTCGCT
> TAGGTTTGTTTGTTATTATTAATCTGGATAAACTTTTCAGGGTCTCCAGGTATTTGGCAA
> ATCTTCATATGGATGACCCCCCACTTGCAGGTTAGTTGAAATGGTACAACTCGTCCAAAG
> GAAAGATTATACAAGATAGGAACTGCAATCTTGAATTTTCATGCCTATTCACGAATTGTA
> GCACCTAGTTGTTGAAAATACACACGCCGACAATCGATAAAATCAAATAGCCCCTAACGG
> CTGTTAATACATCATGACACCTAGATGCTGAAAAAGTGTAATGTCCATATGGACTTGAAC
> TCGTAGAGTAAGTGTGTCCTCACTCTCAGCAACACATAGTACTACTAGGTGTTATAAGTG
> AATACAATCGTGGACCACTTTACCTACGTCTTTCCCGGAGATGTAGGTTAACCAGTAATA
> GGATATAGGTAAGAGTAGGAGAGAGGGATGTACGCGTCGTTAAGAGCGAATGGAAGACTC
> AAACGAGTGGCATCAAGATTGAGAAATTAGCAGAACTAGAGCTCGAGCAGCAGAAATAAC
> TCTGTTATTCTCCATCGTTCGATGAATGTATTATTGTAGTTACAAAGACCTCATACCTCT
> TTTTATATAATGGTCTTAACACTTTTATGTATAAATTGTCTCTTATAGTTACCAGTACTG
> AGTTCTTCGTATCTTGTACAAAGCTTGCTTCGTTCATGTCGGTAAAGGGAGCTCCTTTAA
> ACAATGTGGTACAGCGTCCACATACTAGATTCGAATATCATATTACAGTAAAATTGGCGT
> TGTCTATCAAACGTGTATGATGCTAGGCTCCATCGAGGATGAGGGTGTGTGATATTAATT
> AGTATTTTTATGTTGTGATATTAAAAGACCCGCGCTGGAGAAGGTAATTATCTACTACTC
> CTCCCGGGGCAGGTCCCAATGTGTGTTCATTGAGTCAGACGTCTGTACACCTAAAAATCT
> GTTATCGTACACCGTTATTCGGGAAACTTAGTTTCTATTATAAAAGCCATCTGGTACAAG
> TTACTTTGCATGCAGATCTGTCAAGATCGCAAAATTAATGAGCGGTACATACCTGCCTTT
> CTAGGTACTGGATGGAGAGTTCTTGGTATAGCATAATGACTCTTCTTCCAACCTCAACTC
> CGAGGAAGCACGATCGCTACTGACATCAAATTATTTTTGGGACATCTAGACCAATAATTC
> GTGGCCGTAAAATCTATAATTTGATGATACTAAGGAGATCTGAATGTACATACTCGAAGC
> GCTTCCTGATTTATTTCGACGTGACTTTTCATATTATAGATCAAATAGCCTTACGTAGGA
> AATATAGATACAGCAACAATACGAACGGAATTGTTTACGTTCGGTATTATGTATGTTCAC
> CGCGCACTTTCGTTCACTACCCTGTGTTCGGTCTAGATTCTGGAAAAACTTTTAACTCTA
> CCAGGAACTACTCGCGGACGCATGATCCGATGCTAGGCATAGCTCTTTCCTCGCTACTAT
> GTTAGAAAGTTTATATTTATGTCTTCAGTTGAATCAGCTTTATGTGGAACTATAATTTAG
> TTAGATACAGACAAATCTAGATGAAAGAAAAATAACCAATTTAGTTTCAAAGACTGTCTA
> AACGCACGTAGAGTAAGTGACGTATATTTACTTTATAATGATCCGGAGATAGGGTATTAA
> ACTCACAGGGTTCGAATGTCCGTTCATGTCCAATGTTACTCTTCATGCCCGCAATGTATA
> ACCCCTGCCAAAATTGTATATTTTTATACTCTCATCGATGACCTGAATTTCATACGACAC
> TATCTAGGTTACCTACTTTGGGAACATATAGTGCGGGGTAGCCCAATCTTCTAAGCGTGC
> CGAGTACGTACTTAGGGGGCCATATAGGCAAGCCACTAAGCTGCTACTCTCCTTCTCCTT
> GGGAAAATAGACAAAAACGGTTGTTTATATTACAAGGCGATAGGGCACGAACTATTTAAT
> GAGATGGAATGACACGTTTCATAATGTAACTCGAGGTCTGGAATTTCCGCATAGCCCGTT
> GAGCCTCAAGGATACTGTAAGCAGCTTCGAGGGACCTTACTACATCGTCTGCTCTGACCT
> TCAGCTCATACTTTGTTAACATTACAGTGTTACATTGAGCCAGTTGCAAATTTAATGAGG
> ACGGAAGATCCTACTTCCGTTGTGAGAATAAGTGATATCTACTATAAGAGAGTGATGCCG
> TCACCTCCTTATTGATCCGCTGCCGAAACGAAAGAGTAATACAGTGCTAGTCTCATTCGA
> TTAAACGTTAAGCCAATAGTTTTGATCCCATGTTAGCTTGCAGGCGCCGGTTACGCCGGC
> CATTCTCGGTTTTTGTGTCGGCTACAGACTAAAACACTAACGCTAGTAGAACAGGTTTGG
> TAAATAAAGAGGTTATGAAAGTTCTTGGTACCATGAGAGCTATCAGTATTCAAGATACCC
> TTACGCGAACGCAATCTATTCGCCGACTTTTGCGTCATCTTTGTTGAGTTATTAGCGAAG
> GGACTTAGGCTAAACTATTATAGTGCCACTTCTCAGCCTAAATTGTTTTGGATTTGCCCT
> GCCGACTCTACGGCGTGACCGTAGTACAGTGAAACTACATTAATGCTCGGATATAACAGA
> GAATGGGTGGGGCTTGACACCACATACCAGTAAACCTCTTTCCTTCAAACGTCTGAAGAT
> TGTGAATCTTCGGTGGCTGAATTTGAATTATAGGCCCGTACTCTATCTACATACAGATTA
> CAGATACCAAGTCGAGTAGCGGTTTACGATGCCCTGTCAATAGTCAAAATACGCAATTCT
> CATTAAGAACATTTAGAACCGTTCACTTGGCCAGCGCCTTGATCAATTCGCTCTGCGTTC
> TAGGTTAGAACCTTTAAATTTCGTCCCCACCCGGACAAAAAGGAATGAAGTATAGCCAGT
> AGAGAATTGTGCTCTATGGTTCAGTGGTATGATCTGATACACTCCTAACTATGAATGCTT
> TTCTAGAAAACCACTGCTCATAATCCGTTTATAATATATGTACCCTATCACGAACAGAAA
> TATGACGCTAACATCTCTATGGTCAATTTAAATGGGTCTTGTTTATCCAGTGCAGGGAAT
> GGATTAATAGATCGTTCAGTCAACGGATGCCGCCCTGTCCAATCCATAGAGAACTTGTTA
> GTATTGTGATTAAGCCCTAAGCTACTCACCGATATTACCAGGTATATAAGCAACACGAAA
> GTAGTCTTGAAGAAAACCCGGTTATGCCAACGCCCACAGGGATCGGGATAATCAGCAAAT
> AAAAACCAACATTGTACTCCAGCCAATTGTACCAGGTGTCCTTATTTGTAAACGCGTACG
> TGCGAGCTGGAAACCAAAAACGAAAACATATTCCGTAATTTAAATGAGTCTGTAGATACG
> CAGAAGAGTATTAAAGTCGTTAATCGAGTATGAATTTCGAATTCACGTGAGTTGCTTAGA
> CACAAAGCCTTAATCCTTAGAACGGCTTATTTGTAATTGAGTTACAGATTACAATTCCCC
> ATTCTTTCAATCAGGTACTCCTTAATTTGAACACTTCGGCTTCTTTAAGTCAAAAGCACT
> TTCTATAAATACAGGTTGGTAAAATAATACAAATTTCCTGAGGATTTTAGAAACATGATG
> GTTAGTGTTATCATAGAATACCTAAATGCTCATCCATCCTAAGTCATTTTACCTAGTGAC
> CGCTACACACCTTGTCTAAATTACTTCGTACACACCCCGGATGAAACAATACTACGATTG
> CAACTCAAGGACTGTAAACATATCAAGTAAAACCGTGTATGGCATCTATTATGATATTCC
> TTGTGTGACGGTAGTTTTACTGTTCAACAATGCTACTTGGACCACCTTGCGAAGGTTGAC
> CAACAACAATACCTGTAATGAGATCGACTGCGGATTATTTATGTGACAGACGACTAACTG
> TACTTATGCACCCAGACGAATTTTCTTTGTATTTTATTTATTATAGCGACATTACAACGC
> TGGGAACTATTTAGTTACGAGTGTGATTGTATACGTGGAATATAGAAAATAAGTTTTCTT
> CTATCAGCCTGAATCATAAGACGCTAATCACGATGTTTCAGCCCATTCAAGGAATAATCG
> AGTACCTTCGCGTAGTAGTGAGGGGTTGGTAACACTTAGAGCGACTCCCTGCGGTTTTCG
> GTTAACTACTGTAAAGTCTGCTTTGCGCCCCCCGCGAAGCAACGAAAGTCTTGATAAAAC
> CCCTCACATTGCCCCAACCATTGCATACCTAAACTTGGAATTACATAAATAGGTTTGCGA
> AGGCGGCCGTTACTGTAGCGCATGGTGCAATTACGGGCTATATTAAACGGAATAAAGAGA
> CTATTAGAGTTATCTCCGACGTGCGCGTTCCTGTTCTTCTTATCTTGCCTTAATTATTAC
> ACTATGCGCTAGTCGAAACAAGAGGCGGATACTTTAAGTACTTTAGTTCATCGTTAAGAG
> AACGAATGAAATGATCTTTATTGTCTTAACGAACCGGAAAGAAAAAACTTTCTTCTGGGT
> AATAAAACAGTCCAGAATATTGTTCTTATGCGATTGACCTACTATGGATGTGAGGTGGGC
> GTCAACAGCTAAAAAAGTGTGTCTGCATAAGAAACGCCATGTCTGATTCTTAAAGTATGC
> AACGGTACTAGTTTGAACACTATAATAGTAATGCTTAAGTAACAATATTTTTATCATGAG
> GAGCTACCTCCATGGGTCATCAGTATAACACTTTCTGGTAAAAAAAACTACATGCTGTCG
> AACATATAGCTTAATAGTCTAAACTTATTTAAGCGCTGCGCATCAGTTAATTACAAATCC
> TTTCCGCTGATTTCCGAACATCTTTATTAAGCAATATACCTGCCCTCCGAAAATCTATAG
> AGGGACGTTACAACTATATCATATTCTACGATGGCCTAATGTATCCATAAAATTTGTCTA
> GTCTTACATAATATTTAAATTCCAGTATACGAACACTCTAGTAGAAACATAATATTCTGG
> GACATTGGGAGCTACTGACAAGATCAGATAACTAATACAACACCTCACCCGATCCATGGT
> CGTTAATATGTACTACCCGGAAAACGTAACTCTAAATCTTGTATATTAAGTCGCCTAGAT
> TATGGGTTCGTAAATCACTAAGAACGGTACTCACCCATTGCCAAAATAGCTGAACCTTGA
> ATATGATAATTTTTGAGACAGGATTGGCCCATTGATGACCGTAATTGCTTAATTAATCGG
> GACGGTTGCAAGGTTGGGAACGGGTATTAGACATCATATGAATGTTAAATTCTATGTGGT
> ATCATAATATAGTACTTACTCCGCATAGCCTAACATTGTTTCCGCCCTAAGTTAGCGGAT
> TAACATGAGGGTCTAAAGACAGTAATTCATCTTATATGTTATTATCGGCAAACTTGAACA
> TCAGGTGTTCTAGCGTCATCTTGCAGAGATTTTCAATCAACCGTTAAATCAATAATTTTT
> AAAGTTAGCAAACCTCATTATCCTTGTACTATGACCTATATGCCTCCTGTTACCTTGAAT
> ATATAGCGCAATACTCACACACTGCCCCGTCGAGTCAGGACAGTTTAATTCTGTAGCTGA
> TATAATCGTGATGCTTGTAACTACACTACCAAGTCTGACGAAATAACCGGTTAAATTGGC
> AAAAATCTGCGAACTGAAAAGATGATTTTCTTATACGACCCAATCCTCATTAATATTTTT
> CCGATGATCGAAGCGATAGTAAGCGGAAGTCTTTTTAACAATAACAATATGGCAGATACC
> GCATCCATTGTTCAAGCGCGCTCCCGGTAAATGACCAGAAATGATTCTACGGAGCCACTT
> TGCAATCGACGACTTTCCGTGTTGGTTATATATCGCATACGGAGCAATACCAGTAGAATA
> GCACATTCGTGGAATAAAATGGTCGAATATAGTATTAACAACCTAATTCTAATTTCTGGT
> CAGCAATTAGAAACGCTTGCCTATAGGAGACATATATCTCAATACGTCTGGAGAACTATT
> TGTCTCAATCACTTATATGTTAGGTACGGCGCTTGGTTAAACGAGTTGCGATTTTTTCGT
> GTACTCCGTAGCCCATTGGGAAGGCGAGCCTTTATTTTTTACTATATTCAATGCAATTGG
> AGATATAAGCAGGACATAGTTGCCAATCGACTAATCAATGCCATCATCAGTGGTATCGAT
> CAGCTTTTGAAAAGGTTTGCAGTAAAATGGAAAAAAAGAACGAATGTGCCATATTCGGTG
> GAACTATCGCACGAGCAATGAGTAACGAAACTAAATGACTGCTAAAGCCAAATCACAATC
> GGTAAAGACAGCACAGATGTCAACTAACAGAATACGGAAGATCTGTCGCTATATTTCAAA
> TCCCGTGCTTTTATAGTTGGTACGATTTCAGAGCATCTCTATGTCATTAGACCCCTTTGG
> CGGCTAATCCCCGGCTTTACATTGTTAGATTAGAACATACCTTGCTTTACACTGAAGATC
> AATACCTGCTTAGCCACGCCATGCCGTCAATATACATGGGTTCCAAGTCTTACACGGCGG
> AAGATTACACATACACATCCGAGCTTTTGTAAAGTTGGACCCTTACAAACGTAAAGTTTT
> ATAAAAAGGAATGCCACTAGATAGCTATAAAACTGAGAATTCTGTGTTAGGGGAAGAAGT
> CAACCTTTGCACTTTCTGAGACGGATTCTAGTATATTTCCTTAGGGACGCGAATTTAGGC
> GATTCAGATTTTATCACCATGACCTCATGGCCAGTTTTTTAAAGATTTGTAACTCAGGTA
> GGTTAGAATACCCTGCCTACTAAGTAATCCCGACGAAAACAATAGAATGACGGGTGATGC
> GTTATTTCTTCGTTGGATTAAGAACCTAAAATCCCTTGAACTACCTGACGTACCCGTTCC
> TACCTTTAGCACTGTGAAGGTATGGGTGTTCCACTCGTTATAATGTCTATAGAATAACCT
> ATTCGAAACTCCATAGTCATCTTTAACACTGGCTAAAGGTGACAGGAAAAACACGTAGAA
> TTCATTTGGAAATACGTCAGTTATTTCTTGGCTTAATTCTCCTGGTCAAAAAACGAGTCC
> TCATGCATGGAACTCTCTAACATAACGATAGTGATTGCACGAATATCTTCATCCAGATCT
> CTTTGTATAATCTGTGTTTTCTTGCTTATTGCTCAGCGATTGATTTGGGTCACGAAGAGA
> TGCTCTGCCCCATCCGAAGACATTTGTCAATGTACGGTTAAAAGTTTCTCGTGCTTTGAT
> TCAAACAATTGTATAAAACTATATGTGTCTCTATTTACGGAGAATTTAACCTCTAGCCAA
> TACAATTTATGGAGGGGTGAGGCAGAGTTTGGCGTACAAACAGAAATCTATTATGGATAA
> GTGCCCCGCCAATATGTTTGAAATTTGTATAATCCACACGCTTTCGGTGAAGGTTCACGC
> GTCGAGAAATGTGCACCCTCAGATTGTACGCCTGATTTAGCATAGGAGAATTTTAATTAC
> TAACCACCCAAATCTCTTACTATAGTCGCTCACTATCAAATTTTTACCATAGGCTTAAGT
> CTTAAATCTCGCCAAAAAAGCTTCTTGCCTACAGTATAATAAATACAGAGAAACTCGACC
> CTTGGTACTTAATCCCCTTGAATTAAACTGACTTAACAAGTAGGTCGCCAGGTTACCATT
> TTTCATTTTCATTGAAGAGTCGCCCAGAGCTGCTATATGTGGAATAGCACAACAACACGC
> AAGCCTCTAACTATATAGATGTATTATGCTACGGTACGAAGCCCAAAGCCCGAAGTCTTC
> ACGGGGTCTGATAATCTTTAGCAACATTATGAACTGTTACAAAGATTCCTGCCTTAACAT
> TTTCCCAGGCTTACTGTTTAATTTATTTAAGCGTCATAAGTTCATAATAAACTAATAGTA
> GACGAATTTTTCGCAGTAATACTTGACTTCAGAGACGGGACTCGAGTGGTTTGACACATG
> GGGGCCCTAATGAAGATTTCATTTCGGTTCACCGTCAAGATGCATCGGAAGTGCGGACTT
> GGACACGTCCATATCATCATAAGGTCGACTATATCGGTTCTACGATGCTTCGTAAGTGTC
> AGCTGCTCTGTCTAATTTTGTTATATATATTGACCTTAAATTGAGATATTGATGTTGGAA
> TAGCGGATCTAGAAGACTGAATTGCGTTAAGAAGCACTAGAATCGTAAAAACAAACGCAT
> CTTAGCGTGCTCAGCCACAAGCACCACCAACTTGTATATTCTCGTGCAGTTTAGATCGCG
> CTGTCTACAAGCAGGACTGGTCAATTTGGTCAAAATTCTATTCCACGGTCCAGACTATCT
> ACTAATCCTCTTAATGGCACAATGACAGTTTCTGGCCATAATTAGATGTCGTCTGTACAC
> TGGTGTTATAATAATGAGATACACTTCGGCGCTATACTTCCGAAGATCCCCTCATTCCGA
> GCATTTAAGGTTCGACGAACATTGAGACTTTAGTATTAGTCTAAAGTCTCCATTTTGTTT
> CAGTGCTGTTAATAAAAATACAATTGGCCATCAGCTCATCGTACTACGACCAAAATTAGA
> CTGAACGACTTTTAATGTTATCGTATTGCTTCATCCGCCGAGTAGGTGTCCTAACCGAAT
> TGTTTTAAATCCCAAGAGTGGTTCCTCAGACTAAATTCTCGCTCAGGCGATAGGAAGTAT
> GGCACATCTAATGGTGCTCTTTAACCAAAGATCCGCAGATCTAAACCGTTGCGCAATTTA
> TTTTAAGTACCTCTTTTGTAGATCCCAGTTTACAGGTCATATGTTTAAAACGAATCTGCT
> TATCCTTATAGAAAAGGCACAACAGTTTTGTTAGCCGAATAACACGTGCCATATATGTTC
> GGCGTAAGAAGTACGTAAGGTGGTTGAGTATTTACATGGTACTGTATTATTCCTCCTAAA
> AAAATAATATCATTTTCCCGTTCAGGTCTTGAACAATTTTTCAAAACTGCTATGCACAAA
> GGTAGCGCAACAATGCCCCGAAGCGATATCTGATAACGTACTTGTCTATAAGTACCTGAT
> CAGTTAACGAGTGTGAGCTAGAGTCGCATTTCTGTCGAATATTCTATCAGACTTCTCGCG
> AATATGTGCATGCGTGGGTGAGGAGCTAGTCTTGGATATTAACTTCTTTACTAAGAAGGG
> CCCGAAAACATCTAAATCGGAACTGATGACATAATTTGGGAAAGGACTCCAACTACGATT
> AAATCGTTAAAATATAGTAATTATGTTCCTGCTATGACATTTCTATGACTAATTCATTAA
> ATGCGACTTCTCGTAACTCATACACGATGCAATTCAGGATATTATCATTGAAATTTATCA
> ATTAGTGGTTTTCTTTGTGAGTGCCCTTAGAGTATTCATTGCGAGTCGTAACGGATCTCT
> TGGTCAGTATAGAGCATTATAACCTTGGGAAATCCAGAAGTTTTCCTACCTTGTATTACT
> ATGCTTTGCGGATGTTGCGCGCTGACCCCATAAGTCATTGCATATATCTCAGGTTAGTTA
> GGTACATGGTAGTATCACGAACGAACCTTTTACAAAGATTGTGATCATATGTAGTAAACA
> ATGTAACAATTCATATTTTATGATTCCTCGGCCGCTTAGCTACGTTGCATAGGCTATAAT
> ACAATGATCGTCTTGCGATAGGGCTTTTGTAGTGGTTGGACGTGAAATGTCTGTTTAATA
> AATCGCAAGCAGAATTAACGTATCTAAATGGTCTCTTTCTTTGTATAAATAACTCTGGTG
> GCTGCATAGCACAGAGGTTTTTATGGCTGCAAATATAAATAGGTTCTTAGCACACAAAGA
> TGGAATATCCCTTTGTTATCTTAACTTACAGGCAACCTCTTATGGTATCTTAACTCGTCC
> CAAGGTCAGTTGGCCATAAGTGTGCATTCCACCGAGTTAGATGATATTAAAAACTTTTTC
> TTACACATATTGATAAGCCATTATCATGCCCCTTATACTCTCTCTGTGTTACGTTCGACG
> CCAGAAAATATCTCTTTATAATAATCTAGCTACTACTTGATTTACACTAGGAATGAGTGT
> GTGCATCTACAAGCTCTGTCATCATTATGGTGTAAGTGACGTCTGAAGACAAAACTGTGA
> AGGTCAGTTAAATGGTCAAAATCTACACTCGCTGTCACTTACTGATACATTTCAACCTTA
> TTAAGTAAATGAGCAACGTGTTGGACAAGTTAGCTCTAAGGTCCCTCAGGCTTTATTCAT
> TAACATATGGTGGATGTAAGGACTAACCCTAACGATTTATTCAAGCTGTACAATGACTTC
> ATCCATTTACAGGAAAGTCCGGCCTAAATTGTCCATTTAAAGTGCTACTCTTTCCTCCAA
> AGCGGGATACTCATTAGAGGTGTACTGAATTTTTTTAATTGAATGATGTCGTATTTAACT
> TTAAGTATGTTCGATGTTGCAAATATAATCGAAACAGTGCCAGTTCATGAATGATAGTCT
> ATCTGTTTAGCGAATCCATCACTAAGTGACGTTAATGTGATTTTATTTACATGTGAGAGC
> CATTAGTTATTGGATAAAAATCCTGACAATTTGAGCATGTCGGAACTCAGTCTAACGGAT
> GACGTCTAGTTCCTACTGTTAAATCATCGATTACATCAATGTACCAAAATTCCCTCTGTC
> AAGAGTTTTGCGGGAGTCATAATAGCAACACCGTGTACCATGGTAGTCAATTATGGTCTG
> GACACTCGAACAATTTCATACTGTGTATGTGGCCTAATGTGCTTTCGACCCAAGGGCTGC
> CTTACAATTTAGATTAATAGAAACCATTAATAGGGTTAAACACCATGTTATTTATCCCGA
> TAAAACTACGATTGAGGTATCGCATTGCTAAGGACATGAAGCAAAAGACACTATGTGTCA
> GGCAACTTGGGTCAAGACAGTCCACACCTCCTGCGATGTTGCACGCTCCTAGTCTAGACT
> AACGGTTCCTAATTGTAAAACTCTAGAATATATGGTCGACTCTTAGTTAATCTTGAATAC
> CTTAATGACCACAATGATAGTTGCATAGAGGATGTGAACTTGTCGTTACTCGGTCGCTGA
> GGCACAAGCGATGTTACAGTTTTGAATTCATTTCACGTGGTCCATCGTCGATCCTGTCTT
> GAATCAAAAGGTAACCGTAAAGATTTCAGGTCGCAAGGCCGTTTCACTCGCTGTCAACTG
> TTGATTAGCATAACCCATATCCAAACAGTAACATACGCGGCTATACGAAAGATCTTCAGA
> CCTAATGTAGCTGAGGCTTGTAGATCCCGTCACCTTAGAATTCGAATCCACACGTCACTT
> ATAATCCTAAGGGTGTGGTGTAGTGAAAGACCGCCGTCTCATTGTGCCGGTTTATTCTGA
> CGTTATTGTTAAAACAGTTGACGTACAGATGATTGAGAAATCCATTTGAATGCAGTTATA
> AGATGATTCGACGAGTTTTTAAAACCAGCATAAACGGTATCCCGGTGAAATCTTTTTCCA
> CTCAGTCTAGATTCAAAGGTTGGAACAAAAATTATCACGAATTTCTATGATACGCATTGT
> GTAGTAAACATCACGTTCGTCGCTTACGTGTGTTTCTGAGGAGTAATCTGCATTAAATTT
> GAAGGCTAGCCTCGTATTTGCCAATTATTCTTTTCGATCACAAACCACGTGCTGCGTAGT
> TCTAATGGGACAACTCCTACTTAGCAAACAGTAGACAAGTTTGGAACGCATATCTTCAAT
> TTGAAGCCAGATTATCCAATGGTAGCACATACTTGTTGAAAATAAAAACCCCCACATGAC
> AGTAAATAAAATAGCCAAGTAAGCATGTTTATAAAGCATGTATCCTAGATCAGCAATTAG
> TGGTATCTACATATGCACTGCAACTCGTACACGATGTCGGTCATAAATCTATGAAACACT
> TACTACGAATACGGGTTTGAACGGAATTAAATAGTCGAAAAATTTAAATTCGTCGGTAAC
> GCAGATGTTGGTTATCCTCTAATTGGATATACGGATCACTAGGAGAGAGGGATGGACGCG
> TCGGTTACAGAGTAGCCAACACTATAAAGACGCGCAGCAAGATGGAGTAATTTCCACTAC
> TTCACCTCGACCAGCAGAAATAAAGCTGTTATTATACATCGGGACATGAAGGTTTTATTC
> TTGTGTATTAGACATCTTACATCTGTTGATAGATTGGGCTTAAAACGTTTTTGTATTAAT
> TGTATCTTAGAGTGTCATCTTCTCAGTTCTGCGTAGCTGCTTCAATGCGTGCTTCCTTCT
> TCTCCGTATACCGACATCAGTTAAAATTTGTCGTACTGCCGACACTTACGAGATTCCAAT
> TTAATATGACAGTTAAATGCGCGTGCGCTTTCAAACCTCTATCAGGATAGGCTCCTTCGA
> CCATGACGCGCTCTGAGAGGAAGTACTATTTGTTGGTGCTGAGATTTAAACTCCCCCCAT
> CCACTTGGGATTTAGATTCTTCTAATCACGGGGAAGCTCCCAAGCGGTCTTCATGGAGTC
> TCAAGGCTGGACAACTTAAAATCTGTTATCGGAATCACTTTGTCGGCTATATTAGGTGCT
> ATTATTTATGCAAGATGCGACATCTTACTTTCATGGCAGTTCTGTCAACAGCCAAAAAGT
> AATCAGCCGTAAATAAATCCCTTGCGTGGTAATGGATCCAGAGTTATTCGTATTCCTTTA
> TGAATCTGATTAAATCAGCATAGCAGAGGAAGCACGTGACCTTAGCACATAAAAGTATTG
> TTGCGAATGATTGTACAAGATGTAGTGGCAGTTTATGATATTAGTTGATCAGAATAACGA
> GATCGCATTGTAATTAATCGAAGACATGACTCATGTAGTTACACCTGACTTTTCAGTTTA
> TACAGAATATTCCCTTACGTAGGTTTTTTTGTTAAAGCAAAATTTACTTCGCAAGTCTTT
> AAGGTCGGGTTTTTCTATCGGAACACAGCTCTTTACTTATATAACCTCTCTTAGGTCTAG
> ATTATGGTAATAAGTTTTAATATACCTGGAAATTATCCCCGTCCAATCAGAAGATCATAC
> CCATACATAGGTACTAGCGAATATGTGAGATTGTTTATTGTTTTGTCTTCTGGGGAATCA
> CCTTTTGGTCCTAATATTATGTAGTGACATTATCTAAATTATTCTGCATAGATTAATAAC
> CAATGTTGGGTAATTCTCTGTCGAATACCTCGTTCTCTATCTGAACTATATGTTATTGAT
> AATGTTACGCTCATTCGGGTTTATTCGCTCACGCTGCGAATGTAACTTCTGGTACAAGCG
> TTCGATGAATGCCACATATCTAGAACAAATGACAAAATTGTTTATTTTTAGTAGCTCATA
> GTTGTCCTCAAGTTCTGACCACAATATATAGCTTACCTAATGGCGGAACTTTGAGTGCGG
> GCTACCACAATATTCGATGCCTGAACTCTTCGTACTGAGCCGCCATGATAGGCATGACAC
> TAAGATGCTACTCTCCGGCGCATTCGGTAATTTGTCTAAATCCGTTGTGTTTAGGAAAAC
> GAGTTAGCGCTCGATCTTTTTATTCTGTGCGTAGGTAACGTTGATGAATGTATCTCCAGC
> TCTGGAATTGACGCAGAGAACGGTGACCCTCAACCATAAGGTAACAAGATGCGAGGGTCC
> TTTATTCAGCGGCTCCTCGCTCCTGCAGCGAATTATTTCGGAACATTACTGGCTTACATT
> GAGCAAGTTCCAAATGGAATCTCCTACCAAGTGCCTAATGCACGGGTCAGAATTTCGGAG
> ATCTAATATAAGAGTGTCTTCACGGAAACTACTTATTGATCCGATGACGAAACCTAACAG
> TAATTCACTCCGAGTATATTTCGTTTTAACCTTAACCAAATTCTGTTGTTACCATGTTAC
> CGTGAAGGAGCAGGTTTCCCCGCCCAGTATCCCTTTGTCTCTAGGCTTCAGACTTAATCT
> ATTACGCGACTACAACTGCTTTGGGTATTTAAGTCGTGATGATAGGTATTGGGTAATTCT
> GTGCGAGCACTTTTAAACATTCACGGTCGCGTTCGCTATCGATTCCAACAATTTTGAGTA
> AGATTGCTTCTGTGATTTGCGAACGGAATTAGCCTAATCGATTATAGTCCATCTTAGAAG
> CCTAATTTCTTTTCCATTTCCCCTGAAGACTCGAAGGCCGCTACCGACTACAGTCATACG
> ACATTTATGAGCCGTGATAAAAGTGAAGGGGTCCGCCTTGACAACACATTCATGGAAAAC
> TATTTAATTAAAAAGTCTGATGATTGTCTATAGTAGGGCCCTCAATTGCAATTTGAGCAC
> ACTAAGCGATCTTATGACAGATGACAGAGAAATTGTCGTCTACCGGTTTACCTGGAAATG
> TCTAGACTAAAATTTAGCAATTCTAAGTATCAACATTTAGTTACCGTAACTGGGCAAGAG
> ACTGCATCTATTACCGCTGAGTTCTAGGTGAGATACTTTAAATGGAGTCCCCACCCGGAC
> AAAAAGGAATGTTGTATACAATGTTCAGTTTGCTGATATATCGTTCACGGGGTTGATCTG
> ATTAACTAAGATATAGGATTGCTTTTCTAGAAAAAATCGGCTATTAAGACCTGTATATTA
> TATCGACCCGTTAAACTTCTCAAATAGGTCGATATAAGCTCGATCGTCAAGTTATATGCG
> TATTGTTTATCCTGTCCAGGCATGGCATTAAGAGTTCGTGAACTCATACGATCACCCACT
> GTACTTTACATAGAGAAATTGTTACTATTCTGATTAAGCCCTAACCTAATCTCCGAGATT
> ACAACCTTTATAACCAACTACATAGTTCTATGGAACAAAAACCGCTTTTGAATTCGCCCA
> CACCCATCCGGTTTATCACCTATTTTATACCAAAATTCTACTACAGCCAATTGTACCACC
> TGTACTTTTGTCTAAACGCGTAAGTGCGAGCGGGAAAACATTTTCGTAATCTGATTCACT
> AATTTTAATCACTCTGTAGATACCAACAACAGTTTTATAGGCCTTAATCGAGTATGAATT
> TCCATTTCTACTGACTTGCTGAGACACATTCACTGTATCCTTACAAAGGAGTATTTCTAA
> TGCACTTACTGATGACATTTACCCATGATTTAATTATGCTACGACGTAAGTTGTAAAAGT
> ACGAGTCTTTTAGTCTTTAGATATTTATATATATACTCCTGGCGAAATTAATACTAATTG
> AAGCTGGTTTTTAGATTAAGGTGGGGTACTGTTATAATTGAAGACCTATTTGCTCTTCCA
> TCCTTTGTAATTGTACCGAGTGTACGATACACTCAGTCTATAAAGGAATTAGTACAAACC
> ACGGAGCATTCAAGAATACGATTGCAACGCATGCTAGCTTATCATATAAACTTTAAACCT
> CGATGGCATATATTATGATATGACGTGTCTCACCCTACTTTGACTGTTAAAAAATGCTAC
> TGGCACAACAGTCCCAAGCTTGACCTAATACATGAACTCGATGCAGATCGTATCCGGTGT
> ATTTATCTCTCAGAACACGATCTCTACTGATGCACCCAGTAGATTTTTCTTTCTATGTGA
> GGTTTTTTTGCGACAGTACAAAGCGGCGATATAGTGAGTTACGACTGTCAGTCGAGAACT
> GGTTTATAGAAAAGTTGTGTTCTTCTAGCACCATGATTATTAACTAGCTTTTCACGAGGT
> TTATGACAATTCTAGCATTAATCGTCTAAAGGCCCGTACTTCTCTGCGCTGGCTAAAACT
> GAGACCCTCTCACGCCGCTTGTAGGTGAACTAATGGTAAGTATCCTGTGCCCCCACAGCC
> ATGCATCCAATGTCTGGATAAAACACATCACATTGACACAACATTTGCATAACTAATATT
> CCTAGTAAATATATTCCTTTGACTACCCCCACGTTAATGTACACCATGCGGCATTTAAGC
> GCGATATTATAAGCATTTATCAGTCGATTACTGTTTGCTCACTCCGCAGACTTCCGCGTC
> TTCGTAGCTTCAATTAATGATTAATCTATGAGCTAGTCGAATCAACACCAGGTTTATGTA
> TGTTATTTACGTAATACTGTAGAGATCCATTGTATTGATCTTTATGCTCTTTACGAACCG
> CTTTGTAATTACGTTCGTAGCCCGTAGAATTCAGTCAACAATATTCTTCTGTTGCCTTTC
> ACCTACTTTCCAGGTGAGCTGCCAGTCATAACCGAATTAAGTCTCTCTGAATAAGTAACG
> CATTCTATGATGATGAATCGTTCCAACCCGACGAGTTTCTACAATATAATACTAATCCTT
> AACTTAATATTTGTTTAGCTTGTCGTCCTAACTCAATCCGTCTTCAGTATAAATATGGAT
> GCGTATAATTAATACTGGATCTCGAAATGAGTCCTTAATAGTCTAAACGTATTGAAGACA
> GGCCAAGCAGGTAATGACATATACTTTCAGCGGATTTAACAAATTCGTTAGTATGCTAGA
> TTACTCCCCGACCAAAATCTAGTGTCCGACGTTACTACGTTATCAGTTTCTACGATGGCA
> TAATGTAGCCAGATTATTTGTATAGTCTTAAATTATATTTATAGTCAAGTATACCTACAA
> TCTAGGACTTTCTTAATATTCTGGGTAAGTGGGACATAATCACATCAGCAGATATAGTAT
> AAATCAACTCAAAAGAGAAATGCTCGTGATGTTGTACTACCAGCAATAACGAACGATAAA
> TATTGGTTTTTAAGTAGACTACTTTTTGGCGGCCTATATCACTTTCAACGCTTATAACAC
> TTGGCCAATATTGATGATAATTGAATTTGAGATTTTGGCACACACGATTGGCACATGGAT
> GACCCTATGTCATTAATTTATCGCGAAGGGGGATACGTTGGCAAACCGGATTACAAATAA
> TTTCATTGTTATAGTATATGTGGTATCATTTTATACTTATTACTACCCATTGCCTAAATT
> TGGTTCCCACCTAAGTTAGAGCATGATCATGACGGTCGTATGACACGAAGTCATCTTATT
> TGTTATTAGCCGCTAACTGGTAAAGCTCGGGTTATAGCGGATGCTTGATCAGTTGTGCAA
> TATAACCTTTTATAAAGTATGGTTAAAGTTACAAAACCTAATTATACTGCTAATTGGAAC
> TATATGAAGCCTGTGAACTTGAAGATATAGCGAAATAAGAAATCAATGCACCGGCGAGTA
> TGCTAACTTGTATGATGTAGCTCAGATAATCGTCATCCGGGGAACTAAAATAAATACGCG
> GACGTAATATCAGCTTAAATTGGAAAATAGATCAGTTCGGTAAACATGATGTTCTGATAA
> GACACTAGCCTATTTAATTTTGGTCCGATGATAGTAGCGATAGTATCCCCAAGGATTTGT
> AACATGTTATATATGGCAGATAACGCATACATTGTTCATGCGCGATCCAGGGAAATCTAA
> ACTTATCAGTATAACGTCAAACTTTGCAATAGTAGACTTTACCTCGTCGGTATATATCGA
> AGAACGTGCATTACCAGGTCAATACCACTTTCCTCGTAGTTAATGGGCCATTATACGATG
> TACAACCTTAGTAGAAGGTCGGGTCACCTAGGAGAAAACATTCCCTATACGTGTAATATA
> TCTATATACGTCGGCACAAAGTGTGGTCTAATGAACTTTTATGTGACGTACCCACCTTCG
> GTTAACGACTGGAGATGGTGTCCGGTACGAAGTAGAACTGGCGCAACGCCAGACTTTAGG
> TTGTAAGATATTCATGCCAATTCCAGATATAAGCAGGAATGAGTGGCCATTAGAATAATA
> ATTCACAGCATATCGGGTATCGATAACCTTTTGAATTCCTGGGCAGGTTATGGCATAAAA
> AGAAACAATCTGAAAGATGCGGTCCTACTTGCGAAACAGATTTGTCTTAAGATACGTAAT
> CAAGCCTATTGACTTATCAATATCGGTATACACAGAACACATCTAAAATTACAGAATAAG
> GTAGATATGTCCATATATTTCAAATACACTGCGTTGAGAGGGGGGTCGTGTTCTGACCAT
> CTCTATGTCTGTAGAACCCTGGGGAGCATTTTCACCCCCTTTACTTGGTGACATTAGTTC
> ATTCCTTCATTTACAATGAACATCAATACCTGATGACACTAGCCTTGACGTCAATATTCA
> TGGCGGACTACTCTGACACGGCGGATCAGTACACAGACACATCCCAGCTTTTGGTTACTT
> GGTACATTACTATCGTTATGTGTTTTTAAAAGGAATCCCAAGAGATACCGTTAAAAAGCA
> GATTTCTCTCTTTCGCCTACATCTCAAAATTGCAAATGTATGAGTAGGTTTCTAGGTGAT
> TTACGGAGGCACCCGAAGTTAGGAGATTCAGTGTTTTGATCCTGGACCTCAGCGACTCTT
> GTTTAAAGAGTTGTAAATCTCCTAGGTTACAATTCCCTGCATACGTAGTATTCCCGACCT
> TAACTAGAGTATGAACGGTCATGAGTGAGGTATTCGTGCCTTGAAGAACCTATAAGAAAT
> TCAAATTACGCACGGAACAGTTAAGTCCTGTACAAATGGCAAGGTATGCGTCTTCAACGA
> GTTAGTATCTAGATACAATTAACTATGAGAAACGAAATACTAATCTGTAAATATCGCTAA
> ACGGGACAGCAAAAACACCTAGAAGTCATGTCCAAATAAGTAACGTATGGATTCCATTAA
> TTCGCCGGCTAAAATAAAGTGTCCTCATGCATCGATCTATATATCAGAACCATACGCATT
> CATCGAAGTTATGAAGCCTCATCTCTTTGTTGAAGAGCTGTTTTATTCCTTTTGGATAAC
> CCATGCTTTTGGCTAACCATGACTGGATATGACACTTACGTTGAATTTTCTCATTCGACC
> GGTAAAACTTGCTCCTGCGTGGATTAAATCAATGCTTTAAAACTATATCGCGAGCGTTTT
> ACCGAGAAGTTATCCGATAGACTTGAAAATGTAGGGAGGCGTCACCCACTCTTGCCCGTA
> CTATCTCAAAGATAGTATCGAGAAGTCCCCAGCCATGTGCTTTGATTTTTGTTGTATCAA
> AACGATGTAGGTCAACCTTAACCCGTCCTGATATCTCCACCCGCACAGTGGAAGAATCAT
> TTAGAATTGGTGATTGTGAAGTAATATACAACCAAAGATATTTATAGACTCGATAAATAT
> CAATGGTTTAAATTACCATTTAGGCTTTAATCGACACAAAAATCATGATTGACGACTGGT
> TTATAAATTCAGTCAATCGAGAAACTTGCTTCTGAATCCCCTTCATTTATACTGTCTTAA
> CAACTACCGCGCAAGCTGACAATTTTTCAGTGTAATTGATCACTCGCCCTGACCTCATTT
> ATCTGGAATACCAATTAATCTACAAACCCTCTAACGTTTTACATGGTTTATCCTAACGGA
> ACAACCACTTACCCCCTAGTCGGATCGGGGTATCATTATCTGTAGCTAATGGATGATAGG
> TTAAAATGATTCATCACTTAACAGTTTCCCACCCTTACGGTGTTATTTATTGAACCGTCA
> TTTGTTAATAATAATATTAGACTAGAAGAAGTTTTCCATCGATTAATTCAAGTATGAGAC
> GGCACTCCAGGGGTTTGAATCAGGCCCGACCTTATGAAGATGTCAGGGCGGTTAAACCTA
> ATCTTCCAGCGGAAGTCCGCACTGGCAAAACTCCTTAGCTGCTGAAGCTAGACTTTATAG
> CGTATACCATCCTGAGGAACGCTAAGATCCTATGTATAATGTTCTTATATTGTTTGACCT
> TATATGCAGTTTTTCATCTGGCAATAGCCCTTATACATGTCTCAATTCAGGTATCAAGCA
> ATAGATTACTTTTTTCAAAACCATATTTGCGGCATAAGCCACATCCACCACCAACTTCTA
> TAGTCGCGTGCAGGGGAGTTCCCGCGGTCTACAAGCAGGAATGGTCAAGTTGGTCAAATG
> TCGTTGCAAACGTAAACTCTTGATACTAATCCTATGTAGGCCACATGCAATGTTTCTGGC
> CATAAGTTCATGGCGTCTGGTAACTCCGGTGATAATTAGGAGATTCACTGCGCCGATATA
> ATTACGAACATAAACTCAGTAAGAGAATTGAACCGTAGACCAAAAGGGAGTCTTTAGGAG
> TAGGCTAATCTATCCATGTGGTTTCACGCAGGGGAATAAAAATACTATTCCCAATAACAT
> AATCCGAATAACAACAAATGTAGACTCAACGAATTTTAATGTTAGCGTATGGCTGCTGCA
> GCAGTGTACGTGTCAGTACACTATTCTGTGTAATCCAAAGAGGCGTTACTAAGACGAATT
> TCTACCTCAGGCGAGTGGATCTATCGAACATATTTTCCGCCTAGTTTACAAAACTTCAGC
> AGAGCTTAAAAGGTCAGCAAGGGTTGGGAACGACATCGTTGGGAGATACCAGTGTTCAGG
> GATTATCTGTAAAACCAATCTGCTTAGCCTTTTTGAAAACCCAAAACAGGTGTGGTTGCA
> GAATAACACCTGAAATTTATGTTACCACTTTGTACGTCCTAAGGGGCTTGAGTATTTTCA
> TGGTTATCTATTTTTACTCATAAAAAATGAATATAATTGGCCAGGTCAGGTCTGGATCAA
> TTTTTATAAAATCATATCATCAAAGCTAGCCATACAATCCAACGAAGCGAGATCTGTTAT
> AGTACTTGTCTATATCTAACTGATATCTTATCCACTCTGTGCTAGACTACCATTTAGGTA
> GAATATGCTATCACAATGCTAGCCAAGATCTCAATGACTCGCTGACGTGATACTCTTGCT
> GTTTATCTTATTGAATATGAACCCCAAGAAAAAATCTATAGCGCATATGTGGACTTATGT
> TGGCAAAGGACTCCTTCGACCATTATTTAGTGAATATTTACTTATTATCTTCCTCCGTTG
> AAATGTATTTGACGTATGAATTATAGGAGTAGGCTAGTAAATAAGTCACGTTGCAATGAT
> CGATTTGAGAATTCAAAGTTATCAAGTTCTCGTTGTCTGTGTGTCTGCCCTTACTGGAGT
> AAGGGCCAGTCGGAACCCATATCTGGGTCAGGATAGTGATTGTTAAAAGTCGGAAATCAA
> CTAGTTTTACTACCTTCTATTACTATGATGGCCCCATGGTGAGCCCGGACCAATGAAGGA
> ATGGCATATATAGCAGGGTACTTTGGGAATTCCGAGTAGCACGTACCAACCTGTTTCTAA
> GATTCTGAGATTTGGTAGTAAAAAAGCTAAAAAGTCATATTGTATCTTGCAGAGGAAGCT
> TAGAGAACTTGCAGACGCTATAATTCTAGGTTACGCTTCACATACGGATTTGCTACGCGG
> TGCAACTGATATGTATCTTTTTTAAATCGCAACCACATTTAACCTTTATTATTGGTATAT
> TGCGTGGTATAAAGATATCGCGTGGCGGAATAGATCACTGCTGTGGAGGCCGGCTATGTT
> TTATTGGGGATTTCCTATCTAACAGGCTATATCCCTTTCGTTTCGTAACTTTATCCCAAC
> ATCTTATGGGTTATTTAATAGTCCCATCCTAAGTTGCCAATAAGTCTGAATTCCACCGTC
> TTAGTGGTGATGAAAATATTTTTATGTATCATATTGTTAAGCCAGTTGCAGGCAACTGAT
> TCTCTCTCGCTCGTTCCTTCGACGACAGTAAAGAGCGATTTATAATAATATAGCTTCTAA
> GTGATTGACACTTCCTATGAGGCTGTCCTGATTATTGCTCTCGAATCATTAGGCTCTAAC
> TGAACTCTGAACAAAAATAGGTCAACGTATGTTAATTGCGATTTTTCTACACTCCCTGTA
> TATGACTGTGAAATTGATACATTATGAACGAAATCACAAACGTGTTGGAAAAGTTAGCGC
> TAAGCTCACGCACGCTTTAGGCAGTTAATGATGGGCGTTCGTAGCTCTAACCCTAACGTG
> TTATGCAAGATCTTCTATGACTGCATCCAGTGTCTGCTAAGTCCCGACTATTGTCTACAT
> TTATACTCCTACGCTTGCCTACTAAGCGGCTTTCTAATTACACCTGGACTGATGTGTTTT
> AAGTGATTGTTGTACTTTTTAACGTGATGTTGCTTAGATCTGGAAAATATTTGACAATAA
> GTGCCTGTTAATGATGCATTCTCTAGCTGGTTAGCCATTCCTTCACTAACTGACCTTAAT
> GTGATTTTAGTGTCATGTCTCTGACTTTAGGTTTTGGATTAAATTACTGAATTGTTGACC
> ATGTCGCAAATAAGTCGAACGCATGTAGGCGTGTTCCGACTGTGTAATAATCGATTAAAT
> AAATGTAACAAAATGCCCTCTGGCTAGTGTTTGGCGCCTGGCATATTTGCATAAACGGCT
> ACAATGCTACTAAAGTTGGGTCGGGTCAATAGAACATGTTAAGTATGTGTATGTGGCCTA
> ATGTGATTGCGACCCTAGCCCTCACTGACTATTTAGATGAATAGAATAAATTTTTACCGG
> TATACTCAATGTGAGTTATCCAGAGATAAAGACGTTTGAGGTATCCCATTGATATCGACA
> TCAACCAAAAGTCACGAGCTCGCAGCAAAATTGCCTATACACAGTCCACACCGCATCCGA
> TCTTCAAAGCTCCGACTCGACACTAAAGGTGACGTAGGCTAAATCTATAGTATATTTCGT
> AGAAGCGTAGGTAATCTTGTATTACTGAATCAACACAATGAGAGTTGCTTACTCGATCTG
> AAATGCGAGTTTCTACGTAGATGTCGCAATAGAGAGCTTACTCTGTGCATTTCTTTTCTC
> GGCCTCCAGACTCGATAATCGCTTGAATCTAAACCGATCAGGATTGAGTGCACGGCGCAA
> GGACGTTTAAATAGAGGTAAAATGTTGATTACCATAAACCAGATCAATAAAGTTACAGTA
> CCGGCTATAAGAAACATCTTCTCTAAGAATCTAGATGAGGAGGCGAGATCCAGTCAAATT
> ACAATTCGTATCAACAACTAACTTAGATTCATTAGGGTGTGCTGTACTCAAAGACAGAAG
> TATAAGTCGCCACGTTGATTCGCAAGGTATGGTGTAAACAGTTCACCTTCAGTGCATTGA
> GAAATACATGTGTATGCTCGGTTATCATGAGTACTAGAGTGGTTTATTCAAGCTGATTCG
> GTAGACCGGTGATATATTGGTACACTCAGTCTAGATTAAAAGGGGGCATCTAAAATGTTC
> TCCAAGTGATATCATTCGCTTTCTGTAGTAAACATCAACTTCGTAGATTACCTGTCTTTC
> GGTGGTGTTTTAGCCTGTTAATTGGATGCCGAGAATCCTAGTTGCATATTATTCTGTGCC
> TGCAAAAAAATAGGCATGCGTACTGCTAAGCCGAAATAGACTACTTTGCAATCAGTAGAA
> TACTGTCCATCGCATTGATTCAAGTGGAAGCAAGATTATACTAGGCGACATAATTCTGGT
> GCTTATTTAAAAACAACTCATGACAGTATTGAATAGAGAAAAGTAAGCATCTGTATAATG
> AATCTATAATTGATCAGCAATTACTGGTAGCGACTGTTGCAATGCAAAGACGACACGATC
> TCGCTCATAAAGATATGAAAAAATTTCGTCGTATTCCGCGGTGAACGCATGTAATTACTC
> CTAATAGTGAAAGTACTCGGTAAACCAGTTCTTGGTTATCATCTAAGTCCTTAGACCGAT
> CACGACGTCACAGCGTTCGAACCCTAGGGTACAGACTTGCCTACTAGATAAACTCGCCAT
> GATTCTTGCAGTTAGGTCATCTAATTCTCAGACTCAACATCTTATAAAGCGCGGTTGAGA
> ATGCGGGACATGTTGCGTGGTTTCTTGTGTATTTCAAATATGTCATAGGGGGAGTGATTC
> CGATTTAATCGTTTTGCTTGTTAGGGGATCTGAGTCTGTAATCGTATCTCTGCGGACTAG
> AGGCGTATTTCCGTCATTACTTCTGCGACCGATACCCTCATCAGTTAATATTGCTCCTAA
> TGCCGACAATTAAGACAGTCCATTTTAATATGACTGGTTAATGCGCGGGCGCGTTCTAAA
> CGCTAGCTGCAGAGCATACTGCCACCATCTCGCGCTCTCAGAGGTAGTTCTATGGGGTGC
> TGCGCTGTGGTAAACTCCACACAGCCACTTGCGTTGTAGAGTCGTAGAAGAAAGGCCAAG
> CGAAAATGCGCTCTTAAGGGACGCTCAACGCTGGAATAATTATTATATCGTTTCCGAATA
> ACGGTGGACCCTATATGTGGGGATATGAGTTTTCAAAGAGGCGAATTCTTAATTGCATGG
> AACTTCTCGATTCTGACAATATGTATTCTGACGTAAAGAAAGCACGTGCGTCCTAAGGGA
> TCCACAGGTATTCCGATTCATGTATCAATATGAGGAATTCAGAATAGAACACCTACAAAG
> TGACAGTAGCAAATAAATGTTTTGGTCCCTATGATTCTAAATGATGGAGTCCAACTTTAT
> GAGTTTTGTTGAGCAGTATAACGAGAGCGCTTGCGTATTAAGACTTGACATGAAGCATGT
> AGGTACTACTCTATTGTCAGTTTAGACAGATTAGTCACGTACCTTCCTTTTTTTCTTTAT
> CCTAAATGTACTTACCAAGGCTTGAAGGTCCCGTTTTTCGATCGGAAAACACCTAGTGAC
> TTATAGTAAAGCTCGTACCTATAGTTTATCCTAATTAGTTTTAATATTAATGCTAATTAG
> ACACGTACAATCAGAAGTGCAGACCCTTTCATAGGTAAGACAGAAGTTCTGAGTTTGTGG
> TGTGTGTGCTAGGATCGGCAATAACATGTTGGTCCTAATTGTATGGAGGGACTGTATCTA
> TTTTAGTCTGCTTTGTTTTTGTAAAAATGTTGGGGAATTCTCTCTAGTATACATAGGTCT
> CTATCGCAACGAGTTGTTATTGATTAGCTTAACCTCAGTCCCGTGGTTTCGCTCACCCGG
> CGAATCGAACGTATGGGAATAGCGGTAGAGGAATGAAACATATCTTGAAAAAATCAATAA
> TGTCTTGAGTGTTAGTAGCTCATACTGCTAAGCTTGTGATGTCCAATATAGAGACCTTAA
> CGAATGGCCGATATGTGTCTCCCGCCGTCCAAAATATTCGTTCACGCAACTCTTACGTAT
> GTGCCGCCATGATTCCCATCAAAATATCAGGCTAATCTACGGAGAAGTCCGTTATTTCTC
> TTTATCCCTTCTGGTTTGGAAATCGACTTTCCCATACATATTTTGATGCTCTGCGTAGCT
> AAACTTGATGAAGCGATCTCCTGCTATCCATTTGAACATGAGAAACGTCTCCAGAAACCA
> TTAGGTATCAAGAGGAGACCGTAATTTATTCAGACGATCATAGCTCAGGAACAGATGTAT
> GTCGGTTAATTAATCGCGTAAAGTCACAATGGGCCAAATGGTATCTCCTACCATCTGAAG
> TATGCACGGGGCACTATTTCGCAGATATAATTTAAGTCTCGCTGCAACGAAAAGAAGGAG
> TCTGAAGATCAAGTTTACTAACACGAATTAACGCAGACGAGATTTCCTGGTTACCGGAAC
> AATTTTCTGGTCTGAAAATCGTTCCGGGAAGCACCACGTTTACACCCAAAGTATACCTGT
> GTCGCTACCCTTAACAAGTATTATATTTACCGTCGACAAATCCTTTCCGTTTTTTAGTCC
> TGAGGTTTCGTATTCGGTAATTCTCTCCGTGATCGTTGATACAGTAAAGGTCGACTTAGA
> TATAGTTGACAACTATTGTCACTAAGAGGGCTTCTGTGATTTGCCATCGCTATTAGCAGA
> ATAGAGTTGACGCAATAGTAGATCAATATTTTCGGTGCCTGTTCCAAGCAAGTAGCGTAC
> GACGCTACCGTCTAATCGCTTAAGAAATTTAGCAGCCCTGTTAAAACTCAAGGCCTCCGC
> AGTCTAAAAAAATTCATCGATAAAGATGTAATTATAAAGTAGGTTCATGCGCTAGAGGAG
> CGCCATCATGGGCTAGTTGTCCAAACTAAGAGATCGTATGTAACAGGAAAGAGTAATTGG
> ACTCTACACCTTTTACTGCAAATCGATAGTCGATATTTTACCAATTCGAAGTATCAAAAG
> GTAGTTAACGTATATGCCCATGAGACTGCATATTGTACAGAGCACTTATACCGGACTTAA
> TTTAAATGGACTAAAATAAACCAATTATAGCTTTCTTGGATTCAATCTTCACTTGGCTCA
> TAGTGCCGTATCGCGGTTCAGATGATTATAGAAGATAGAGGATGGATTTGATACAATAAA
> TCGCAGATTTTGAACTGTTTATGAGATCGACAAGTTAAACTTATCTAAGAGCTAGAGTTA
> TGCGCGATCGTAAAGTGTTATCCGGAGTCGGTAGAATCTCATCCCATGCCTTGTAGAGTT
> CGGGATCGCTTACCTTCACCCAATCTAATTTACAGACACTAAGTGTGACTAGTCTGATTT
> TCACCGAACCGAATATCACAGATTTAAACCTTTAGTACCTTATACATACTTCTATGGTAC
> ATAAACCCCTGTGGAATTCGACATATCCCATACCGTTTTGAACATATGTTTTTAAAAATT
> GCTTATAAACAATAGTCTACATCCGCGACGTTTGTCGAAAACACTAAGTCACTCAGCCAT
> TAAATTTTAGTTATCTGTTTAACGAATGGTAAGCTCTAGCGTCAGAACATCAACTCGTTT
> ATACGACTGTATACACGTGCAATGTACTTGGATACGCTCTTGAGGACTATATTTCAAGGT
> TTACTTTCATAGCAGTAGTTCTAATGCACGTACTGTGGTAATTGAAAAAGGATTTAATTA
> TCCGAAGACGTTTGGTCTAAAAGTACGAGGATGGTACGATTTTCATATTTATATATTGAC
> TCCTGCCGATATGTAGAATATTTGAAGCTCGTGTTTAGATTAAGCTGGCGTTCGCTGAGA
> ATTGTAGAAATTTTGGCTATTCAATCCTTTGTAATTGGAAAGACTCTAACATAAACTAAG
> GCTAGTAAGGAAGTACTAAAAAAAACGGTGCATTATAGAAGTCCTGGCAAACGCTTCCTA
> GCTTATATTTGAAACGTTAAAACGCGTGGCATGATTGGTTCATAGGAAGTCTCGCTACCT
> ACTGTGAATGTTAATAAAGCCTACGGCCAAAAAAGTCCCAAGCTGCACCTTATTAATGAA
> ATCGTTGCACAGAGTATCCCGTGTATTTTTCTCTAAGAACAAGTTAGCGTCTGATCATAA
> ATCTACATTTTGAGTGCGATGGGAGGGTGTTGTGACACAGGAAATACAGCCGTTATAGGG
> ACTGTACACGCGCTGTCGAGAACTCCTTTTTTGATAAGTTGGGGTCTTATTGCTCAATCA
> TGATTTTCTACCTTTTATAGAGCGTTATCAAAATTCTACCTTGAATAGTCTAAAGGACAC
> TACTTCGCTCCCCTGCCGTTATAGGACACACTCTCACGCACCGTGGACCTGAAATAAGCG
> TAACTATCAGGTCACAAAAAACACATCCTTACATTCTAGGCAGAAAACAAATAACAGTCA
> CAAAAAATTTGAATAAATAATATTCCTTGTTATGTTATTCCGTGCACTACCACCAACTTT
> ATCGACACAAGCCGCATTTGTACCGAGAGTTGTTTAGCTTTTTTCAGTAGTGTTCTCGTT
> GCGAACTACGCACACGGACGCGGAGTAGTTGCTTCAAGGATGGAGTTATAGTTGACCTAC
> GAGATTCTTCACCACCTTTATGTTTGTTAGGGACGGATGACGGTAGACATACATGCTTTT
> CATCTTGTTGCGATGTAACTAACCCTTTGTATTTACGTTCGGAGCCCGTTGATTTATGTA
> AACTATTTGCGTAGGTGCACTGGCAACTAATTTCCAGCTGTCCGCCCAGTATTATCAGAA
> TTTACGCGCTATCAAGAACTATACCATGCTAGCTTGAGGTTTCGTTCATTCCCGAAGACG
> GTCTAATAGTTAAGACTTATCAGGAACGTTATTTTTGGTGAGATGCTCCTCCTTAAGAAT
> GCCCGATTAACGAGAAATATGGAGCCGTTTTTTTTATTATGCATCTCCATATGTGTCATT
> TATTCGATTATAGGTTTGTACACAGCACAAGAACGTATTGAAATTTAATGGAAGCGCAGT
> TAACTTATGAGTTAGTTTGATAGAGTACTCACAGACCAATATAGAGTGTCCGAACTGTAT
> AAGTGATAAGTTGATAACTGCCCAGTATCGTGACAGTTTATTTCGATTCGCTTAATTTAT
> TTGGATAGTAAACTATAACTAATATATTCGTCTTTATTAATTGTATGGGTAAGGCCGTCA
> GAATCTAATCAGAACATTTAGTATAAATCTACTATAAACAGAAATCCTACGGATGTTCTA
> ATTAAACCTATTACGTTCGAGATTTATGCGTTTGTAACTACAAGACTTTTGCGCGGCCTT
> TATAAATTTCAAACCGTAGAACACTGGCCAAATATTGAGCATAATGCTAGTTGAGTTTGT
> GGCTCAATCCAGTGCAAAATGCATCACACTATGTCATTAAGTTTTCGCCAAGCGGGATTC
> CGGCCCAAACCCGATTACAATTATTTTCATGCTTATTGTATTGCTGGGTTAATTTGATAC
> GTATTTCTACCCTGTCACTAAATTTGGTTAACAAATAAGTTTCACCTGGTTAAGCTCCGG
> AGTATGACACGTAGTAATATTAGTTCTGTTTAGACCCTAAAGGCTAAAGATCCGGGTAGT
> CACGATGAGGCATCACTGGTGATAGATAAACTTTTTTAAAGTTTGGTTAAACGGACATTA
> CATAATTAGACTGCGAAGTGCTACGTTATCAAGCATGGGTAATGCATGTTAGACCGAATT
> TAGATATATATGAAAACGACACTATCCTAACGTGTTTGATCTACAGCAGTTAATCCGCTT
> CCGGCGTAATAAAAGAAATTCGAGCTAGTTTGATAACCGTTTATGCCATTATAGAGCACT
> TAGCTTAACTTCATGGTATGTGAACAAAATAGCATATGTAATTTGGGGAACAGCAGACTT
> CACAGTGTATCACCTAGGAGTTGTTAATTGTTATTTATCGAAGATAAACATTAAATTCTT
> ATTCAGACATACAGCGATAGCTAAACTTATCAGTAGAACCTCAAAATTTCAAATACTACT
> CTGGAACGCGTCCGTATAGATACAAGTACCTGAATGAACTGGTCATGACAAATTGACTCC
> TTGTTAATCGGACATTATTCGTTGTACTAAAGTTGGAGAAGGTAGCCTAACATTGGACAT
> TACAGGCCAGTTACCTCTATGAGAGCGATTTACCGCGCCACTAAGTGGGCGAGAATGATC
> GTTTATGGGACGGAACCACATTCCGTTATCCTCTGCACATGGTGGACGCTTCGAAGTACA
> AATGGCCCAACCACACAAGGGAGGGTGTTAGATTTTATTGCAATGTCCTCTGATAAGAAC
> GTATGACTGCACTTGACAATAAGAATTCAAAGAAGATCGCCTTTCCTTAACATTTTCTAT
> TCCGGGGCTGGTTATGGCTTTATTTCTTACAATCTCAATGATGCCCGCCTACTTGACAAA
> CACATTTGTCGTAACTTTAGTTTTCTAGCCTTTTCAATTTTAAATTTACCTTTTCTAAGA
> AAACAGCTAAAATTAATGAATAACCTTCATAGCGACATTTATGTCTTTTAAACGCAGGTG
> TGAGGGCGGTACTGTTATCACATTAGCGTGCGATGGACAAAAAGGGCCAGCAGTTGCAAC
> CCAGTGAATGGGTGACATGTCTTATTTAAGTCAGTTACAATCAACTTCTTTAAAGGAGGA
> CAATACACTGGACCTCAATATTAAGGCCGGAATACGCTGTAAAGGACCATCTGTTCTATG
> TCAAATAACAGATGTTGGTTACGGCCTAAATTAATATCCGTTTCTGTGTTTTATAGCAAT
> CAAAAGACATACAGTGTTATAGCTCATTTATCTCGGTCGCCTTCATCGAAAAATTGCAAA
> GGTATCTCTACCTGGATTCGTGTTTGAAGGACCCAACCCATGTTTCGACATGCACTGTTT
> TGATAATGCACAGCAGCGAATCTTGTGGATTGAGTGGTAAATCTCCTACGGGTCATTTCC
> ATCAATACGTACTATTAAACAACTTTAATAGTCTATCTACCCTCTTCACGGAGGTATGAG
> TGCCTTGAACTTACTATATGAAATTCATATTACGCAACGAAAAGGGAAGTAAGGTACAAA
> GCGCTTCCTAGCCGGCTGCAACGAGTGAGTATCTAGAGTCTTGTAAATTTGACTATAGAA
> TTTCTATGATGTAAATATCGATTAACCGCAAACCTTTAAAACCTACATGTATGGTCCTTA
> TAACGAACGTAGGGATGCCATGTTGGAGAAGGCGAAAATTAACTCGCCGAATCATTCCTT
> CTATATTTATGTTACAGACGCATTCATCGAAGTTAGGATGAATCATATCTTGGTTGAAGA
> GCGCTTTGAGGCATGTGGCAGAACACATGCTTGTGCCTAAACTTCACTGGATATGAAAAT
> TAACTTCAATGGTCTCTTTCGAACCGGATTACGGGCTACTCCGTGGAGGAAATAAAGGCT
> TTAATTCTTTAGCGCGAGCGTTGGAACCACTTGGTTTAAGATACACTTGAATATGGAGGC
> AGGCCGCACCCACTCGGGCCACTTATTTCTCTATGAGTGTAGCCAGAACTCCCAACAAAT
> GTGCTTTCATTTTTCTTGTAGCAAATAGATGTAGCTCAACCGGATCCCGGCCTCATAGCT
> CAAACAGCTCAGTCGAACAAGCAGTTACAAGTCGTGATTGGGAAGTTATATAAAACATAT
> GAGAGTTATTGACGACATAAAGATATATGGTTTAAATTACCAGGTTCGAGTTTTTCGACA
> AAAAATTCATGATGGAAGACTCGTGTATTTTTTATCTCATTAGACTAAAGTGCTTATGTA
> GCCCATGCATTGATTCTCTAGTATATTCTTCCGAGAAACCGGTAAAGTTGTAAGGGTAAG
> TCTTCACTACCAATCACATCATTTAGCTCCAAGACCTATTATTCTACATACAATATAACG
> TTTTACTTCGTTGATCATTACGGTACATCAAATTTCAAACTACTAGGATACGGCGATCAG
> TTTAGGTAGATAATGGTTCTTAGCGGAATATCTTTAATCAATTAAATGGTTAAAACCATG
> AAGCGGGTATGTATTGATCACTATTTTGTGATTTAGTATAGTTGACTACTAGATGGTTTA
> CATCGTTTAATGCAAGTATGACAACCCAATCCACGCGGTTGAATAAGCCCCCACCGTATC
> AAGAGGGAAGGGACCGTATAACGATTCTTCCAGCGCAAGTCACCACTGGCAAAACGAATT
> AGCTGATGAAGCTACTATTGTGACCGGATAACATCATGACGATCGCTATCATCATATCTA
> TAATGTTCTTAGAGTGTTGCTAATTATATGCTCTTTGGCTGCTGCCATTACACCTGATTC
> ATCTATCTTTTCAGGGTTCTTCAAAGTCATGACTTTTTTAATAACCATAGGTGCGGCAGA
> AGCATATTCATAAAAAATAGTCGATTGTAGACGCAAGGGGACTTACCCAGCTATTATTCC
> TCCAATCCTAATGTTGGGATAATGTAGTTGAAAACCTAAACTATTGAGACTTAGAATATG
> TAGCCAAAATGCTATGTTGATGCAAATTTGTTCTTGGAGGATGGTAAATCCGCGGAGTTT
> TTGGTCTGTATCTGACCACAGAGAATTAACATCAGAAAAGAAGTAACTGATTTGTTCCGG
> ACACCAAAAGGCTGTCTTTTCGAGTTGGATATTCGAGCAAGGGGGTTGAACGCAGCGGAA
> GTTTATGACTTGGCCAATTATCAGATTCCGTAGAACAACTATTGGTGTATCATAGAAGTG
> GTAGCTTAGAGGAGGCATGATGAACAACTCTACCGCGAAGTTAACTATGCGGTGTATTAA
> ATTCAGGCCTGAATAACAAGAATTTAGACATATCCACTGTGCTTCTTTCCAAATTAGTTG
> CCGCCTAGTTTAAAATACTGAACAACTGCTTTAAACGTCACAAAGGGTGGGGTACGTAAG
> AGGGGCGTCAGACAACTGGTATCGGATTATCTGTATATACAATATCCTGAGACTGTTTGA
> AAACCATAATAACGTGTGGTTCAACAATATCAACTCAAAGTGATGGGACCACTTTCTACG
> TCCGATCGGCCTTCAGGTTGTTCATCCTTATCTATTTTGACTAATAATTATTGAATTGAT
> TTGGAAACGTATCCTATGGATAAAGTTTTATTAAAGCAGATCATATATGCTTCACATTCA
> TTCAAAAGTTCAGTGAGATCTTATACGACTTCTATTTTTCTAAATCTTATCGGATACACG
> CTCTCATAGACGACATGTGAGCTACAATTTGATTTCACAATGATAGACATGATCGCAAGC
> ACTCCCTGTCGTCAGACTCTTCCTGTTTATATGATGGAAGATGTACCCAAACATTAATGC
> GTTAGACCATAGCTGCAATGATGTTCCCATACCAAGAATTCGAACATGTTTTACTGAATT
> GTTTCTTAGGTTCTTAATCCGTGCTATGGGATTGCAAGTATGATTTTTAGCACTAGGATA
> GGAAAGAAGTAACCTGCAAATGATCGAGTTGAGAATGCTATGTTAGAATGTTCTCCGTGT
> ATGTGGCTCGGACCTGACTGGTGTATGGCACTCGAGGAACCCTTAGAGGCGTAAGGTTAC
> TCATTGTTAAAAGTCCCATTTAATCTACTTTTAAGAAATTCTTTGAATAGGATGGCACCA
> TCGGCAGACAGGAAAAATGTAGGAATGCATTAGATAGATCCGTTCTTTGGGAATTCCGAC
> TAGAAACTTCCAACATGTTTATAACTTGCTGAGATGTGCGTCGTAAATAGCTTTAAAGGA
> AGTTTGTTTCTTGCAGAGGAACAGGACAGAACTTCAAGTCCAGAGAATTATAGCTTACGA
> TTCACTTTCGCATGTGCTACGCCGGCCAACTCTTATCTATCTTTTTTTTAGACAATCAAC
> ATTTAAACTTTAGTTTGCCTATAGTGAGTGGGTGTAAGATATAGCCTCCAGGAAGACATA
> ACTCCTGGGGAGGCAGCATTTGTGTTATTGCGGATGTCCTATATTACTGCCTTGAGAAAG
> TTCGTTTAGGTACGGTATCCAATAATCGTTTCGGTGATGTTAGAGTAAAATCCTAAGTTC
> CCAAGATGTCTCAATTAAACCCTCTTACTGCTGTGGAATTTATTTGTATGTATCAGAGGC
> TGAAGAATGGTGCAGCAAACTGATTATATAGAGCGCGTTACTGCCTCCAAACTTAAGAGA
> GAGTTATAATTATAGAGAGTATTAGGGATTGAAAAGTCCTATCACGCTGTCCTGAGTATT
> CCTATCGATGATGTTGGCGCGAACTCTACTAGCATCTAATATAGCTCATCCTATCTTATT
> GGCGATTTTGATAAAAGACATGTATATGAATGTGAAATTGATAAAGTAGGAACGAAATCA
> CAATACGCTGCCAATACTTTCCGCTATCCTAAAGATCCATGGAGGCAGGTAATGATGCGC
> GTGCGTACCTCGTTAAAGATAGTGTTATGATTGATCTTCTTTCTCTGAAGAAAGGGTATG
> CTTTCTCACCAAGATTGGCGAAATTGATACTCCGAAGATTGAATACTAACACCCTGTCTA
> TTTTCACCGCGTCTCATGTGTTTGTAGGGATTCTTCTACGTTGGTTAGGGATCTTGCGTA
> CTTCTGCAAATGATTTGACAATAAGGCCATCTTAAGGATGCTGTCTCGAGAGCGTTACCC
> TTTAATGAAAGTACTCAACGGTTGCGCTGTGTAGGGTCATCTCTCTCAATGTACGTTTTC
> CTGTATATTAATCTATTGTTCACATGCTAGCATATAACTCGTAAGCATGTAGGAGTCTGA
> AGAAGCTGTAATAAGCCTGTAAAGAAATCTTACAAAATGAACTATGGATACTCTTGGGCC
> CCTCGATTATTTCAATAAAACGCGAAAATCCGTCTAATGTTGCGTAGCCTCAAGACAAAT
> TGTGAAGTATCTCTAGCTGGAAGATTGTGATTGACAAAATTGCCCTCACTGAATATTTTC
> TTGTAGTCTTTAAAGGTTTACCGGTTTAATCAATGTGAGTTTGAAACAGATAAAGTACTT
> TCAGCTATACATTGCATATCCTATGCATCAAAAACTAAAGTGCTCGAACCAATATGGCCG
> ATACTCACTCATCTAAGAATCCCATCTGCAAACAGACGACTAGACAATTAACCTGAAGTT
> GGCGTTATCTATAGTTTAGTTCGGACTAGAGGTCGGTATATTCTATTAAGGAATCTAATC
> TAGCTGACGTCCTGACTCGAGCTCAAATGCGACGGTATACCTACATGTCGAAATACACTG
> CGGTATCGGGGCATGTATTGGATACGCCTAAAGACGACATAAGCGATTGATTATTATCCG
> ATCACGTTTCTGTGCACCGAGCATGGAACTGTATATACAGCTATAATCTTCTTGACCTGA
> AACCTGTGAAATTATGGTAAAGTACAGCCGATAACAAACTGATTATCTAAGAATCTACAT
> CACCAGGCGTCTTAAAGTAAAATTACAAGGCGTTGAATATACGAAAGTTGATGAAGTTCG
> CTGGGCTCGTCGCAAACACACAACTAGATGTCGCAACCTTGATGAGCTACGTTGGCGGTA
> ATAAGTTCACCGTAAGTGCATTGAGAAAGACTTGTGTTTCATCGGTTATCATCTGGACTA
> CTCTGGGGTATTCAACATGATTACGGAGAAAGCGGATTTATTGGTAAACGATGTCTAGAG
> GATTACGGGCCTTATAATTGGTTATCCATGGGAGTTCTGTCGCTGTCGCTTCGTTAAAGA
> TACGGACTACATGTCCTCGCGTGAGCTCGTGGTTGAGCCTGTTAATGGGATCCCGACAAT
> ACTAGTGCCATTTGAGGATGTGACTGAAAAAAAATAGGCATCACGACGGATTTGCCCTAT
> TAGAAGAATTTCCTATAAGTTCAATACTGTCCATAGCATTGATGCTAGGGGATGAAACTG
> TATACTAGCCGTCATAAGTATGCGGCTTTTGTATAAAAAACTATTCAATCTTTTGAATAG
> ACAAAAGTAACAATCGGTTGTATCATGCTATAAGTCAGCACATTTTACGCCTTGAGAATG
> TTCAAAGCAATAGACGACTCGTTCTCCCGAAGATAGATATCATTATATTTAGTACTATTC
> CCCGGTGTTACCTTGTATTTACTACTAATAGTGAAAGTACGACGTAAACCACTTCGTCCG
> GTTAATATTTGTCCTGAGTACCATCTCGTCCTCACTCCCTGCCTACACGACGGTAATCAC
> TTGAATAATAGATTTACTACCCATGATTCTGCCTCTTTGGTAATCTTATTATAAGACTAA
> TCATCTTTTATACAGCGGTTGAGAATGACCCAATGCTTCCGTGGTGTAGTCTGTATTTCT
> AATATGTAAGAGCGGCAGTCATTCCGAGTTTATACGTGTGCGTGTTAGGCGAGATGAGTC
> GCTAATAGTATATCTGAGCACGACAGCCGTATTTCACGCATGACGGATGAGAACGTTTAA
> CTAATAACGGTATATTGCGACGTATCAAGAAAATTTACTCAGGACATGTTATGATCTATC
> GTTTAGCACACGCAGAGTGATTTAAGAGTGCTCCAGTCCATAATGACACATGCTCCACAG
> CGCTCTCCTACGTATTGGGCGTCCTGAGCTCTGGTTTACTAAACAAAGACTATTCCGTTG
> TTGAGTAGTAGAAGAAACCCCATCCGAAATTGCGCTAGGAAGGCTCGATATACCAGCCTA
> TAAGTTTTATATCGGTTACGTATAAAGGTCGACCATATAGGTCCGGAGTGGAGTTTTCAA
> TCAGCCGTATTAGTTAGTGAATCCAACTTATCGATTCTGAAATTTTCGTTGCTCAACTTA
> TGAAAGAAAGTCAGTCCGAAGCCTTAAACACGGAGTACGTGTCATGTATCAAGAGCAGGA
> ATTAACAATAGAACACCTTCAAACTCACAGTACATATTAAATGTTGGGGGCCCTATGAGT
> CTAATTCTTGGACTCCAACGTTATGAGTGTTCTTCTGCTGTATATCCTCAGAGATTGCGT
> ATTTAGACTTCAAAGCAAGATGGGAGGGACTAAGCTAGTGTAACTGGAGACTCATTTGTA
> AAGTTACTTCCTTTGTGTCTTTATCATTATTGTAATTACATAGGCTGGTACGTACCCTTG
> TGAGTTAGGAAAACACATAGGGAATGATAGTAAAGCTAGTACCGAGTCTTGATCCTTATT
> ACGGGTTAGAGTAATCCTTAGTAGACAACTAAAATCTCAACTGCAGTAAATTTAATACGG
> AAGACACTAGTGCTCACTTTCGGGTGTGGGTGCTAGGATCGCCTAGATCAGGGTGCGAAT
> AAGTGTAGGGTCGCTATGTATATATTTGAGTCTCATTTCTTTTTGTAAATATCGTCGGGA
> TTTATAGCTACTATACATACGTCTAGTTAGCAAAGTGTTCGTATGCTTTAGCTGAACATA
> TGTCCCCTGGTTTAGATAAACCGCACATGCGAACGGATCCGAATTCCCGTAGAGGAATCA
> AACATAGATTCTTAAAAGCAATTATGTCGTGAGGGGGTGTAGAGAAGACTGCTAAGCTTC
> TGATCTAAAATATAGAGTCCGTAAAGTATGCACCATATGTCTCTCACCCCGTCAAATTGA
> TGACTTCAAGCAAATAGTACGTAGGTCAACCAATCTTTCCATTCAATAGTTCAGCAGAAT
> AGAACCAGAAGGACCTTTTTTCTATTTATAACGTCTCGTTTCGAAATACACTGTCACATA
> CTTAGTGGGATGCTCTGCCTTCCTAAACTTCATCATGCGTTAGACTCCTATCCATTGGAA
> CATCTCAAACGGCTAAAGATTAATGTAGCGTTCAACAGGACACCCTAAGGTAGTATGACG
> ATAATAGATAAGCATCACATGTAGGTAGCTTATTTTATCCAGGTATGGCACAATCGGCAA
> TTGCCTAGATAATACAATCTGAAGTAGGAACCCCGATCTATTTCCCACTGAGTAGTGTAC
> TCTCGATGCAACCATAAGAAGGAGGCTGAACATCAACTTTACTTTATCGTTTTATAGAAG
> TCGAGATGGACTGGTTAACGGATCAATTTTCGCGGCTGAAATTCGTTAACGCAACCACAA
> CCGGTAAAACAAATCTATACATGGCGCGCTACCAGTAACTAGTTTTATAGTTACAGTCGT
> AATATCCGGGCCCTTTTTTTCTACGCTGCTTTCCTAGGCCGTAATGATCTCAGTCATAGT
> GGATTATGTAAAGCTACACTTACATATAGTGGACAAATAGTGGCACTATGAGGCATTCTC
> TGTTTTCACTTACCTAGTTCAAGTTTACTGTTGTCGAAATAGTAGATCAAGTTTTTCGGG
> GAATGGTAAAAGCAACTAGACTACCAACATAAACTAGTATCGATTTACAATGTTTGCACA
> ACTGTGATATCTCTACCCCGAACAAGTCTATAATATGTAATCGTTTAAGATGGAAGGATT
> TACGAGCTTCAGGCGATAGACGACCCCAAGATTGGGATTGTTGTCCAAAATTAGAGTGAG
> TATCTAACAGCTATCTGTAATTCGACTAGTAACCGGGTAATGCAAAGCGATTGTCGATTT
> TGTACATTGGAGATCGTTAATATGGGACTTAACCTATAGCCCAATCACAAGGCTTATTGT
> AAAGAGCACGTAGTCCGCACTTAATTGTTTTGCACTAAAATAAACCTATTATTCCTTGCT
> TCGTTTAAATCGTCACTTGGAGCATAGTGACGTATAGCCGTTCTGAGCAGTATAGAAGAT
> AGTGCATGCAGGTGAGACATTAAATAGCAGATTTTCAAAGGGTTATGTGTTCGAAAACTG
> AAAATTATATTAGACCTACAGTTATGAGACAGACGATAGGGTTAGCACGAGGCGGTTGAA
> TCGCATCCCTTGCATGGTTCACTTACGCATAGATTAACTGCAAAAAATCTAATTGAAAGT
> CTCTAAGGCGGTAGAGGAGCATTTTCAAAGTACAGAATATAACTCTGGTAAAAAGTTTGT
> TCATTATACTTACGTAGATCCTTATTAAAAACCTGTGCAATTACAAATATCAATGAACCT
> GTTGAACATATGTTTTTAATTATGGCTTATAAACAATTGTCTTAATAAGCGAAGTTGCTA
> GTAAACACGTACGCACTCACCCTTTAATTTTTACTTATATGTTTAAAGATGGGTTTGCTC
> TAGCGTCTGTAAATCAAATCGTGGTTACGACGGTAGACTCGTGCTTGGGAATTGGATAAG
> CTATGCAGCTCTATATTTCAAGCTTTAATTTAATACCACGAGGTAGTAGGATAGGTATCT
> GCTATTGGAAAATGGAGGGATTTATCCGTACAAGGTTCGGCTAAAACTACCACGAGGGTT
> CGATTTTCATATGGAGTGTTTGTATAAGCCACATTTGTTGTATTTGTCAACATCCTGGGG
> ACTTTATGCTCCCCGTAGCTGAGAATTCTTCTAAGTTTGCAGATGAAAGAATTTCTATGG
> GGTAAGACTCTAACAGTATATAACGAGAGTATGCAAGGACTTATAAAAAACCTGATTTAT
> TCAAGTACTGGCATAACATTCATAGATTATATTTGATTAGTTTAAACGCGTGCCATGAGT
> GGTGCTGTGGAACGCGAGATACATAAGGGCTAGCTGAATATTGCATTAGGCCTAAAAAGG
> CAAAACCGGCTAATTATTATTCTAAGAGTTGCACTGACTAGAACCTCTTTGGTTATATAT
> CTAATACTTAGCGTAGGATCATAAATCTACTTGGGGAGTGAGTGCGCTCGGTGGTGTCAC
> TATCGTAATACACCCCTTAGTGGCTCTGTACTCGCGATCTCCTGAAAGCCTTGTGTCATT
> ACTTCGCGTATGAGTCATAAAGCTTGATGTTATACAGTTGATACTCCGGTATCAAATTTA
> TACCTTGTTTACTAGTAACCAAACGTATTAGATCCCATCCCGTTATAGGACTCAATAGAA
> ACCACAGGCGACCGCATATTAGCGTAACTAGAAGGTCAAAAAAAACAAATCATTAATTTC
> GAGCCTGAAAAAAAATAAAAGGCAAAATTAATTTCAAGTAAGATTATGACTTCTTATGTT
> TGTACGGGCACTTAAAACAACGGTAGCGTCACATGCACCATTGGTACCCACTGTGGTTTA
> CATTGTTTATCTACTGGTCTCGTTCAGAAATAACAACAAGGAACCGGAGTAGGTCAGGAA
> AGGATGCAGTTATAGTTCACAGTCGACATTATTAAAAACCTTTATGTTTCTTAGGGAAGG
> ATGACGGTTCACTTACATGCTTTGCTTATGGTTCCGATGTTACTTAACATTTCTTTTTAA
> GGGAGGACCACCTTCTTTTATCGAATCTAGTGGAGTAGGTGCAATGGAAAATAATTGAAT
> CCTCTCCGCAAACTATTATCACATTTTACGAGAGAGCAAGTTCTTTACAATGCGAGCTTG
> AGCTTTCGTGAATTACAGTACTCGGTCTAATAGTGTTGTAGTTTAAGGTACGTTATTGTG
> CGGGTGATGCTCCTAAGTAAGAATGCACGATGATCGTGTTATAGCGAGCAGTTTTTTTTA
> TTATGCATCTACTTATCTGTAATTTTGTCGATTTTACGTTTCTTCAAAGCAAATGATCGT
> TTGCAAATTTAATGGAACAGCAGTGAAATTATGAGGGTGGTTCATTGAGTAATAAAACAA
> CATTTGAGACTCTCCCAACTGTATTACTGAGATGTGGAGTACTGCCAAGTTTCGTCAAAC
> TTTTGGGCGATTCGAGGTATGTTGTGGGTTTCTAATCGTGTAATAATATATTCCTCTTTA
> TGATTTGGAGCCCTATCGCCCTCAGAAGCTAATATCATCTTTTAGTTTAAATATAATATA
> AACTCAATTCCTACGCTTGTTCTTAGTAAACCTTTTACGTTACAGATTGATGCGTGTGTA
> TCGACAAGTCTGGTGCCACCAAGTTTTAAAGTTATAACAGTAGATAAATGGCAAAATATT
> CAGCTTAAGGCTAGTGCTCTTGGTCCCTAAATACTGGCCAAAAGCCAGCTAAAGTTCTCA
> TGAAGTTTGACACTACCGGCATTACGGCCCTTAAACCAGGACAATGATTTGATTGCGTTT
> TCTAGTGCGCCGTGATTTTGAGACGTATTTAGAACATGTCAATAAATGTCGTGAACAAAG
> TACGTTCACCTGGTTATGCTCCCGACTATCAATAGTTCGATTATGTGTGCGGTTGTCAAC
> ATTTAGCCTTAACATACGCGTAGTCACCATCAGGCATATCTGCTCATAGATTAAATTTTT
> GAATCTTTGCGTTTTCGGACATTTAAGATTGAGAATCCGAAGTCCTAAGTTTGCAAGAAT
> CGCTAAGGCTTCTTTGTCACATTGTACATATATAGCAAAACGACACTATCATATAGTGTT
> GCATCGACAGCAGTTATTACGATGCACCCGTTAGTATAGTAATTAGACCTACTTTGATAA
> CCGTTTAGGCCATTTTAGAGCACTTAGCTTAACTTCTGGGGATCTGTACTAAATTGAATA
> TGTTTTTGGCCGAACTGCTGACTTCACTGTCGATAACATACGAGGGCGTTATTCTTATTG
> TTCCATCATAAACATGAATGGCGGATTCACACAGAAACCCTTTGCTAAAATTTTCTGGAG
> TACCTAAATAGTTCAAAGACTACTAGGGAAAGACTACGTTGAGAGACATGTAACTCATTG
> TAATCGTCTTGTAAAATGGAATCCTTCTTTTGCCCACATTTTTACTTCTAATAAAGTTCG
> AGTACCTAGCCGAAAATTCGTCATTACAGGCAAGTGACCTCTATGTGTGAGATTGTACGA
> CCATCTAACTCGCCGAGATTCATAGTTGATCGCACCGTACAAAAGGCCCGTATACTATCC
> ACTTCGTCGACGCGTACAACTTCAAATCGACATTACAATCAAGGGTGGGGGTTACTGTGT
> ATTGCATTGGAATCTGATTTCATCCTATGTCGGCAATTGACAAGAAGAATGAAATCAAGA
> TACCCGTGACTGATAAGTTTCTATTCCGCGCATCCTTTTGCCTTTTTTTCTTACTTGCGC
> AATCATGACCGCATTATTCACAAAATCATTTCTCGTTACTTTACTTTTCTAGAAGTTTCA
> ATTTTAAATTTACCGTTTCTATCATAACAGCGAAAAGTAATCTATTACCTTCATAGCGAA
> ATTTTTGTATTTGAAAAGCAGGGGTCACCGCCCTACTCGGATCAAATGAGAGTGCGATCG
> TCAAAAAGCCCCACAAGTTGAAAACCAGGGTATGCCGGTAATGTCTTATGTAAGGAAGGT
> AATATCATATTATTTAAAGCAGCTAAATACAATGCAACTATAGTGTATGCCCCGAATTCG
> ATGTATACCACCATCTCGTATATGTATAATAACTCATGTGCCTTTCGGCCTAAAGTAATT
> TACGTTTCTCTGTGTTTTTCCATGAAATACACATTCACTGTTTTAGATCTTTTAGAGAGG
> TACAATTCTTAGATTAATGCAAAAGCGAGCTCTACCTGGAGTCCTCTGTGAAGGTCCCAA
> AACATCGGTCCACAGGATCTCGGTTGATAATCCAAAGAAGACAATCTTCTGGATTCACGG
> CGATATATACGACCGGTATTGTAAAGCAAGTAGTTCGTTTAAACAACTTTTATACTCTTG
> CTAACCGATGCACGCAGGTAGGACTCACTGCAACTTAATTTTTGAAAGTCATATTAAGAT
> ACCAAAACGGAAGTAAGCGTAATAGCCCTTCCGAGCACGAGGAATACACGGTCTTGAGAC
> AGTATTGTTAATTTGACTTTACAATTTCGATGATCTTAATATCCAGTTAACCCAATCATT
> TTAATACTACATGTATGGGCATTATAACGATACGTGCCAGGACATGTTGGAGAACCAGAT
> ATTTTACTCGAAGATGCATGACTTATATATTTATGTTAATGTAGAATTAATACATGTGAG
> CATCAATCTTAGAGTGCGTCTACAGAGCTTGGAGGAAGGTGGCAGAAAAAAGGCTGGGCC
> CGAAACTTCTATGCAGATCAAAATGAACTTCAATGGGAGATTGAGTAACCGATTAAGGCA
> TAAGCAGGGCTGGAAATATTGGCGTGTATTATTGTGCGACAGAGTGGGAAACTCTTCGGT
> TAAGATTCAATTCAATATCGTCCCACCACGAAAAAACTAGGGAAACTTATTTATATATCA
> GTCTTGACTCAACTAAAAACAATTCTGAGTGCTTTTTGCTTGTTGAATATACATGGACCG
> CTACAGGATAAACGAATCTTAGCTAATAAACATAACTCCTACAAGATGGTTCAAGTCCTC
> ATGCGGTAGGTAGATAATAAATTTCAGAGGTAGTCTCGACATAAAGTGATTTGCGGGTAA
> TTAAAAGGTTCCAGGTTTGACACAATAAATTAAGGATGCAACTATCGTGTTTTTTGTATC
> TAATTAGACTAAAGGCCTTATCTAGAAAATGCATGGTTTATCTAGTTTATTCTTAAGACA
> ATCCGGTAATGGGGGATCGCGAAGTCTTATAGACAAATCTAATCAGTGTGAGCCTTGTAA
> TATTATTATAAATTAAATAGTTAGTTTTTATTCCTTGAGCAGTAACCTAAATAAAATTTA
> AAACTACGACGATACCCCGAGCTGTTTAGGGTCATTATGCTGCTTACCGGTATTTCTTGA
> AGAAATGTTATCGGTAAATAAAGGTACCGCGTATGGTGTCTTCACGATGTTCTGATGTAG
> TTTAGTTGAAGTCTACTTGGTTTAAATACTTTTAGGAAACGATCTCAACCCTATAATCCC
> CGGGCAATATCCCCACAAAGTAGCTACAGGGAAGCGACCGGATAAAGATTCTGAATCACC
> ATCGAACAAAGCCCAAAAAGAATTAGATCATGAACAGACTATTGTGACAGGAGTACTGCA
> GCACGATCGCGATCAGAATAGCTAGTTGGGGATTAGTGTCTTGCTAATGTTTGGATCTGT
> GGATGATCCATTTTCAAATGAGTCTTCTATCTTTTCACCGTTATTCAAAGTCTTGAAGTT
> TTTATTTACAATAGGTCACCAAGATCAATATTAATAAAAATTAGGAGATTGGAGACGCAA
> CCGGACTTAAACACCGATTATTCATCCAATCCTAATCTGCCGATATTGTAGTGGAATACC
> GAATCTAGTGAGAATTAGAATAGGTAGCCAAATTGCTATCTTGATCCAATGTTGTTATGC
> CACGATCGTATATAACCGCTGTTTTTCCTCTGTATAGGACCACAGTGTATTAACTTCTGA
> AAAGAAGGAACTCATGGGTTACCGACAAATAATGGCTCTAGGTTCGACTTCCATTTTAGA
> GAATGCGCCGGGAAACCAGCGGTTGTTTTTGAATTGGCAAATTATCAGATGAACTAGAAA
> AAATTTTCGTCTAGAATACTAGGGGTTGCTTTCACGTGCCATGATCAACAACTCGAACGC
> GAACTTAAATAGGAGCGGTATGAAATTCACGACTGAAGATCTACTATGGAGACAGATCCA
> CTGTCCTTCGTTACATATTAGTTGAAGCATACTGTAAAATAATGAACATCTCAGTTAAAC
> CGAACAAAGCCTGCCCTTAGTAAGACGGCCCTCTGAAATCGGGTATCCGATGTGCGGTAT
> TTAATTTAGCAGGTGAATGTTTCTATTCAATAATAACCGGGCCGTCAACTTGATATACTC
> AAAGTGATCGGAACAAGTTCTTACTACGATCCCCATGCACGTTGTTAATCCGTAGATAGT
> TGGAATAAGAATTTTTGATGTGATTGGGAAACGGATCCGAGGCTTAAAGGGTTATTTTAG
> AAGTTAATATATCAGTCAAATTATTGAAAAACTTCACTCTGAGCTGATACGAATGCGAGT
> GTTATTAATCTTATCGGTTAATAGATCTCAGTCACGAAATGGGACCGACTAGTTCAGTTA
> AAAAGGATACAATTGAGAGAATGCACGCCAGCTACTCAGTATATGCATCTTTTTAGGATG
> CTAGATCTAACAAAACATTTATGAGTTTCACCTTAGCTCCTATGATCGGCCCATACCTAG
> AATTAGAAAATGTTTGACGGTTTTGTGTATTAGGTTCTGAATAACTGCTATGCGAGTGCT
> ACTTTGATTTTTACCACTAGGAGACGTAAGAACTAAACTGCATAGCATCCAGTTCACATT
> GATATGGGAGATTCGTATCCGTGGAGGGCGCTCGCAAATGTCTCGTCTATCCCAATCGAC
> GATAACTTAGAGCCCTAACCTTTCTCATTCTGTTAACGACCTTTGAATATACTGGTAAGT
> AAGGATTGGTAGTGCAGCGAAAAAGCGGCACAAAGCAAAAATGTTCCAAGGCATGTGTGA
> GATCCCTTATGTCCCAATGCACACGTGATACTTAAATAATCTGTATAACTTGATCTGATG
> TCCGTCGTAAATTGCGTTATACGATGTGTCTTGATGGAACACCAACAGGACACTACGGCA
> ACTACAGTGATGTATTCCTGACCAGTCAATGTACCAGGTCATTACACGGCAAAATCTTTT
> CGAGCGTTTTGTTTGACATTAAAATTGGTTACGTGAGTTTGCCTAGAGGGAGTCCGTGTT
> TCTTAGAGACGCCACCATGTCATATCTCCTGGCCACCCACCATTTGTGTTTGTCCCGATG
> TCATATATTTCTCCATTGTGAAAGGGCCGTTAGGTTAGGTATCAAATAATAGGTGCCCTG
> AGGTTAGACGAAAATACTATCGGCAAATGATCGAGCATTGAAAAACTCTGTCTCCTGTGC
> TATTTATTGGGATCTATAAGTGGCTGTACAATGGTCATCCAAAAGGTTTATAGAGAGCGA
> CTTACTGACTACAAACTTATCTCAGAGTGTTTTGTAGAGTCAGTAGTACGCAGGCTAAAG
> TAATTGCACGCTCGAATCAGTATTCATATAGATGATGGTCCAGAGTTCTCTACTAGCATA
> TATTATAGCTCATACTATCTTTTTGCCGATTTTGATTAAAGAAATCTATATGAAGCTCAA
> AGGCATTAAGTAGCTTCGTTAGCAAATTACGCGGCCAATACTGTCACATATCAGAAACAT
> ACATGGACCATCGTTATCTTCCCCCTGACTACATAGTTAAAGATACTGGTATCATTCAGC
> TTATTTCTATCATGAATGGCTATCATTTCTAACCAAGTTTGGCGAAATGGTTACGAAGAA
> CAGGCAATAATTTCACCCTGTATATTGTAACAGCGTATCTTCTCTGGGTACGCTTTCTGC
> GAAGTGGGTTACGGTTCTTCAGTACTGATCCATTTGAGTTCACATTATCGCAATCTTAAG
> CTTGATGTCGAGTGAGCCGTACAATTTAATGAAAGTAATCAAAGGTTGCGCTGTGGTCGG
> TATTCTCTATCAATGTTCGGTGGCCTGTTTTTTAAGCTATTCGGCTCATGCGACCTTATA
> TCGAGTTACCTGCTACCACTCGGAAGTAGCGCTTATAAGACTGTAATGATTGCTTAATTA
> ATGAAAGAGCGATTCTCGGGCCACAATCCATGTTGTCATTATAACCAGAAATGCCGTAGA
> ATCGTCCCGACCCTATAGACTAATTGGGATGTATCGCGAGCTCCAAGTTGCGCATTGACA
> AAATTCAAATAAAGCTATAGGGTCTTGTTGTCTTTAATGGTTGTAACCGTTTATAATTCG
> CACTGTGAAACAGATTTAGTACTGGCACCTTTACATGGCAGATACTATGATTAATATACT
> AAAGTCAGACATCCAATAGGCAAGATAATATCGAATATAAGAATAACTGCTGAATACAGA
> ACTATAGTATATTAACCTGAAGTTCGAGTTTTAGAGTCTTTTGTTCCGACTAGACGTCCG
> TTGATGCTTGTAAGGTAGATAATATTGCTCTCGTCATGTCTACTGATCTTAGCACACGGT
> ATAACTACAGCTCCAAATACACTGAGGTATAGCGCAATGGATGGGATACGACGAATCAAG
> ACTGAAGAGAGGCTTGATTATAAGTTAACCTTTCTGGCAAACCACATTCCAACTGGATAT
> ACAGCGATTATCGTCTGGTCATGTTAAATCTGAAATTATCGTTAACTAAACCAGTGTACA
> AAATGATGATATAACTTTAGTCAGCTCCACCAGTCTGAAACTAAAAGGTAATGGACTTGA
> ATATACGATAGTTCTTGAAGTTCCCGCGCCTCGTCGAATACAAACAACGAGATCGCCAAA
> ACTTGTTGACATACGTTGCCGGTTTTATCTGCAACGTATCTCCTGGCACAATGAATTCGC
> TTGCATCGCTGATAAGCTCGACTACTCTCCGGTATTAATCATGTTTACCGTGAAACCGCA
> TTGAGTCCGAAAAGATCTAGTCTGGATTACCCGCATTATTATTGCTTATACTTCGGAGTG
> CTGTACATGTCGCGTCGTTTATGATACGGACGACAGGTACGCGAGGGAGCTCCTCGTTGA
> CAATCTTTTGGGCATCAAGACAAGACGTCGGCAATTGGAGGATCTCAATCATATATAATA
> CCCATCACGTAGCAGTTCAACTATTACAAGAATTTCATTTATCGTCTATTATCTCATTAC
> ATGTGAGGATTGGCCTTCAATCTGGTTAATTCCCCTAATAAGTAGGCGCATTTTGTATTT
> AAAAATATTCAATCTTTTCATTTGTCAATACTTACAAGAGCTTGTTTCATGATATAAGTC
> TGAACATTTGTCGCCGTCACAATCTGCATAGCATTAGAACTATACTTCGACCGAAGATTC
> AGTGCATTATAGGTACTACTAGTAACCGCTCTTACCTTGTTTTGTCGACTAATTGGCTTA
> CTAAGACCGAAAAATCTGCGTCCGGTTAAGAGTTCTAATGTCTACCTTATACTACTCTAT
> CACTGACTAAAAGACCCTTATCAATTCAATTATACATTTAATACAAATCATTATGCATCT
> TTGCTAATATTAGTATAAGAATAATCATATTTGTTACACACCTGGTCAATCACCCAATGC
> TTCCCTGGTGGAGGCGCGATGTCTAAGATGTATGACCCCCTCTCTTGCACAGGTTTTACG
> GGGGCGTGGTTCCCCAGAGGTCTAGCTAATAGTAGATAGGACCAAGTCACCAGTATTTAA
> CGAAGGAAGGAGCACAACCTTTAAATATGAACGGTTTAGTGCGAAGTATCAACAATATGT
> ACTATCGAATTGGGTTGTGCTATCGTTTTGCACACCCACAGTGATTTAAGAGTCATCATG
> TCAAGAAGCAATAATGATACACAGAGATCTCCTTCGTAGTGCCCGGCAGCAGATCTGCTT
> TTAGAAAAAAAGAATATTCACTTGGTCAGTACTACAACAAACCCAATCACAAATTCACCG
> AGGATCCCTACATATTCCAGCCTATTAGGTTTTGAGACGTGAACTTGAAACCTCGAAAAG
> TTAGGTCCGCAGTGCTGTGTTAATTCAGCACTATGAGGTAGGCATTCCATATGAGCCATT
> ATCAATTTTTCGTTGATCAACGTATCTTTCAAAGGCACTAAGTTCCCTGAATATCCGAGG
> AAGTGTAAGCTTGCTTGAGCTCGATTGATCATTACAAATACTTAATACTCAAAGGACATA
> TGATTTCGTGGCCGAACTATCAGGCGTATTCTGCGACGCAAACGGGTGCTGTGGTCGGCT
> CATCTAGTTACTCTCACATTCCGTTGGTTCAATTCTATGCAACATGCGTCGGAATAAGCT
> AGGCGATCTGGTCTATCATTTGTAAACGTACGTCCTTGGGGGCTGTTTCATTATTCTTAG
> TAAATTCCAGGGTACCGAAACGGGGGACTGACCTTATATAAGACGGAAGGATACTAAAGA
> GACGTAAGAGTCTGGTGACTTTTTTCGGGGTAGAGTAAGCATTTGTAGAAAACTAATTGA
> TCATCTGAAGTAAATGTATGTCCGAACTAACTACTGAGCTCTGGCGCGTCTCGCGCAGAG
> CATCCCATTGATAAGCGGCCGAATTAGTGGTGCCTCGCTATGTTTATTTTTGACTAGCAT
> GTCTGTTTCTTAATTGCGTCCCCTTGTAGAGCGACTTTTAATACCTAGAGTGACATAAGT
> GTGCGGTGGCTGTTGATGAAAATATGGAAACTCGTGTACAGATACACCACTTGAGAAACG
> AGCCGAATTCACCTACACCTTGCAATAAGTGAGTCTTAAAAGAAATTTTGGAGGGTGGCG
> GTCTTCAGATGAAGCATAACATTCGGATCTAATATAGTGACTAAGGTAACTAGCCAACTT
> ATCGCTCGAACCAACTAATATTGAGGACTTAAACCAAAGAGGAACTAGCTCAACAAAGCT
> GTAAATTATATAGTTAACCAGTAGAGAACCACAACGACCTTTTGGCGAGTTTTAAAGGAG
> CGTGTCCTATTACAATGTAAAATACTTAGGGGCTGCATAGCACGTCAGATAAGGCATCTT
> GAGTTAGAATCAGAGAATTGGCTAAATCTCAAAACGATAAACATTAATGTTCCGTTAATC
> AGCACTAACTAAGGTAGGATCACCAGAAGACATAAGCATCACATCGAGCGACCTTATGGT
> ATACAGGTATCGATAATTCCCAATTTGCCTTGAGAATAAATTAGCAAGTTGCAAACCCGA
> TCTTGGGACCTCTGAGTTGTGTTCTATCGAGGATAACTTAACTAGCTCGCTGAACAGATA
> CTTTAAGTTATCCTTGTATACAACTACACATGGAAGCCGTTAACCTTAAATTGGAGCCGC
> TCTAATGACGTAACGCTTCATAAACCGGTAAAACAAATCGTGAAAGGGCGACAGACCAGT
> ATATACTTTTATAGTTAAACTACTATTATAAGGGAACTTTGGTTCGAAGCTGCTTTCCGA
> GGCCCTTATGATATAACTCATACGGCTTTATCTAAACCTACACTTACAGTGACTGGAAAA
> ATTGGCGATCGATCTCGCAGGATCGCTGGGCACTTACCTTGGTCAACTTTACTGGTCTAC
> AATTACGACATAAAGTTTGGACGGCAATCGGAAAACAATCTACACTTACAACATAAACTA
> GTATACATTTACTATGGGTCAACAAATCTGTTATCGATTCCACGAACAACGATATAATAT
> GGAAGACTTTAAGAGGGTTGGATTTACGACCTTATGGCCATTCACCTCCCAAAGATTCCC
> ATTCGGCTAAAAAAGTACACTGAGGTTCTATCTCCTATCTCTAAGTCGAATAGTAAAAGG
> GTAATCAATAGACATTCTACATTTGGTTCATTGGAGATCGTTATTATCCGTCGGTAACGA
> TAGCACATTCTCAAGCATGATTCGTAACACATCGGAGTCACCTATGAAGGGTTTGCCTAG
> AAAATAAACCTATTTTTCCTTGCGTCGTGTAATTAGTATAGGGCAGATGACTGAAGGATA
> CACCGGATCAGCTGTATACTTCTTACTCCTTCCAGGGCAGTCTTTTTAGACCACTTGTTC
> TAAGCGTGTGGTCTGACTAAACGGTTTAGGATATTTCTCATACACTGATCACACTGACGA
> TTCGCTGTGAACGACGAGGGTGAATAGAATAAATTCAATGCTTCTCTGACCCATAGATGA
> ACTGAAAAATAGAGAAGGGAATGTATCTTTCGCGGTAGTCGAGCTGGTTCAAACTTAACT
> AGAGAAATCTGGTAATAAGTGTCTTAATTATAATTTAGTAGAGCCTTATTTTAAACAGCT
> GCATTGACAAATATAAATGAAACGGTTGATAATTTGTGTTTAATTTTGGAGTAGAATCAA
> TTCGCGTAATAACAGAACGGGCGACTTTAAAAGTACGAAATAACCATTTAATTGGGACTT
> TTAGCTGGAAAGTTGGGTTTCATAGAGCCTCTGTAATTATTATACTGGTTTACAAGCTTG
> AATACTGCTTGCGAATGCGATTAGCTAGGCACCTATATATTGATAGCTTGAAGGTATTAC
> CACGTGGGAGTTGCATACGTAGCTCCTATTGCTAAATGCTGGGTTTGTGCAGTACTACGT
> TCCGAGTTTACGAACTCCAGCGGTCCATTGTCATTGGGTGTGTTTGTATAAGCAACTTTG
> GTTCTATTTGGCTACATACGGGGGTCTGGTTCCTCCACGTACAGCTGATGTCTTCTAAGT
> TTCCAGAGGAATGAAGTGCGATGGCGTAACTAGATTACTGTATATATCCAGAGTTTCCTA
> CGTCGTATATAATACCTCATTGATTCTTGTAATCCCATTACATTCATTCAGGTGATGTCT
> TTAGTGTTTAAGACTGCCATGTGTCCTGCTGTCCAACGAGACATAAAGTAGCGCTAGCGG
> ATTATTGAAGTACCCATAATATCGAAATTCAGGATAAGTATTATTCTAAGACTGCATATC
> ACTTGAACCTCGTGGGTGAGATATCTTATACTTACACTAGCTGAATAAATCTACTGGGGG
> ACGCACTGCCCTCCCTGGGCTCACTATCGTATTAAACAACTGTGTCCCTAGCTAATACAC
> ATCGACTCTAAGAAGTGTGTCTTTTCTTCGCCGAGGAGTCATAATGCTGGATGTTAGACA
> GGTGATACTCACGGATCAAATGGAGTAATGGTTGACTAGTATCCAAACGTAGGAGATCAA
> AGCCACTTTTACCTCTAAAGAGAAACAAAACGCGACAGCTTAGTTGACTTTCGAGAACCG
> AAAAAAAATAAATGAATGAATTTCGACCATCTTTTATAAGATATCGAAAAATTAATGGCA
> TGTTAGTTGTGGAATTCGTTTCTGTGTAACGGAAATTAAAAATAAGGTAGCCTAAAATCA
> ACCATGGGTTCACACTGTGCTGTTCATGGTTTATCTACTCGTATAGGGCACAAATAACAA
> AAACGAACACCACGACGTCAGGATACCTTCCTCGTTTACTGCACAGTCCACTTGATTATA
> ATCATGGAGCGTTCGGAGCCTACCATCAACCTTCTATTAATTCCTTGGATGAGGCTGCAC
> AGCGTAATTAAAATTTCGTTGTTACGGACCACAAACTTCTTGTATCGAATATTGTGGACG
> AGCTCAAATCCATAAGTAGGGAATCCGCTAAGAAAACGATTTTAACTTGGTTACACAGAG
> CTTGTTAGTTACAATGAGACCTGCACCTTGACTGAATTAAACTACTCCCGATTATTCTGT
> TCTAGTTGAAGGTTACTTATTGGGCCGGTCAGCCGAATAAGTAAGAATCAACCATGATCC
> TGTTAGTGCCACAACGTGTTTTTAGTAGCCTGAGACTTATCTCTAAGGTTGTACAGTTTA
> CGTGGCTTCAAACAAATTCATACGTTGCTATTTGTAGCCAACACATCGGAAATTTGCACG
> GTCGTGCAGTCTCGTAGAAAACTAATTTTGACTCGCTAACTAAGCTATTACTGTGATCTG
> CAGTACTGCAAAGTTGACTCAATCTTTTGGGACTGTACAGGTTTGGTGTGCCTGTCGAAT
> AGTGTAAGTATTGAGTACTATGTAGGTTGTGGAGCCCGTTCCCCCTAAGTAGATATTATC
> ATATGTGACGTGTATGATAAGATTTTATCATTGCAGAAGCTGCTGAGTAGTAATAATTGT
> AACTTACACTTTGTGCACTGTCGTTAGACAAGTATGGTCACACCAAGTTTGATAGGTATT
> AAACTACATAAATCCAAATTTTGTCTGCTGTAGCATTCTGCTCTGGGGCCATATATAATG
> GCCATATGCCTGCTAAAGTTCGAAGGTTCGTTGACACTTCCCCCATTAAGCAAATTAAAC
> CTGGTATATGATGTGATGGCGGTTTCGTGTCCGCCCTGATGTTGTGTACTAGGTAGAAAA
> TCTAAAGTTATGGCCGGAAATAAGTTCGGTCTCATCCTTATCCTAACCACTTTCTATACT
> TCGATGAGGTGGGCGCTGGTCAACAGTTACCATTATCATACCCGGAGTCACCATCACCAA
> TATCTGCGCATTGTTTTAAGGTTTGATTCGTGCCGGTTTCGCTATTTTAAGATGGTGAAG
> CACTAGGCATAAGTGTGAAACAAGCCCTTAGGATTCTGTGTAACTTTGTTCTTTTATAGC
> AAAACCAATAGATAAGTTAGGCTTGCTGCGTCACATCTGTTGAACATGAACCACTTAGTT
> TTCTAAGTACACATACGTTCTTATAACGTTTGGAAATTTGTCACATATTACCGTTTATGC
> TGCCGAGCTGTTATAAAGTCAAGTGGGTTGTGCCCGAACTGCTCTCTTAAATCTCGTTAA
> AATTCCTCGGCGTTATGCGTAGTGTGCCATCTGTTACATGAATGGAGGATGAACAAAGAA
> TCACTTTGATAATAGTTGATCGTCTAACTATTTAGGGAATTGACGAATAGCCAAACACGA
> ACGTGTCTGAAATCTAACGCATTGTAATCCTATTGTAATAGGCAAGACGTCTGTTGCCCA
> ATTGTGTACTGCTTATTAAGTTCCACTTCCGACCCGATAAGTCCTATTTAAACCAAACTG
> TAATCTTTCTCTGAGATTGTACCACCATATTTCTCCCAGACATGCTTACGTGTGCGCTAC
> GTAAATAAGGACCGGTTACTAGCAAATGCCGCCAACAGTACATCGTCATATCCACATTAA
> AATAAACGCTCCGGCGTACTGTGGATGCAATTCGAATCTCTGTTCATACTTGCTAGCAAA
> TTCTATTGTTCTTGGAAATCATGATACAAGTGAATGATAAGGGGCTTGTAAGCCCATCCG
> GTGCCATTTTTTTATTAATTGAGAAATCTGCACCCAATTAGTCAAATTATATTTGCGAGT
> TAATTTACTTTGATTCAAGTGTCAAGGTGATATTGACAGTTTATATCTTATATCAGTTTT
> GTTATCTTGTACATTATGTCACAAAGTGTGCGATTTGAAAACAACGGCTCTCCCACCGAA
> TCGGATATAATGAGACTGACATCCTCTTAAACCCAATCAACGGCAAAAAAACGCTATCCC
> GCTATGGTAGTATGTAAGGAACGGTATAGATTATGATTGTAACCAGCTATAGTAAATGCA
> ACGATTGTGGATGCCACCTAGTAGAGCTATACCAACTTATCGTATATCTATATGAAATCA
> GCGGCCGTTACCCCTAAAGGTATTGACGTTGCGCGCTGTTTTTCATTGAAATACTCTGTA
> ACGCTTTTTCATCTGGGAGAGACCGACAAGTATTACATTATGGCAATACCGAGATATTAC
> GCGAGTACGCTGGGAACCTACATAAAATTCGGTCCAATGGATATCGGGTCATAATCATAA
> CATCACTATAGGCGCGTTTCTCGGCGTTTGATAAGTACCCTATTGTAAAGCATGTACGTC
> GTTGAAAATAATGTTAGTCTCTTGATAAAAGATGCACCCTCCGAGCACGCAATGCTTCTT
> AAGTTTTCAATGGATTTGTAACATAACTAATCCCTTCTAACCGTATTACACATTCAGTGC
> ACCAGCATTACACGGTCTTGAGACTCTATTGGTTAGTGCACTTTACTTTGTAGATGAGCG
> TTTTAGACAGTTTAACATATCATTTTTATAAGTATTCGATCCGAATTTGTACCATACGTG
> CCTGGAAAGCTTGGACAACCAGATTTGTTAAGCCAAGATGCATGAATGAGAGAGTGATCT
> TAATGTACATGGAATACTTCGGACCTTCAATATGAGAGGCCGGCTTCACACAGGGCACCA
> AGCGCCATGATAAATGCATGGGCCAGATAATTATATCCAGAGCTATATGAACTTATAGGC
> GAGATTGACTAAACCTTTTACCCAGAAGAACGCCTGCATTTATTCCAGTGTTTTAGTGTC
> ACACTCACTGGCTAAATCTTCGGTTAACAGTAAAGGCTATTGCCTCCCTCCAACATAAAT
> ATAGCCAAACGTATTTATATTTCAGTCGTGAATCTTCGAAAAAAAATTCGCAGGGATGGG
> GGCGGCTTCATTTTACAGCGACAGATTAAGGATAAACCAATATGTCAGAATAAACATATC
> GCCTAATTCATGGGTCTTGTACGCTGGCCCTTCGTAGTGTATAAATTTCACTCGTTGTCT
> ACAAAGTTTGTGATTTCCGGGTATTGTAAAGCGTACACGGTTGACAATATTTTTTAAGCA
> GCCTACTATCCTGTTGTTTGTATATATTGACAATATAGGCAGTAGCTTGAAAAGGATTGG
> TTTAGATACGTTATTAGTAACACAATAAGCTAATGGGCGATCGCGTTGGATGATAGAAAA
> ATATAAGAAGTGTCAGACTTCTAATTTGATTATAAATTAAAGAGTTACTGTGTATGCCTG
> CTGAAGTTACCTTATTAAAAGTTAAAAATTAGACCATAACCACTGATGTTGAGCGTCAGT
> ATCCTGCTGTCCGCTATTTATGGAAGATAGGTTATCGGGAAATAAAGCTACAGCCTTGCG
> TGGCTTAACGATGGTCGCATGTTGTTTACTTCTAGTCTTCTTCGGGGAATGACTTGTAGC
> ATACGTTCTATACAATAGAATACCCGGGCTATATCAAAAATAACGTGATTCTGCCATCCC
> AAACGATAAACATTATGAATCACATTCGAAAATAGCCATTTTAGAATGTCATCAGCTTCA
> GTATAGTCTCAAACCAGTAATGAAGCTACTTACAGTTCAGAAGAGAGAGTTGCGGAGGTG
> TGGCGGCATAAGGTTTGCATAGGGGCATGAGCAATTGTAAAAGGAGTATGAGAGATTGGA
> TCCCTTATTCATTGTCTGCAAGGTTGTATTTAAATGACCTCACCAACATCAATATTAATA
> ATAATTACGACTGTCGACAACAATCCCCTCGGAAAAACCGAGTATTAATAATAGCCGATT
> CGGCCCATTTTCGACGGCAATTAAGAATAGAGTCTGTAGTTGAAGAGCTTCCAATATTCA
> TAGCGGCAGCAAATGTTCGTATGCCACGAGCCTATAGAACAGCTCTTGTTCCTATGGATA
> GCAAAAATGTGTAGGTAATTATCATTACATCGAAATCTTGGCTTAACGTATAATTTTCCA
> TCTAGGGTACTCGTCCAGTTTACACAATGCGCCGGCATACAACACCTTGTTTTTGTAGTC
> GAAAATGATATGATGAACTTCTTATAATTTGCCTCTAGATTACTACGCCTTCCGGTCACC
> TCCCAGCAGCATAAACTAGTAACAGAACTTAAATTGCAGCGCTTTGAAATTATCCAAGGA
> AGATATACTTTGGAGAAAGATAAAATCTCCTTAGTGACTTATGTCGTGAACAAGTCGGTT
> ATTTTATCAAAATATCAGTTTATCCGATAATTCCCGCCCCTTACTAAGACGGCACTATCT
> AATAGCCTATACCAGGTGAGCGTTTTAATTGAGCAGCTCAAGGGGTCTTTTAAATATTAT
> ACGCGCCGGCAACTTGTTATAAGCTTTGTCTGCCGAAATAGTTATTACTAAGTTCCCCAG
> GCTCCTGCGTATGAAGGTGAGTGGTGCAAGAAGTTTTTTTCTTGTGTTGGCCAAACCGAT
> AAGAGCCTTATTCGGGGATTTTAGAACTGAAGATTTCAGTAAATGTATTGAAATACTTCA
> CTCTCAGATGTGTCCTAGGCGAGTGTTAGTAAGATGAGACGTTAATACAGAGAAGTCTAG
> TAATGGCACAGAATTGTGCAGTGATATTGCAGTCAATTCTGAGAATCAAAGAAAGCTACT
> AAGTAGAGGAATCGGGTTAGGTGCCTACTGCTTAAAAATATTTTTTGACTTTCAAATGAG
> CGCATAGGTTCGGACATTTACTACAAGTACTAATGCTTGGACGCTTTTGTGTAGTTGCTG
> AGGAAGAACTGATTTCCCAGGCCTACGTGCTTGGTTTCAACGACCAGACCTTAGATCTAT
> AAGCAATTGCATACTGTGCTCATGCATTTCGGTCATTCGGAGAACGCGAGCGCGCGACCA
> AAGGTAGCCTCGTTCCCAATAGACCTTAAATGTCAGCACGATCCTGTCTCATGCTGTTTA
> CGACATTTGAATAGTAGGGGAAGTAAGGAGTGCTAGTCCAGCCAAAATGACGCACAAACC
> TAATTTCTTCCTTGCAATGTCTGACATCACGTAGGTCCCTTTGAACTAGTCATAAGTAAT
> TAAGCGGTATTTCTGCAGCTCAGCTCACTAGTTTATTCAGTTTTTCGATCTGGCGTGAGG
> CAACTCCAACAGCTATCTTAGGAATCTACACTGTTGGAGTCCTGTACAGGAAATGTACCA
> GGGCAGTACACCGCATAAGATGTGAGAGAGGGGGGTTTCACATTAATATTGGTTAAGTGA
> GTTGCACGAGACGCACGCCGTCTTTCTTTGACAAGACACCTTGTATTATAGAAGCGCCTC
> CAACAATTGCTCGTTGGCCCCTGGTAATATATTTATCCAGTCTCAAAGGGACGTGACGTT
> ACCGATAAATTAAGACGTGACCTCAGGTTTGTCGAAATTAAGTTCGGCAAATGTTCGAGA
> ATGGAATAAAGAGGTAGCATCTGCTTTTGAGGGGGAGCTATATGTCCATGTTCAATCCTC
> ATCAATAAGCTGTAGAGAGACAGACGTAAGGACTAATATCTTTTCTCACACGGTGTTGTT
> GTGTCACTAGTACGCTGGCTATAGGAATTGATACAGCGAAGCTCTAGGCAGAGACATGAT
> CGTCCACAGTTAGCTAAGACATTATATTTTACAGATTAAGAGAGGTTGGCACATGGTCAG
> TATACAAAGCGATTGCTAGCGCTATGGCATTAAGGTCCTTACTTTGATAATTACCAGCCA
> TATTAGGTAACAGTTAAGATACATACAGCCTCCATCCTTATCTGCCCACGGACGTAATAG
> TTAAACTTACGCGGTGCATTCAGAGGAGTGCTAGCATGAATCCCGATCATTTAGAAACAA
> CTGTCCAGTATGGCTGTAGAACTACAGGCAAGTAGTTAACAATCTAGATGGTATAAGCCT
> AGATTCGCGGGGTTCCCTTGCTGAGAACGGCCTTACCCTTAGTCAGGAATGAGCCATTTC
> TGGGCAATTTATCCCAATCGGATCCTGCATCGAGAGTCACCCGGTAAATGGAATGATAGT
> TAGATAAGGTTCCCCTCGCGTCGCTATGAGATAGATATGGTACGTGGACTCTTTTGGAAG
> ATTTTCGGATAATCAGACATTTGATAGACTTACATGCTACCACTAGCAACTACCGCTTTG
> ATCAATCGTATCATTGAGTAATTTTGCAAAGAGCCATTATCGGCCCAAAAGACATGTTGG
> CATTTTAAACAGTAATGAACTAGTTTCGTCACGACCATATAGAATTATTCGGATCTAGAG
> AGTCAGCCAAGTTGCGCAGGCAATAAATTCAAAGAAAGCTATTGGGTATGCTTCTATTGA
> TTCGGTGTAACCGTTTATAATGCGCTCGGTCAAAATCTTTTTCTAAGGGATCCGTGAAAT
> GCAAGTTAATATCATTAATTTTATATACTCAGACATAAATTAGCCAAGAGTATATCGAAT
> ATAACAAGAACTGAGCATTTAACAACTAGACTATAGTTTACGCTACTTCCACTTTTAGTG
> TCTTGTGTGACCAATACACGTACGTTGAGGCGTGGAAGCTTGATAATATTCCTCTACGAA
> TCTATACTCAGATTAGCACAAGCTAGAACGTAAGCTACATATTAACTCACGTAGACCGCA
> TGCGATGGCAGAACAAGAATCAAGACTGAAGACAGGCTTGATTTTAACTTAACCTTGATC
> GCATACCACATTCCAACGGGATTGAAACAGATTAGAGGCTGCTAATCTTAAATCTCATTT
> TATCCGTATCTTAACAACTGTAATTTATCAGGAGATATCTTGAGTCTGATAATCCACTAT
> GAATCGATTTGGTATTGCACTTCATTATAACTTAGGTCTTCAACTTACAGCCCAGACTAC
> ATTTATAAATTCGTGATCGACAATAAGGCTGCACATACCGTGCAGCGTTTATCGGATAAG
> GATCTCATGGCTCTTTCAATGCGCTTGCATACCGGTTATGATCCTATTATCGCCCCGTTG
> AATAATCTTTAACGTCTAACACCTTTGTGGCCGAATACATCGAGTCTCGATTTACCCAAT
> TATTTTTGCTGAGAATTCCCAGTGATGTACAGGGACCGTCGTTTATCATAAGCAAGAAAG
> GTAAGAGACGGACATCCTCCGGCTCAATCGTTTGCCCTGAAACTCAAGAAGTCGCAATTT
> GGTCCAGCGCAATCATATTTAATTCCAAGAACGTACCAGTTCAACTTTGACAAGTAGGGA
> ATTGATCGTCTAGTAGCGAATTACATGTCAGCATTCCCCTTCAATATGGTGAATTCAACT
> ATGTTCGAGCACCATGTTCTTTTTTATTATATGATATAGTGTCTTGTCTATATTCGTTAA
> TGAGCGTCTTGCTTGAGTGAACTATGATAATTGGTACACGTCACTAGCTGAATACCATTT
> CAACTATACTGAGACAGATCTTTCTGTGATTTATAGGTACTACTTGGAAAACCGCTTACA
> TTCGTTTGTAGAAGTTTTCGCTTTCGAAGAACGTTAAATATGAGGAACCTGAAGAGTTCG
> AAGCTCTAACTGATACTAAGATATAAATCACTAAAACTACCGTATATAGGCAATTATTCT
> GTTTAGACAATGCTTTATGCATAGGTCCGATTAGTTGGATAACAATAATAATATGTGTTT
> AACACCGGCTCTTGCAAACTATCATGAACGCCTCGACGAGCGTGGTATATGTGCTATCAC
> ACCCTCTCTGGAACAGGGTTGAACGCGCACTCGGTCCACTGAGCTCTACCGTTGACGTGA
> TAGCACAAACTCACCACGTTTGAAAGAAGCAACCAGCACTAACTGTAAATATGATACCTT
> GTGGCAGAACTTGAAACTATAGGTTCTATCCAATTCGGTTGTGATATACGGTTGAAAAAC
> AACACGGAGTTAACAGTCAGCATCTAAAGTAGCAATAATCATAAACACAGATCTACTTCC
> GAGTCCCACGAAGCACATCTCCGTTTAGAATAAATCAATAGGAACTGCGTCTCGACGACT
> TCATAAAAATTAACTAATTCACAGACCATCCATACAGATTACAGAATTTTACGTTTTGAG
> ACCGGAACTTGATACCGACAAAAGTGTCCTAACCACTGCTCGGGGAATTATCAACTAGGA
> GGTACGCATGAAATAGGAGACAGGATCAATTTTGCCTTCATAAAAGTTTCTTTCAAACGC
> ACGAAGTTCAATGAATATACGTCGAACTCGATGCGTGATTGACCTCCTTTGATCATGTCA
> TATAATTAATTAGCTAACGTCATTTGTTTTCGGCCCCCAAATTGCTGGAGTTTTATGCCT
> AGAATTACGGTGCTCGCGTCGGATCATCTTGTTAATATCACAGGCACTTGGTTCTAGTAT
> ATGATTCATGCCTCCGTAGTACATTCGCGATAGCCTCTATCTTGTCGATACGTAAGGAAG
> GGCGCGAGGTTTAAGTTTGCGTAGGTAATTCCAGCCTTACGAAACGGGGCACTGACCTTT
> TATAAGACGCTAGGTGTCTTTTCAGACGTAAGTCTAGGGTGAAGTTGTTCCCCGTTGTGG
> ATGAATTTCGTCAATAAGAATTGATCTTATCATCTAAAGGTATGTCCCTTCTAACTTCGG
> AGATATGGACCCTCGCCCGCAGTCCAGACAATTCATAAGCCGCACAAGTTGTCGTCCCTA
> CATATCGTGAGTGGGCTCGAGAATGGAGGGGTCTTTTTTGCCGACCCTTGGAGACAGACT
> TGTAAGAACGAGAGTGACATTACTCTGCCGTGCATGGTCAGCTTAAGATCGAAACGCCGG
> GACAGATAAACCAATTGACTTACCAGCACTTGTCAACGACTCCTTGATATATGTCAGTCT
> TTTTTGATATTTGCGAGGCTCCCGGTCGTCAGATCTAGCAGTTCATTCGCAGATAATTGT
> GTCTCTAACGTTACTTGCAAAATGTGCGATAGAAAAAACTAATTTTCTGCAATGAAACAT
> TAGAGGTACGTCCGAAAAAATGCTGTAAATGATATACTTATCAAGTTGACAACCTCTTCC
> AAAGGTGGGAGAGTTTGAAACGAGCCGGTACTTTGAATAGCTAAATGTATGAGGGGCTGC
> AGAGCAAGTCAGTTAAGGATGCTTCACTGACAAGAAGAGAATTGGCTTAATCTATTTACC
> ATAATCTTTAATCGTCAGTTATTATCCTATAAAGAACGGTGGATCAACTGAAGACAGAAC
> CATATCTGCGTCCGACCTGATGGTAGACACGTATCCATAATGACCAATTTCCCTTCAGAA
> GTAATTAGCAACGTCCATACCACATAGTGGGACATATCTGTTCGGTTAGAGACAGCATTA
> ATTTTCTACCTCGATCTTATGATTAGGGAAGTTATACTTGGATACAACTACTCTGCGAAG
> CCGGTAACCTTAATTTGGACACCAGCTTATGACGTAACCATTAATAATAAGCGAAAAAAT
> ATCGTGAAAGCCCCACAGTAAAGGTTATTCGTTGTGTCGTTAACTACTATTAGAACCGAA
> AGTGGGTTAGAACCTCAGGTAAGTCCAACGTTGCAGAGAACTCTGACGGCTTTATCGTTT
> CAGAAAAGGAAAGTGACTGCAATTATTGGCGATAGTTCTCCAAGGAGAGCTGGGAAATTA
> AATTGGTAAACTTGAATCGTCTACAATGACGTCTGATTCTGGGGACCCCAATCCGAAATC
> ATTAGACACGTAATACAGTAACTAGTATACAGGTACTATCGGTCATCAAAGCTCTTTTAG
> ATTCAAACAAAAACGAGATTTTTTCGATGACTGTTTCTGCGTTGCTTTTTAGACATGATC
> CACAGTCTCCTAACAATGATTCCCATTCGGCTAATATAGTTCTCTGACGTGCTTTATCCT
> TTATCTTTGGACTAGACTATAACCCTAAGCATTTCACTGTCTACTTTTGCGTAATTCCAC
> TTCCTGATTATCCCTAGGTAACGTTACAAAATGATATACCATGTGGCGTATCACATAGGA
> CTAACCTATGTTGGGTTTGCCTAGTATTTAAAAATATTTTTAAGGGAGGACTGTATTGAC
> GATAGGCCAGATGTCTCAACGTTACAACGGATCTCATCGTTACTTCTGTCTCATGCAACC
> GCTCTATTTTTTGACAACTGGTTCTAACCGGGTGCTCTGACTAATAGGTTTAGGTGATTT
> CTCAGAATCTGTTCACACTGAAGTTTCGCTGTGAAACTCCACCGTCTTGACATGAAATGC
> AATCCTTCTAGGAACATTACAGGTAATGATAAATTGAGTTGGGTATCTATAGTTCCACCT
> AGTCGAGATGGTTAAAACTTAACTTGTGATATCTCCGTTTAAGGGTCTTAATTAGTATGT
> AGGACTGAATTATTTTTAAAAGCGCATTGGAAAAATATAAATCAAAAGCGGCTTAAGTGC
> GGTGTAATTTGCCAGTTGTTTATTTTCGAGTATTAACACTACGGCAGACTTTAATACTTA
> GATATAACAATGTTTTGGGGAAGGTGAGCGGGTTACTTCCCGTTCATAGTCACTATCTTA
> TTATTATACGGCTGTACAACCTTGAATACTCATTGCGAAGGCCAGTACAGAGGAACCTAT
> TGATGGATTCAGGGTAGGGATGTAATACTCCGACTTGCATACCTAGATCCTTTGCCTAAT
> TCCTCCCTTGGTGAACTAATACCGGACCAGTTTTAGTAATACACCCGTACAGGGTATGTG
> GCTGTCTGGCTAGAACCAACTTTGCTTCTAGTTCGCTTCAGAAGCCGCTATGGTTCAGAA
> AAGGACAGCTCTTGGATTATAACTGGCAACAGCATTGAAGGGAGTTGGCCTTACTAGAGT
> TATCTTTAGATCCAGTCTTTCCTTCGTAGTATTTATTAAATCATGGAGTCTTCTAAGCCA
> TTTACATGAAGTCAGGTGAGGGCTTTACGGTTTTACACTCAATTCTCTCCTGATCTCCTA
> CCAGACATTAAGTACCCCTACAGCTTTTTTCAAGTACCAATATTTTCGAAATTAAGCATA
> AGGTGTTTGCTTACACGGCATATCTAGTGAAAAGCGTGGGGGAGAGATATTATAATGACA
> CGAGCTGAAGATTGAGTATGCGCCACGCACTCACATCCCGCCGCGATATATCCTTTTTAA
> CAAAGGTCTCCCTAGCTAATACACAGCGACTCTTACAAGGCTGGATTTTAGGACCCGAGC
> AGGCAGAATCATGCTGCTGAGTAACGGCTTAATCACCGTGATTTTGGAGTAAGGCTTGAA
> GACTTTACTAAAGTAGGACAGAAAAGAAACTGTTTCCTATATAGACATACAAAACCCCTA
> ACCTTAGTTCACGTTAGTCAACCGAAAAAATATATATGAAGGTATTGACACAATCTTTTA
> TTTGATATCGATATTTTATGGGATTCTTAGTTGTGCAAGGCGTTTCGGTGGAACCCATAG
> TAAAAATTACGTTGACTATATTCAAAATTGGCTTAAATCTCGCCTGGTAATGCGTGATAG
> TCGCCTAGACGGCACATAGAAAATATACCAACACCTCGACCTCAGCATTCCTGCCTCGTT
> GACTGATAACTACTATTGATTATAATAAGGGTGCGTGAGGTCCCTACCTGCTACCGTATA
> TGTATGCAGTGCATGAGCCTGCACAGCGTAATTTAAAGGGAGTTGGTACCGACCTCAAAA
> GGATTGGAGACATTAGTCGCCACGACCGCAAAGCCATAAGTAGGCAATCAGATAACAAAT
> AGATGTTATATTGGTTACACAGACATTCTTAGTGAAATGCACTCATGCTCCGTGACGCAT
> TTAAACTAATACCGAGTTTTCTCTTCTAGTTGATCCTTACGTTGGGGCCCGCTCAGCAGA
> AGAAGTTACATTCAAACAGCTTACTCTTTGTGCCTCAACGTGTGGGTTGGTGCATGAGAA
> TTTGCTCGATGGTTCGACTGTTTAACTGGCTTATATCATATTCATACGTGCCTATGTGTA
> GCCATAACATCGCTTATTTGCTCCCTCGTGATGTCTCGTAGATAACTAATTGTGACTAGA
> GAAATAAGCGTGTACGCTCATCGCCACTAAGCAAATCTTGACTCAATATGGTGCGACTGT
> ACACGTTGCGTGTGCCTGTCGATTAGTGTAAGTATTGAGTACGAGGGTGGTTGTCGAGAA
> AGTTCCAAATATCTTCAGATGATCATATGGGTCGTGTTTGATTAGTTTTTATATTTGAAG
> TACCTGCGGAGTACTTATAATTGTTACTGACTCTTGGTGCACGGGCGTTACTATACTAGC
> CGCAAACAAAGTGTGATACGGATTAAACGTCTTATAGCCAAATTGTGGATCATGTTGCAT
> TCGCATAGGGCGACATATTGAATCCAATTATCAATCATAAAGTGCGATGCTTCGGTCAAA
> ATTAACCATGTAACCAAATTTAAACTCGTATTTCTGGGCATGCACGTGGAGTCGCACAAC
> GCTTGGGCTCTACGTGGGACTAAATCGAAAGTTTGCGACGGATATATCTTAGGGATAAGC
> CGGTTCAGAAACACGTGATATACTTCCATGTGCTCGGACCTGCTCAAAAGTTACAAGTTT
> CTGAACACGTCGATACTGCACCATGATAGCAGCTTTCTGTTAAGGGGGGTTTCGGGCACG
> TTTACCTATTTTAAGTTGGTCTAGCACTTCGAATTACTGTCATTCATGACCGTACCATTC
> TGTCTAAATTGCGTATTTGTTTCAATTTACTATAGTGAAGTTACGCGTCATGACTATCAT
> CTGTTGAACAGCAACAACTTACTTTTCTTTGTACACATAAGGGCTGTTAACGTTTCCAAT
> TTTGTCTCATAGGTCAGGTTAGGATCCCCAGATCTTATATAGTCAAGTGCGTTGGGCCAC
> TAATCATCTAGTAAATCTACTGAAAATTACTCCCAGGTTGGAGGTGGCTGAATTATGTTA
> AATCTATCCACGTTGAAATATGTATAAATTTCAGTTTAGGTGATCCTCTTAAGATTTTCG
> GATTTGTAGTATACCCTAACACGAACGTGTCTCTATTCTTAAGATTGCTAATACGATTCT
> ATTTGCCAAGAAGTCGGTTGAACAATGGTGTACGGCGTAGTTACGTCCTCTTAAGTCAAC
> ATATGGCCTATTGTATCCAAACTCTAAGAGTGCTCTCACTGGGTAACAAAATATTTCGCC
> CACTCTTGCTTACGGCTGACATAACTTAATATCCAACCGTTAATAGCATATGACGCCAAC
> AGTACTTAGTATTTGCCAAATTAAAATATACCCTCCCGCGTTATGTGGAGGCAATTCGAA
> GAGCTGTTAATAATTGCTAGCAAATGCTATTGTTCTTGCATATCATCTGACAAGGCAATC
> TTAACGGGATTGGAACACAAGAAGGTGCAATGGTGTTATGTATTCAGATTTATGCAAACA
> AGTAGGCAATTTATATGGGAGACGTTATGGTAGTTGATTCAACGGGATTGGTGTTTGGGT
> AAGGGGATTTATTATATCAGTTTTCGTATATTGTTAAGTATGTCACAATGTGTGCGAGGT
> CTATACAACCCCTCTACCAACGTAGCCCTGATAATCACACTCACAGACTATTTAACACAA
> TAATCGGCATAAAATCGCTTGCCACCTATGCTAGGATCGTACGATCGGTATTGATTATGA
> GGGTTACATCATATAGTATAGCATAAGATTGTCGATCAAACCTAGTACAGCTTTAAAAAA
> TGATCCTATATCTATATGTAATATGCGCACGGTACCAAGTATGGTAGTGAACGGGAGAGC
> GCGTTTTAATTCAAATTCTATGTAAAGCGGTGTCATATGGGACACACCGAAAAGTATGAC
> ATTTTGGCATTTCCCTCATAGTAAGCCTCTAAGCGGGCTTCCTAAATAAAATGAGCTAAT
> ATCCATAGAGCGGCTGAAGCATATCATCAATTGAGGAGCCTGTATAGCACTTTGAGAACT
> AACCTATTGGAATGAATGTACGTACTGGAAAATTAGGGTTGTAGAGTCAGTAAACATCAT
> ACCTCCGTGCAAGCAAGCCTTATTAAGTGTTCTTTCGATTTGGTACATAAATTTTACCTT
> CGAACACTATTTCACAGGAACTCAAACACCATTAATACCTAGTGACTCTCGAGGCGTTTG
> GGCTAGTTACTTTGGACTTCAGCGTTTGTGAAAGTTTAACATATAATTTTTATAAGTATG
> CGATCCCAAGTTGTTACTTAACTCCCTCCAATGCGTCCACAACAACTTTTGTTTAGACAA
> CATCAAGGAATGAGTGTGTGATCTGAATCTACATGGATGAATTCGGTCATTAAAGATGAC
> ACGCAGGATTCTCACAGGCCTCCAACCGCCATCTTAAATGCAGCCCAAAGTTAAGGATAG
> CATCTGATTTTGGTAAGGATTGCCCACATGCACTAAAACTTGTACCAAGAACAACCCATC
> CTTTGTTTCCACGGTTTGAGTCTCACACTCACGGCCTTAATAGTACCTGTTCTGTATAGG
> CTTGTGCCTCAATAAAACATAAATAGACCCAAAAGGAGTGAGATTGCTCTCGTCAATATT
> AGAAAATAATTGCGCACGCATGGGGCAGGCGTCATTTGAATGCGTAAGATTAACCTGAAA
> ACAAGATGTCAGAATAAACAGATAGAATTATTCATCCGTATTCGAAGATGCCCCTTCCTT
> CTGTATTAAGTTATCTCCGTCGATACAATGTTTCTCTTTGCCGCGTTTGGTAATCCGGAA
> ACCGTGGACTATATTTTTGATGCTGCATACTAGACGCGTGTGGCGAGAGATTGACTATTT
> TCGAAGGTGCGTCAAATGCATGCCTGTAGAGACGTTAGGAGTAACTAATTAACCTATTCG
> GCCATACCCTTCGATGATACAAAAAGATAAGATGGCTCAGAATTCTAATTGGTGGAGTAT
> GTATTGTCTTACGGGGTATGAAGGCTCATGTTAACTTATTAATAGGTAATAAGTAGTCCT
> GAAAAACTCATCGTGACCCTAAGTTGCATCAGGTCACCTTTTGATGCTTCATTGGTTTGC
> CGGAATTAAACCTTAACACGTGCCTGGCTGATAGATCGGAGCTTGTTCGTGTCGTCTAGT
> ATTATGCCGGGAATGAAGGGTTCCATTCGTGATATAAAATTGAATACAACCCATTGTTCA
> AAAATAACGTCATTATCCCTTCACTAACCTTTAACTTGAGCAATAAAATTAGAAAATACC
> AATTTTACTAGGTCAGCAGCTTAACTATAGGCTCTAACCTCTAATGAAGATACTTACAGT
> GATCAAGTGAGTCTTGCGGAGGTCTCGCGGCATATGCTGTCCATAGCGCCAGCAGAAATT
> GTAAAAGCTCGATGAGAGATTGGATAACTGATGATTTCTATGCTACGGGGGATGTTAATG
> TCCGAAACATCTTAAATTTGATTTATTTTGTCCACTGGCCTCTACAATACCCTAGGAAAA
> AAAGAGTAGTAATAATTGAAGTTTAGGAACAGTTGCGTCGCCATTTAACTTTAGAGGCTC
> TAGTTCAAGTCCGTCAAATATGCATTGAGGCAGAAATTCTGCGGATCAAAACAGACGTTA
> GAACACCTCTGGGTCATAGCGATACCAAAAATCTCTTGGTAATTATCTTTACTTCCTTAT
> ATTCCCTGAACCTATAATTTTCCAGAGACCGTACTCGTACAGTGGACTCAATCCCCACGC
> ATAAATCACCTTCTTTTGCTAGTCCAAATTGTGATCTTCAACGTCTTATTATTGGCCGAT
> ACATGAATTCGCCTTCAGGTATACTCCAAGCTGAATATTAGAGTAACACATCGTTTAGTG
> CACCCCGTTCAATTTATACAAGCTTGTTATTCTTGGCTCTAACTGAATATCGAATGACTG
> AATTAGGTCGGCAACAAGTAGCGTATTTTAGCTTAATATCACGTTTTAACATAATTCCAG
> CCAATTACTTTCACCCCACTATCTAATAGCCGATAACTGCTCAGCGTTTTAATTGTCAAC
> CTCAAGCGGGATTTTAATTTTGATACGCGACCGATTATTCTGATTAGATTTCGCTGACCT
> AATACGGAGTAAGAACTGAACAAGGATACGGCGGATGAACGTGAGTCGGGCTAGTTGTTT
> GTTGCTTCTCTTGCCCTATACGAGAAGAGCATGATTCGCGGTGTTTTCATCTGATGATTG
> AAGGAAATGTATGCAATTAATTAAAGCTCAGAGCTGTACTAGGACAGGGGGAGTTTGATG
> TGACCTGTATACAGAGAACTATACTAAGCCCTCACTATTCGGAACGGATATTGCAGTAAA
> TTCTGACATTCATACAAAGATAAGATCTAGAGCAAGCGGGTGAGCTGCCTTCTGATTAAA
> ATTATGTTTTCACGGTCAAATGTCAGCATTGCTGACCAAATGTAATTCTAGGACTTATGC
> GGGGTACCTTGTCGCGAGGTCCTGAGCAAGAAAGCAGTTCCCTGGCATTCGTGCTTGGTG
> TAATAGTCCACTACTTTCTTAGATAAGCATTTGATGAATCGGCTCTTGCATTTCCCTCAT
> TCCGAGAACGCGTCCCACAGACAAAAGCTAGACTAGTGACATATACAACTTAAATGTCTC
> CAAGATAAGGTAGATGGCGGTTTTAGAAATTTGTTTAGTAGCCGTACTTAGCAGTCCTTC
> TCATCCCAAAATCACCATAAAACATATTTGCTTAATTCCAATCTCTCTCATAACGTAGCG
> AACTTGGAACTACTCATAAGTAATTAAGCGCGAGTTATGCAGATCTGCGCACTACGTTTT
> TCACGTTTTACTTCGCGCGGCAGCCATCTAATTAACCTATATTAGGAATCGAATCTCTTC
> GAGTCAGCTAAAGGATAGCTAAATGCGCAGTACAACCAATTAGATGTGACTCACGGGGCT
> TTCAATTGATTATGGCTTAACGGTCGGGCAAGTCTCCCACGCACTCTTTATGTCACAACA
> AAAATTCTATGTTAGAAGCCACTAAAACATGTGCGCGGTGGAAACTGCGAAGTGTGTTAT
> CAAGTCTCTAACCCAAGGGTCCGTACCGTGAAATTATGACCGCAAAGCTGCGGTCTAGAA
> ATGAAGTTAGCAAATTCTTACACATTGGAATAAAGAGGTAGCAGCGCCTTGTGTGGGCGT
> GAGTGATCTCCAGCTTATATCCGCATCAATTACCTGGTGTCACACACACGGAAGCAAGAA
> TATAGTTTCTCACTCGGTGTTCGTGTCTATCGAGTTACATGCCTATACGAAGTGATACAG
> ACAAGCTCGTGGAAGAGACTGCTTCCGCAACACTTAGAGTAGTCATTATTTTTGTCAGAT
> TAAGTGAGGTTGCAACTGGGGCAGTATTCAATGAGTGTGCTTGAGCTTTCCCTGTATCGT
> CCTTACTTTGATATTGAACAGCAATTTTAGGGAACAGTGAAGATACTTAATGCCTCCATC
> CGTTGCTGAACAAGCAAGTAAGACGTAAACTGAAGCCGTGATGGATGAGGAGTGAGAGCA
> TCTATCCAGAGAAGTTAGAAAATACTGGCCACTATGCCTGTAGAACTACAGCATAGTAGT
> TAAAAAGCGAGTTGGTATAACACTAGATGCGCGCCCTTCCATGGAGGAGTACGCCCGGAC
> CCTGAGGCACGTATGAGAATTTGCTGGGCTATTGTTACAATGAGGTTCATGCATCGACAC
> TCTCAACGTAAAGGGATGCTTTCGTAGATAACCTGCACATCGCCTCCCGATGAGAGAGAT
> AGCGTACCGGGAAGCGTTTGGTTCATTGGCCGATATTCACTAATGTGTTACACTTTAATG
> AGTACTCGAGCTACTTCAGAGTTGTTCAAGCGTTTCTTTCAGTTATTTTGCAAACACACA
> GTAGACCCCAAAAAGACTGCTGCGATTGTTTTAAACTTTTCAACGAGTTGAGGCAACACA
> AGATTCTATTATGCGCTTCGTGACACTCAGAAATCTGCACATGGCAATTTAGGAAAAGAT
> ACATTGTCCCTATGCTTCGATTGTTTCCGGCTAAAACTGTTGATTGAGCTCGGGCAATAT
> CTGTTTCTAAGGCATAAGTGAAATCCATCTGAATAGCATGAATTTTAGTTTCGCACACAT
> AATTGTCCAAACTGTATATAGATGATATCTTGAAATCAGCATTTAACAACTAGTCTATAG
> TTTAAGCTTCGGCCACTTTGACTGTAGGGTCGGAACTAGTCTCCTACCTTGAGCAGTGGT
> TCCTTGAGTATAGTCAGCTACGAAGCTAGAATCAGATTTCCACTACCGTGTAAGTATGAG
> AAATTGTATATCACCTAGACCCCATGCGAGGCCAGAACAACATTCTACAATCTTCACTCC
> ATTCAGTTTAACTGATACTGGATCCAATAACAAATGAATTAGCGTTTGTATCAGTTTTGA
> GGATCCTAATCTTTAAGCTCATTGGTGACGTATCGTAAAAACTGTTATTTATCTGGAGAG
> TTCTTGAGTATGATAATCCACTATGTTTAGTTTTGGTATTCCAAGTCATTATTACTTACG
> TCTGCTTCGTAAAGACAAGACTACATTTATATATTACTCTTCCACAATAAGGCTGCTCAG
> TACGGCAACCGTTGATAGGATAACGATAGAATGCATATTTCTAGGCGAGGCAAGACAGCT
> GATGATACTAGTAGAGCACCGTGGATTAAGCTGGTAACTCTTAAACATGTCTCGAAGTTT
> ACATAGACTATCCTGTTAACCAAGGTGTTTTCCGGTGAATTCCCTCTCATCGAAAGCGAC
> ACGACTTTATCAGTACCTACTATCCGAACACACCCACAGAAGACGGCTCAAGAGGTTCCC
> ATGAAACTATTGAACTACCAATGTGCTCCTGCGAAAGCATTTTTTTGTACATGAAACTAC
> AAGGTCAAAGTTGTCTACTTGGGAAGTGATACGATTGTAGAGAATGTAATGGCTCCAGTC
> CAATTAATTATCCTGTAGTCAACTATGTTCGACCACCAGGGGCGTTTTTATTAGTTGATA
> TAGTGGCTTGTCTATTTTAGTTAATCACAGTCTTGATTCAGTGTTCGATCATAAGTGGTA
> CAAGTCAATTGCGCAATTCAATGTCTAATAGAATGACAAACTTCTTTATCTGATTTTGTG
> CGAAGTAGTCGAAAACCGATTAAATGCGTTGCTACAAGTTGTCCCTTTCGTACTAACTTT
> AATAGCACGAACCTGTTGACGGAGAAGCTCTAAATGATACTAAGATAGAAAGCAATTATA
> CTAACGTAGATAGGAAAGTAGTCTGTGTAGAAAATGATGGAGCAAGAGGGCAGATGAGGT
> CGAGATCTAGATGATGAGGGCTTTATCAACGCCTCTTGCTAAATATCAGGAACGCCGCCA
> CGACAGTGGGAGTTCTGCGTTCTCAACATCGATGCAAATCCGGTGTACCCGCACGCGGTC
> AACTCTCCTAGACAGTTGACGTCAGACCTCATACTATCAACGTGGGATACATCCTACCTG
> CAATAACTGGAAAGATCTTACCTTGTGGCACAACTTGATAATTTTGCTTAGATCCTATGC
> GCTTCTCATTGACGGGTCAAATAAAAATCGCTGTTTACACTAAGAATCGAATCTTGCTAT
> AATCAGAAAAACACAGAGAAGTACGACTCACACGAACAACAGAGCCGGGTAGTTTATATC
> AATAGGAAAGGCCTATCGTAGTCTTATTTAAAATGAACTTTGGAAAACACCTTCAAGACT
> GAGTAATCAATTGTTCGTGGTCTCAACGCTAAGTGTTACAGACTAAAGTGTCCGAACATC
> TCCTCGGGGATTGATCAAAGTGGACCGTCCAATGAATTAGCTCACTGGAGATATTGGGAC
> GGCAGATAACGTGCTTTCATTCCATAGAACTTCAAGCAATATAACTCCAACGCGATGAGT
> CATTCTCATCCTTGGTTATTGTATTATAAGTATTTAGATATCGTAATTTCTTTGACGCCA
> ACAAAGTGATCGAGTTGGAGGACTACAATTACGGTGATCGCGGACCATCAGAGTCTGAAG
> ATCTAAGGCACGTGCGTCTAGGATATCATTAATCACTACCTAGTACAGTCCCCTTAGCCT
> CTAGATGGTCGATTACGTACGAAGGGCGCGAGCGTGATGTTTGAGTAGGTAATTAAACCC
> TTAACTAAAGCCGCACTCAAATTTTATATGTCCCTACCTGTCGTTTCACACCTAACTCTA
> GCCTCAAGGTGGTACCCGTTCTCGTTGAAGGTCGTCTATAAGTATTCAGATTAGCATCTA
> ATGCGATCTAACTTATATATTAGCACATAGGGACACGCGACCGAACTCCTGAAAAGTCTG
> ATCCCGAACAAGTTCGCGTCAATACATAGCGTGAGTGGGCTCGAGAAGGGAGGGGGCGTT
> TTTGACGAAACTTGGAGTCACTAGTGTATGTAAGAGACTGACATTACTCGCACGTCCAGC
> GTCAGCTTAAGATCGAAAAGCCGGGTATGTTAAACATATTCACTTAACTGAACTTGGAAA
> AGTATCATTCATTTATGTCACGAGTTTTTCATTGTTGCCACGCTCCACCGAGTATCTTCT
> AGCAGTTCAGGACCTGAGTATTGTCTCTCGAACCTTTCTTCAAAAATGTGAGAGACATAA
> AACGATTTGTCTCCTAGGATAAATTAGACGTACGTCAGAAAAATTGAGCGAATGGATTTT
> CTGATCATCTTCTCTTAATATTCCAAAGGTGCGAGTGGGTGTAACCACACGCGAATTTGA
> ATAGCGAAATGTATGTCGCCATGCAGAGAAAGTAAGTTTACCATGATGCACGGTCTAGAA
> CTGAATGCCATTATGATATTTAACAGATTCTTTAATCGTAACGGATTATCATATAAAGTT
> CCGTCGTTATAATCTTCTAAGTTCATTATATGCGTCACAAAGGTGCCGTGAAACCGTGCC
> ATATTGAACATTTGCAAGTCAGAAGTAATGAGATTCGTCATTAAAACAGAGTCGGAAATA
> TCTCTTCGCTTAGAGACAGCATTAATTTTATTCCTACAGCTTATCATTAGGGTAGTTATA
> CTTCGTGACATATACTCTGCCTAGCCGGTTACCTTATTGGCGACACCAGCTTTTCAACGA
> TACATTAATATTAACCGTATTAATTTACTCTAACCCACAAACTAATCGTTATTAGGGGTG
> TCGGTATAGAAGATGTGAACCCAAAGGGCGGGAGAACATCAGGGAACTCCAAAGTTGCAG
> AGATAGATGACGCCTGTATAGTTTAAGTATAGGTATGTCTAGCCTATTAGTCCCCATACT
> TATCCAACCAGACAGCCGATAGGAAAGTCCGAATAGTGTATCCGCTAAATTGTACTATGA
> TTCTGGCCACCCCAAGCCCATTTCATTAGTCTAGTAATAAAGTTAAGACTTGACAGGGTA
> TTTCCGTCATATAAGAGCTTTGAGAGTAAAACAAAATCCAGTGTTTTTCGTTGAAGGTTT
> CTCCCTTCCTGTTTACTAAGGATCCAAAGTATAATAAAAATCAGGCCAAGTACGAGAATT
> TACTTATATCTCGTGAGTTATAATTGATAGTTGGACTAGACGATAACCCGTAGAATTTCA
> CTGGAGAATGTGGCGTATTTCCTCTTACTGATTTTCACTAGGTTAACTGTCAAATTGATA
> TTCAAGCTGGACTATATAATACCTCGAAAATAGGTTCCCTGTCAATACTTTTGTTTAAGT
> GGTGTAAGGCAGGACTCGATTGACGATAGGCAACATCTCGCAACCTGAAAAAGCAGATCA
> TCGTGTCTTATGTATAATGAATCCCATCTATTGTTTGTAATATGCGGATTACACGCTGCG
> AGCAATTTTAGCTTTAGGTGAGTTCTAAGTATCGGTGATATATCAACTGTACAGGTCAAA
> CTCCACCCTCTTGACATGAAATGAAAGCCGTATAGCTAAATGACTGGTAAGCATTATTTC
> ACTTGGCTTTCTATAGTTACACCGACTCCACATCCGGATTTATTATCTTCTGTTATATCC
> GTTTAACGCGAGTATGGTGTATGTACGACTCAAGGATGTTTTTAACCGCATTGGTATTTG
> TGAAATCTAAAGCGGCTTATGTGCGGGGGTTTTTGCCACGTCTTTATTGTCCACTTTGAA
> CACTTACGCACAATTTTATACTTACATAGATAAATGGTTTGGGGTAGGTGTGAGCCTTAC
> TTCCCGTTAAGACTCACGATCGTATGATTAGAAGCCGGTAATACCGTCTAGACGCAGTCC
> CTAGGCCTGTACAGACCATCATAGTGTGGGATTCAGGCTTCCGATGTAATACTCCCACGT
> CAATAACTTGAGCAGTGGCCTTTTTCATCCCTTGCTGAACGTATTACGGAACAGTTTTAG
> TAATACTCCCGTAATGGGGATGTCCCTCTCGGGCTTGAACAAAATGTGCGTAGTGGGCCA
> TTAAGAAGCCCCTATGGTTAAGAAAACGAAACATCTTCGAGTAGTTCGGGCATCTGCTTT
> CTTCGGACTTCCACTTTATACAGTTATCGTTTGTTAAACTCGTGAATTCCTACGTTTTTT
> TTAAGAAGGGTGTATTCGTAGAAATTTTATGGAAGTAACGTGTGCGATTGACGGTTTTAC
> AAGCAATGCTCGACGCAGCTAATTACACAAAGTAACTACACATTCACCTTGTTTCATCGT
> CAAAGTTTTTACATATTAACCATTTGGTGGTGGATTTCAAGGAATAGCTAGTCATAAGAC
> GCCCGCACAGTGATTATTAGGTCAAGTCATCATGTTTGAGTAGGCCCCTCCCAATCACAT
> AAAGCCGAGATATTTACTTTGTATAAAAGGTCTAAATACAGTATACACAGACAAGATTAC
> AAGGCGCGATGGTAGGACACCTCCTCGATGATTCATGCTGCGGAGTATCGGCTGTATAAC
> CCTGATTTTCCTGTAAGGCTTCTAGACTTTAATATACTACGACAGAAAACAAAAGGTGTA
> ATAGATAGTCTTTAATAACCACTAACATTTCGTCAAGTTACTCATCACATATTTTTTATA
> TGATGGTAGGGACTCAATATTTTTTTTCTTTTACATTTTTTTTGCCATTCTTTCTTGTCC
> AAGGACGTGCGGTCGAAACCATAGGAATAATTACCGTCAATATATTAAAAATGGCCGTAA
> ATAGCGCCGGGTAAGGCGGGATAGTAGCCGAGACCGATCTTAGTAAATATAACTTAAACT
> CCTACGATCCATTAATGAATCCGTGTAGCATATCGACTATGGTGGATAATAAGCGTCACG
> GACGTCCATAAATGATAAAGTATATGTATGCAGGGCAGCTCCAGCAAATCAGTTAGTTTA
> AGGGAGGGGGTTACCTAATAAAAAGGATGGGTGACTTTAGTCGCCAACTCAGCATAGCCA
> TTTCTTCGCAATAACAGAACAAATACTGGTGATATGGGGTAAAAACTCATTCTTAGTGTA
> TTGCACTCAGCATCAGGGAAGCATGGTAAATTATACCCAGTTGTAGCTTCGACGTCATCC
> TTACGGTGGCGCACCCTATGCAGAAGATCGTTCTTGCAAAATGCTGACGCTGTGTCAATC
> AAAGGGGGGGGTCGTGAATCACTATGTGAGAGATCCGTCGAATCGTGTACGCCAGTATAT
> AATATTATTAACTGCATTTGGCTTCCATTATAATCCCTTAGGTGCTACCTACGGATGTAT
> CGTTCATTTATTATGGGCTCTAGAGAAATTACAGTGGTAGCTCTGAGCCTCTTAGCAATT
> CGTCAAGATTTAGGGTCCCAATCGACTCCTTGCGGCGCCCGGTACTTTACTCTTAGTTGT
> CTCGAAGAGGGTGCTTCGCCTCAAAGTTACAAAGATCTTCAGTTGATATGATCGGTAGTC
> TTTGTGTTCTGTTTATATTTCAACTACAGGAGCACGTCGTTTAAGTGGTAAGGTATATGG
> CTCCAAGCGACTGACTATTCTAGCCGCAAAAATACGGTCTTTCGGAGTTAACGTATGTTT
> GAAATTTTGTCGATCAGGTTCCAGTAGCATAGGCCCAAAGATTGAATCCAATTTTCAATC
> ATTTACGGACATCCTTACGGCTAAATTAAAAATGGAACAAAATTTAAAATCCTATTGCTG
> CGCATGCACCTGGACTCGCACAACGCTGCGGCTCTACGTCCGTCTTATGCGATTCTTTGC
> CAACCTTATTTCTTACCGATAAGCAGGTGAAGAAACTAGTGATTTAAGTACTTGTCCGCG
> CACAGCCGATAATGGGTCAAGGTTATGAAAACCTCGATAATGATCAATGATAGCACATGT
> CTGGTTACCGGGCTTTAGGCAACCGTGACATATGGTTTCTTGCTCTTCAACTTCGAAGTT
> CGCTCATTATTCAAAGTTCCAGGAGCTCTATATGGCGTATGTGTGTCATTTTAATATACT
> GAAGTTACCAGGCATCACTATAATAGCTTCTACAGCATAAAAGTTCTTTTATTTGGAATA
> AGTAGGGCTGTTAACCGGTCCAATGGGGTATCATAGGTAAGGTTAGCATCAACTCAGCTT
> AGTTTGTATTCTGCCGTCGCAAACTTAGCATATAGGATATCGACTGATAAGTAATCCCAC
> GGTGGAGGTGGCGCAATGATCTTTATGCTTGCCACCTGGATATATCTTTAAATGTCAGTT
> TAGGTCATACTATTAAGATTGTCCCATTTCTAGTAGTCCCTTAAAACAAACTCTATCTAT
> TAGTAAGATTGCTTTGAAGAGGCTATTTGCCTACAAGGAGGTTCAAATATGCTCGAAGCA
> GTTGTTTCGGACTATTAACTAAACTTATGGAAGATGGTATCCATTCGCTAAGAGTGCTAT
> CTCTGGCTTACTAAAGAGTTAGACAACTATTGATGTCCGCTCACATAACGTAATATCCAA
> ACGTGTAGACAATAGCAACACTAAACGTATTACTATTTGAAAAATGAATATATTCCAGAA
> CCACGTAGCGCCTGGAATTGCCAAGAGCTCTGATGAAGTGAGACAATTGGCTATTCTTAT
> TGCATTGATTCTGAAAACGCTAGCTTATCCCCAGTGGAACAAATGAAGGGGAAAGGGTGG
> GAGGTAGTCACATTGATCATAACAAGTTCGATATTTAGATGGCAGACGTTAGGGTAGGGC
> AGTAATCGGGATTGGGCTTTGGCTAACGGGAGTTATGTTATAACTTTTCGTTGAGTCGTA
> AGGATCTCACTATCGCTCCGTGGGCTTTACATACCAGATAAAAAAGTAGACCTGATATGC
> TCTAGCACTGAATATTTTTAAAAATAATCGGATTTTAATCCAGTGCAACAGATCCGAGGT
> GCGTTCCATCCCTTTTCATTAGCTGGCTTTCATCATATTGTATTGCATTACTTTCTCGTG
> CAAAAATTGTACTCAGTTTAATAATGAGACGTGTGAGTTTTCTTATATCCCCAAGGTAAC
> AAGTTTCCTTGTGTACGGGACACCGCGGTGGAATGCATTGTATATCGATAGCGGTGTAAG
> ATGCCTCACAACGAAAAGGATGACTGTTTCCAATTTCACTCAGAGTAAGACTCGAAGAGC
> CCTTAATAAATTATATGACCGAATATCCTGAGACCCGATGTTGAATTTATTAAATTGACC
> ACCCTGGATACCACTTTCTGAACTAAAAGATGCGTTTCATTCTTAGGACTGCTTTATTAG
> GGTTGTAGAGGCAGTAAACAGCATAAATAACTCCTACAAAGCATTAGGTTCTGTGATTTC
> CATGTCGTTAATTAATTTTAAATTAGTTAACTATTTCAAAGGAACTCAAAAACCTTGTAT
> ACCTAGTCACTATCGAGGCGTTTCGCATAGGGTATTGCGACTGCTCACTTTGTCAATCGG
> TAAAATTTAAGGGTTTTTACTATGACTGAACAAGGTCTTAATTAACTCAATCCAATCCGG
> CCTATTAAACTTTTGGTTAGAATTCTTCATGCAAGGTCTCTCGGTGAGGTAGCGAAATCC
> ATGTATTAGCTCATGATTGAGCTCTCCAACGATTATAAAACCCATACATCCGAAATCTTA
> TATCAAGCCCAAACTTTAGGATAGAATCTCATTTTGCTTAGGATTGCCCACTGGCAATTA
> AACTGGTACCATCTACATACAATCCTTTGTTTAAACGCGTGGTCGCTAAAAATATAGCCC
> TTAATAGGACCGGTTATCTATTGGATTGTCACTAAATAAAACATAATTAGACCAAATACG
> TGGGTGAGTGATCGACGCAATATTACATTTTATTTGAGAACCCATGGCCCACGAGTATTG
> TGTATCACTAACATTAACCTGTATACTAGAGGTCACATTTTTATGATACAAGTATTCATC
> CCGATTCGAAGATGCACATTACGTCTGTTTTTTGGGATATACGTCGATAATATCTTTCTC
> TGTGAACCCTTTGCTAATCAGGAATCCGGGCTATATTTTTTGGATCATCAATTAGTGAAG
> CGTCGGGCGTGAGATGGTATAGTTTCCAACGTCAGTCTTTTCCATGCCTGGTCAGTCCTG
> TGGACGAAATATTGAACAGTTTCCCCCTGACACTTCCAGGAGTCTATTTGATATCATCGC
> TAACAATTCTATGTGGTGGTGTATGTATTCTCTTTAGCGCTAGCAAGCCTCATCGTAAAG
> TATGATTTGGGATTTAGTACTAATGTAAAACTCATCGGCTCACTATGGTGAAGCAGGTAA
> CATTGTGAGCCTTCATTCCTTTGACCCTTTTAATCAGTAACACGTCCCTCCAGGATACTG
> CGGACCTGCGTCGTGTAGGATACTAGTAGGACCCCTATGAAGGCTTCAATTACTGATATT
> AAATTCTAGAAAACCCATTGTGAAAAAATTTCGTCAGTATCAATTAAATAACCTGTTAAT
> GGAGCATGATAATGACATAATTCAAATTTTACTTGCTATGATGATTAACTAGTCGCGATA
> AAATCGTATCATCATAATGAAACTGATCATCTCACTCGTCACCACCTCGCGAGCAAGTTC
> CTGGCAAGAGCGCCAGCACAAATGCTATAAGCTCGAGGAGTCAGGCCATAACGGAGGATT
> TCGATGATACGGGGGTTGTTATTCTAAGATAAATCTTATTGTGGATGTTTTTTGTACACT
> CGACTATAAATTAAAATAGCTATATAACTCGTGGATGAATTCAACTTGACCAACTGTGGA
> CTAGCATTTTAACTTTAGTCGATCTTCGTCTTCTCAGTAAATTTTGAAGTGACCCTCAAT
> TTCGGACGAGCAATACTCAAGTTTCAAAACAGCGGCGGAAGAGCGTGTCATAATATCGCT
> TCCTTATGAGCTTTTCTTACTTAGATGCCAGGAAACTATTATTTGAAAGAGTCCCGAATA
> CGAATCTGGACTATTGCACAACCATTAAATAAAAGTCGGGTGCTTGGCCAATTGCTGATC
> TGCTAAGTATTATTTGTGGACGAGTCATGTAGTCCACGGCACCTATAATCAATCATGATT
> ATTAGACTAAAACTTAGGTTAGTCAACACAGTGCTTTGGATAAAACCTTCTGAGTATTGC
> CTCTATCTGAATAGAGAAGGACGCAATGTGCTAGGCAAAATCTACCGTTTTGTAGATTAT
> TAGATCGGTTTAACATATTTAAAGCAAAGTAAGTTCTACCAAAGATATTTTACAAGTGAA
> ATGCTCACACTGTGTATTCTCATCATATTCCGCGATTTTAATGTTGTTAACACAACGATT
> ATTCTGTTTACATTTCGCTCAACTTATACGGAGGAAGTACTGAAAAACCATAAGCCCGTT
> CAACGTCACTCCGCCTTCTTCTTGGGGGATTCGCTGCCAATTTAACTGAACTCAATGTTT
> CCCCCTGGGTTCATATCATGTGTGAACGATATGGTTGCATTTTAGGATAGATCTCAGCTG
> TACTTCCACTCGCGGACGTTCAGCTGAACTGTATACACAGATCTATACTATGCCCTAACT
> AGTCGCATCGCTTATTCATCTATATGATCACATGCATACAAACAGAAGATCGACTCCAAG
> AGCCTGTCCTCAAGTCTGAGTAAATTTATGGGTGCTAGGTATAATGTCAGAATTGCTGAC
> CAAATGTAAGTATTGGTATTATCAGGGCTACATGGGCGCGACGTCCGCACCTTCATAGCA
> GTGCAATCGCATTAGGCATGCCGGTAATAGTAATCTACTTTCTTAGTTTAGCATGTCATG
> AATCGCATATGCCAGTGACCTATGGACGACAACCACTCACACAGACATTTCCTAGAAGAC
> TGAAATAGACTAATGTAAGCTCTCAAACTTAAGCGAGATGCAGCTTTTACAAATGGCTTG
> AGTACCCCTTCTTTCCACGCAGTCTAATCAAATAATCAACATATATAATTTTTGAGTAAT
> TCAATGCGCTCTATGAAACGACCGAAATTGCAAATACGATGTAGGTATTTTCACCGTGTT
> AGCCACATATGCGAACGACGTTTGTAACGGTGTACTGCGCCACGCAGCATTATAATTATC
> CTATAGTACCATTAGAATCTCTTCGTGTAAGCTAATCCATAGCGAAATCCCAACTAAAAA
> CAATTTCAGGTCACTCACCCGGCGGTATATGGATTATGCCTTTACGCTCGGGCAACTCTC
> CATACAACGAGGGATGTCTAAACAATAATTCTATGTGAGAACACAATAAATAATGGGAGA
> GGGCGAAAATCCGATGTGTGGTAGAAAGGATATTTCCCAACGCTACGTTCCGTGAATTGT
> TCTCCGCAAAGATCCGGTCTACTTTTGAACTGACCAATTTCTGACACATTCCTTTTTAGA
> CCGAGAAGAGCATTGGGTCCCCCTCAGTGTTCGCCAGCGTATTGACGATTAATTTTCATC
> GTCTCTCTAACAACGTACCTAGTATTTAGGTTATATATACCTCTTCGTCTCGATCGTCGT
> ACATCCAGTTTCGAAGGCATAAACACATGATCGTGGATCTCAATGCTGACGAAACACTTA
> CAGTACTAATGAGTGGTGTAACATGAACTGACCGGGCAAATGGGGATCTTTTCTATCACT
> GTCATTCAGATTTCCATGTTTCCTCATTAATTTCATATTGTACACCAATTGTACCGATAT
> CTGAACTTTATGAATCCATAATTAAGTTGATCAAAAAGCAAGTAAGTCGGTTTCTGTAGA
> CCTCATGGATCACGTGGCAGTCATTCTTTACAGTGAAGGGACTTAATTATGGACACTTTC
> CATGTACATATTATCCATTCTTGGGATAAAGAGTCTGCCGATAACAAGTCATGACACCCC
> GTACATGCAGCACTAAGCAAGGTAAAGGACGAACCTAGCACAATGTGATCGGATATTGTG
> AAATTGACCTTAATGAAGCGACTCGATCAACCTATAGGCTTGCTTTCGTACATTACCGGA
> ACAGCCACGACAGTTCACAGAGATTGCCTAACGCCAAGCGGGTGCTTCAGTGGACCAGAT
> GCACTAATGTCTTACTAGTTAATCAGTAATAGACATTATTCACAGTTCTTCTAGACTTTC
> TGTCACGTTTTTTCATTTCTCAATGTAGACCAAATAAAGAATGCTGCGATGGTTTTAAAC
> TTTGCAACGACTTGACGAAACTAAAGTGTCTATTTGGACCTGAGTCACACTAACAATTCT
> GCACATCCATATTTTGGAAATCATTCATTGTCCCGAGCAGTAGAGGGTTTCCGGCTAAAA
> CGGGTGTTTCACATACCGCTTTATATGTGTAGTAGCCATAACTCTATGCCATCTGAAGTG
> AATGATTTTTAGTTTAGAACAATTAATTGTCCAAACTGTAGTTACTTGTGTTATTCATAT
> CACAATTTATATTATACTATATTCGTTAACATTAGGAAACGGGGTCTCGAGGCTCGCAAA
> TAGTATACGAACGGCTCCAGTCGTTCATTCAGTTGTGTAAGATACCATGCTAGAAGCACA
> TTTCAAATACCGTCTAACTATCAGAATTTGTATAGAACCGTGACACAATGACTGCCATGT
> AAAACTTTATACTATCTTCAATCCATGCTGGTGAAATGTTAAGGGAGACATTAAATATTG
> AATTACCCTGTCTATAACTGGTCACCAGCAGATGATTTTTGAGCTTTGGTGAAGGTTAGT
> ATAATCGCGTATTTAGATCCTGAGTTAGTCACTATCAGAATAAAAGAGCTTTACTTTTCC
> TATTCCTAGGCTTGTGTACTTTCCGAGGATTAGGAAACACAACAAGACATGTATTTATTA
> CTCTGACAAATTAACCAGCCTAAGTAACGCAACAGTTGTTACCATTACGTGAGAATCCAT
> ATTGCTTGCACAGGCATGAAAGCTGATCAGACTAGTAGACAACAGTGGTTTATGATGGTA
> ACTATTTAACATGGCTCCAACTTTTCTGACTCTAGCCTGGTAAAAAAGGTGTTGGCAGCT
> GTATGAAATCGCAGCGTATGCCACACGACGGTTTATGTACCTACTATCCGTACACAACCT
> AAGAAGAAGGCTAATGACGGTCAAATGAATATATTCTACTACAATTGGCCTACTCACATA
> GATGTTTTTTGTAAATCATACTACATCGGAAAAGTGGTATTCTTCCGATGGGTGACGATT
> GTACACAAGGTATTCGATCCTGGACAATGATTTAGCCTCTTGTAAAAGATGTTAGTCAAC
> AAGGGGAGTGTGTTTTTGTGCATTGACGGGATGGTAGATTTTACGTATTCACACGCGTGA
> TGCACTCTTCGATCTTATGGCCGACAACGATATTGAGCATGTAATGGTATAATTGTAGCA
> CTAACTTCTGTATCTCATGGTGTCCGTAGTAGTCGTAAAAACAGGTAAGGACTGGCTACT
> AGTTGTACATTTACTACTAACTTTATGAGCACCAACCGCTTCTCGGACAAGCGAGTAAGC
> TGTAGAAGAGAGAAAGCAAGTATACTAAACTTGATACGATTGGTGTATCGGTAGTATATG
> ATGGAGCAAGACGGAACTTGTCGTCCTGTTATAGTTGATGAGGGCGGTATAAAAGCATAT
> TGATAAATTGAAGGAAACAAGACTACACACTCCGAGTTCTCAGTTCTAAAAAGAGAGCCA
> AATCCGGTGTACCACAACGACGGAAAATCTCAGAGAAACTTCTACTCTGACATAATAAGA
> TAATACTGGCATACATCCTTAATCATATTAAGCGTTAGTTCTTACCGGGTCCAACTACGT
> CATTATTGTCCGTAGATAATTTGCCCTGCGCAGTGAACGGGCATATAAATATACCTGGGT
> TATCGATGAATAGAATCTTCATAGTTGAAGTATATATCAGAGAAGTACGTCGCAAAACAA
> CATAAGAGAACGGGTCTTTTTTTATTGTCCAAAGCACGATACTACTATTATTTAAAATGA
> TATTTGGATAACTCCTTAAAGAATCTGTAATCAAGTGTTCCGGGGCTCAACGCTAAGTCT
> TTAACAATAATCGCTCAGAAAATCGCATACCGCATTGATAATAGTGCTCCGTACATTCAA
> TGACCTCAATGGTGATTTGGGGACGGCTGATTACGTGAGTTATTTACATACAACGTAAAG
> CTTGAGAACTACTAAGACTTCACGCAGTCTAATAATTGCTTATGCTATTATAAGGATTTA
> CATTTACTATGTGCTGGGACGCCAAAATAGTCATCCACTTGGAGCAATACAATTACCCGC
> ATAGACGACCAGATGAGTCGGTAGAGATATGCAAAGTCCGTATAGGATTTCATTATGCAC
> GAACTTGTTAAGTCCACTGACAATATTGATGCGACTTTACGTACGAACCCCCACACCGTG
> ATGGTGCACTTCCTATGTAATCCAGTAACTAAACCCCCTAGCTAATGTTTTATCTACATT
> CCTCTAGTTTATCTACTATCTCGAGCCTCAACGGCGTACCCCGTCTCGTTCAAGGTCCTA
> TTTTACTTTGCTGATTAGATTAGTTTGCGTTCTAACTTATATAGTAGCACATAGCCACAA
> GACAAACAACTAATCAAAAGGCTGTTCACCAACTTCTTCGACGAAAGAAAGTGACTCTCT
> GGCCTACTCATGCGAGCCGGAGTTTGGCACCAAAATGCCTCTCACTAGGCTTTCTAACTC
> TCGCTAAGTTAGAGCACCTCAAGCGGAACCTTATCTGACTAAACAAGCCTATCTGTATAA
> TAGGCAATTTACTCAAATTGGATAACTATAATTCATTTTTCGCTCGAGGTTTTCATTGGT
> GACACCATACACCGACTATCTGCTACAACTTATGGACATCAGTTTTGTCGATAGATACTT
> TAGTCAATAATGTGACAGACATAAATAGTTTTGGCTCATAGCATTAATTTCTCCTAAGTA
> AGATTATTTCAGCGAATGCATTGTCGGATAATCGTCTATTAATATTACTAACGGCCCACT
> CGGGCTTACCACAACCGAAGTGGTATACCGATATCTAGCTCCCCAGCATCACATACGAAC
> TTTACCATCATGAAAGCTCTTGATCTCAATGCCATTATGAGATTTAAAAGTTTATGGTTG
> CGTAACGGTTGATAATAGAAACTTCCCTCCTGATAATCTTCTATCTTAATGATATGACTC
> ACTAAGGTGCCGTCTATACGTGACAGATTGAAATTGGGAAAGTCTCTTCTTTGGACATTA
> GTCATTTAAAATGAGGCCCTAAGAGCTCGTAGCGGAGACAATCATTTAATGTTATTAAGA
> CAGATTATCATTAGGGTTCGGTGAAGGCCTGTATTAGAATATCCCTACAACGGTTAATGT
> TTGGCCTAAACACATTTGCAACGTTAAATTAATATTAACCCTTTTATTTGACTCTTTCAC
> ACTATCTAATCCTGAGTACGGCTCTACGTATAGTAGTTGTCATCCCAAACGCCCGGACTA
> AAGAAGCGAACTACAAACTTCCTCACATAGATGTACCATGGTGACTTTAACTATACCTAT
> CTCTAGCATTTTTGTCCACATACTGATAAATCCTCACAGCCCATAGGTAAGTCCGATTAG
> GCTAGACGAGAATTTCTACTATGATTCGGCCCTAACATTGAACTTTTAATTAGTATAGTA
> ATTATCTTTAGTCGTGAATGCGTAGTGACCGAATATTACAGATGTGACAGGAAAACTTAT
> TACAGTGTTGTGCCTTCAAGGGTTATCACTTCCTGGGTACTAAGCAGCAAATCGATAATA
> AATTTCTGGAAATGGACCAGATTTTTCGTATAGCTACTCAGTTATAAGTGAGAGTTCCAA
> TACTCGTTAAACCGTTCAATTTAAATCGAGTATGGGCCCTATGGCATATGAAGCTGGTGA
> AAGACCTTTACTGTCAAATTGATATTAATGCTCGACTTTATAATACCTAGAAAATAGCTT
> CCCGGGCAATACTTTTGTTTAAGTGGTGGAAGGCACCAAGCGTTTCACCTTACCAATCAT
> CTAGATAACTGTAAAACCAGATAAGCCTGTATTAGCTAGAATCAATCCCATCTAGGGGTT
> CTAATATCCGGATTTCACGCTCAGAGCTAGTTTACCTGTTCCTCTGGGATAACTATAGCT
> GATATAGCTACTGTACAGCTCATAATACAAACGATTCAATTGAATGCAATGCAGGAGACC
> TAAATGTATGCTTAGCTTTTTTTCACTTCCCTTTAGAGAGTTACACAGTCTACTCATCCG
> GATTTAGGTTATTCTCTTAGAGCCGTTGTTCCCGAGGTTGGTCTTGCGACCTCTCAAGGT
> GGGGTTTATCACAATTCCTATTTGTGTTTGCTTAACCCGATTTTCGCACCGCGTTGGTGC
> ATCGTCTTGATTGGACACGTTGTTAAATTACCAACTAGTTTTTTAGTACATAGTTAAAGG
> GTTGCCCCTACGTCTCAGCCTTTAGGCAACGGATGTCTAAAGAGAGTTTGTGTTGAACCC
> GCGAATTCAGGCTAGAAGAAGGCACTTGCAATCTTAAGTCCATAAGAGTGTGCCTTTAAC
> GCTTCCGTGGTAATAATACCTAGTCATGTAAGTCAGAAGTGCCATTTTGAATCACTGCCT
> CATAGTATTACGGAACACGTGTACTTATAATCAACGAATCCCGATCTCCCTCGAGCGAGT
> CTTCAATATGGCAGGAGTCGGACATTATCAACAACCGAGCCTGAACAAAACGTAACAGAT
> GCCAGGAGTTCGCCAATCTCCTTGCTTCCCACTGCCAAGTTATACACTTATCGTGTCTTA
> ATCTAGTGAAGTACTACGTGTGTTTTAAGATGCCTGGAGTAGTAGAAATGTTATGCATCT
> ATCCGCTGCGATGGTACCGGTTTATAGAAATGATCGAAGCAGAGAATTAAACTATGTTTC
> TTCAAAGTCACCTTGTGGAATCGTAAATGTTGTTACTTTGTATCAAGTTCGTCGTGCAGT
> TCTAGCATGAGATACTCTTAACACGCCCGCTCTCTGAGTTGTAGCTATAGTCATCATGTT
> TGACTAGCCCCATACATAGCAAAGAAACACCACATAGTGAAGTGGTATAATAGCTCGAAA
> GACAGTAGTAAATGACTAGATTTCAACGAGCGAGGGGACCAAAACTCATCGATGTTTCAG
> CATCAGGTCTATACCATGTAGAAACCTCATTTGCCTCTATGCAGGCTACTCGTTAATTTA
> CGTCCTATCATATCAATAGGTGTAATAGTTTCTCTTTATTATAAAATAAAATGTCGTAAA
> CGTACTATTAACATTTTTTTTATTGCATGCTTGGCAATAAAGAGGTGTTTTCTGTGACAT
> TTTGGTTCCCATGAGTTCGGCTCATTCGACGTGAGCGCCTTAAAATTCGTTTTTTTACCG
> TCAAGTTTTGAATAATGCCAGTATATAGAGCAGCGTATGCCCGCTGACTAGACGTCAACC
> ATATTTCTTATTATTAATTATAATACTACGATCCTTTAAGGAAGACGTCTAGCATATAGA
> ATATGCTGGTGTTTAACCCTCACGCACCTAAATTAATGATTAACGAGAGCTTGCAACGCA
> AGCTCAAGCATATCACGTAGGTTATCCCACGGCCTTACCTAATATTTACGAGGCCTGACT
> TGTGTAGAATACTAACAATTCAATGTTCGTCCATTGAACAGATAATTTACTGCTGTTATG
> CCGGAATATCTAATTAGGACGGTATTCATCTAAGCATAAGGCTACATTGGTTTAGTAGAA
> ACTCGTGTAGCGGAGTCGGCTTAAGGTACGTCGCCAAACAGATCAACTACTTCGTTATTG
> ATTAATCCTGAAGAGGTCTCAATAATACGCGGCCGTCGTCAATCTCTAGGTCAGACTTCC
> GGAGAATCGGGTAAGCCAGGATTTAATTTGATGAACGGAAGTGCGCTTCAATTATAAGAC
> CTTTGGTCATAAAGACGCATCGATACTTCTTTTATTTGGGGCTATACACTTAGTACAGTC
> GTACAGCTGACAATAGTAGAAATTAGGCAAGATTGAGCCGCCCAATCGAATCCGTGCCGC
> GCAAGCGACTTGACGCGTTCTTGTCTCGAAGTCCCTCCGGCGACTCAAACTGAAAAAGTT
> AGTCTGTGCTGATGAGCGCTACGCTTTCTGTTCTGTTTAGATTGCATCTAAAGCACCACG
> TAGTTTATGGCGTTAGGTATATGGCTCAAACCCACGGACTATTAGTCACCAAATAATTCG
> CGCTTTCCCTGGTATACTATGTTTCAAATTTTCGCCATAAGCTTCAAGGACAAGAGCCAC
> AATGTGTGTAGAAAATTTGCAAGCAGTTTCGCACTTCATGACCGCTATAGTAAAAATCGT
> AAAAATGGTTTAAGCCTTTTGCTGCCCTGCAACCGCGACTCGAAAAAAGATGCCCATCGT
> ACTCCGTATTTTGACATTCGGTCACAACCTTTTTTCGGACCGATATGAAGCTGAAGTAAA
> TACTCAGTGTAGGACTGCTCAGACCACAGCCGATTATCGGTAAACGTGATCTAAAACTAG
> ATAATCATAAATCTGACAACATGTATCGTTTCCCCGCTTGACGCAAACGGGAAAGTTGGG
> TTCTGCCTATTCATAGTACAAGTTAGCGCATTATTCAAAGTTCAAGGAGCGAGATATGGA
> GTATGTCTGTAATTTTAATAGACTCATCTGTACACGAATCACGATATGAGCGGCTAATGC
> TTAAAAGGTCGTGTAGTTCGTATAAGTACGGAGCTTATACGGGAAAATGGGCGATATTAC
> CTAACGTGTGCAGCAAATCAGAGTAGTTTCGATTCTCACGGCCCAAAATTAGAAGATACG
> ATAGAGACGCTTTTGGAATACCACGGTGCACCTCGAGCAATGAGCTTTATGCTTGCAACC
> TGCATATATCTTTAAAGGGATCTTTTCCGCTGACTAGTTACTTTGTCCCATGGCTACTAG
> TCAATTTATACTAACGCGAGCTATGAGTTACATGCAGTTGAACTGGAGTTGTCCATTCTA
> CGACCGGCAAATTGCCGCGTAGCACGTGTTTACGAATAGGAACTAAAATGTTCGAAGAGG
> GTTTAATTTAGAGTACACTGAGAGATATCGCGTAATAATGTGGTACAAAAATATGCATGT
> ACCCGCAAAGTAAGTTTTTTCATAACCTGTAGTCAATAGCAACAATTATCGTATTACGAT
> TTCAATATGGTATTGATTAAAGAAACACGTAGCGCCTGCATTGGACTTGAGAGCGGATGA
> AGTCAGACAATTGCATAGTCGGATTCCTTTGATTATCTAAACGATAGATGTTACCCAGGC
> CTTAAAATGAACCGCAATGCGGGGGAGGTTGGCTCATTGAGCATAAATTCGTCCATATGT
> TGATCCCACTACGTTGCGTAGGGCTGTATTAGCCATTCCGCTTTCGCTAACGCGTGTGAT
> GTGTGATCTTGTACGTGAGTCGTAACGATCTAAATTTCGCGCACTGGGATTTTAATAACA
> GAGAAAAAACTACACATCATTTGATATAGAAATCAAGATTTTTAAAAATATTACCATTTT
> TTTACAGTCAAACAGTTCAGACCTGCCTTACTTACCGTGTCAGGTGCTGGCGTTAATAAG
> TTTCTATTCAATTACTGTCGACTGAAATAATTCGTATCAGTGTAATAATCTGACGTGTGA
> GTGTTCTTTGATCACAAACCGTAAAACTTTCCGTCGCTAACGCACACACCCGGGGAAGGA
> TTTGTAGATCGTTACAGGGGTATGAGCCCTATCTAACTATTCGTGCTATGGTTCCATTTT
> AAATCAGACTAACAATAGAACAGCCATTAAGAATGTTTAGGACCGAATAGCATGACACCC
> CATCTTGAATTTATGATATTCTCCACAATGGATACAAAGGTCTCTTCTAAAAGTGGCCTT
> TCATTCGTACGACGCCTTTAGTTCCGGTCGAGACGAAGTTAACTGCATAAATAACTCATA
> CATTCCAGGAGGTTCGCGGATTTCCTTGTCCTTATGTAAGTTTAAATTACTTAACGTTGT
> AAATGGAACGAATAATCATTGTATACAGACGCTATAGAGTGGACGTTCGCATAGGGTATT
> GCGTATGATCACGTTCTCTATCGGGTAAATTGATGGGGGTGTTCGATGACTGAAATTGGG
> CGTAATGTAAGAAATCATTTCAGGAATATTAATATGGGCGGTACAATTATGCATGCTAGC
> TCTCTCGCTGAGGTTGAGTATGCCTTCTAGGACCTAATGATTGTGCTATACAACCAGTAT
> ATAACCAATAATTCACAAATATTTTTGCATCCAAAATCTGTTGCAGTCAATATCATTTTC
> CTTACCATTCAACTATGCATAGTTAAATGGTTAAATCTTCATACAAGAATGGCTGGAATC
> CCGGGGTCGAGATATATATACCAAGTTAGAGGAACGCTTATCGATTCCATTGTCAAGAAA
> TAATAATGTTTGTCTAAATTTACGTCGCTCTGTGATAGACGATAGATGACTTTTTATTGC
> ACATCCCAGCCCCAACCACGATTGTGTATCACTAACTGTTTAATGTTTAATTCAGCGATC
> TTGTTTATGTGACAAGTATTATGACCGATTACAACAGCCAAAGGACGTCTCTTGTTTGGG
> ATATACCTAGAGTATATCTGTAGCTGGCAACCCGTTCCTTTTAACGAATACCGGCTATTT
> TGTTTGCTTCATCAATTAGTCAACACGCGGGCCTGACTGGCTATAGTTTACATCCTCAGT
> ATTTTCATGCAAGCGTCACTACGGTGGTCGTTATATTGATAAGTTGACCAATGAAAATGA
> CAGCTGTCTATTTCAGTTCTTCCCGATCAAGGAGTTGTCCTGCTCTTTGGTTTCTCGGTA
> CCCCGTGCAACCAGCTTCGTTAAGTTTGTTTTCCGTTTTTCGACTAATCTAAAAATATGA
> CGCTAAAGATCGTCAAGAAGCTAAAAGTGGCAGCCTTCTTTCCGGTGAACCTTTGTTTCA
> GTAAAAACGCAAGCCAGGTTACTGCCCACATGCGTAGGCTACGATTCGAGTAGGAACCCT
> TTCTAGCCGTCATTTACTCAGATTAATGTCTTGAAAAAAAATTCTGAATTTATTTACGAA
> GTATAAATTAAATAAAATGTTTATGCTCCTTGATAAGGACTTATTTCAATGTTTTATTCC
> GATCATCATGATCTAGTCCAGATATAATCGTTGCTTCATAAGGTATCTGATATTCTCACT
> CGGCACCTCCTAGACACCAAGTTCAGCGAATGACACAATGATCAATGGCGATTTCATAGT
> GCACTCTGGCCTTAAAGCTGGATTTAGAGCATTACCCCCTGGGTTTTCTAACATAATTAT
> GATTGTGCTTGTTGTTGGTACTATCGACTATAAATTAAAATACCTTTATAACTCGTGGTT
> GAAGTCAACTGGACCAAATGGGCACTACAATTGTTAATTGTCTCCATAGTCGGATTCTAA
> CTAATTGTGCATGTCACCATCAATTGCGGACCTGCAATAATCAACTGTCTTAAAAGAGGC
> CGAAGTGACTGTCATATTATAGAGTCCTTTGGTGATTTTATTAATTAGATGCCAGGTTAA
> TAGTTGGTGAAAGACTAACGAATACGAATCGGCTATATTGAAAAACCATTTATTAAAAGG
> AGGGGGATTCGAATTTTGCTGTTATGCTTAGTATTTGTTGGGCAAGAGTATTGTAGTACA
> AGGAACCGATAAGAAATCATCATTATTACACGTAAAATTACGTTTCGCATAACACTGATT
> TGGAGAATACATTCTGAGTAGGCCATATTTCTGAATAGACAAGCTCGCTATGTGCTACCA
> TTATTCTACCCGTTTGTTCATTATGAGATCCGGTTAAATTATGGAAACAAAAGGTAGTTA
> TAAAAAAGAGATTTGACAACTGAAATCAGATCACTGGGTTGGCTAATCAGATTCACCCAG
> GGGTTTGTGGTTAACACAACCATTAGGAGGTGTTCATTTACATCAAATTTTTACCACGTA
> CTTAGGAAAATCCAGAAGCACCTTCAAACTCTCTACCCATTCTTCGTGGGGCATGAGATG
> CAAATTTAACTGAACTCAAGCTTGACACCTCGGGTATTAGCTTCTGGGATCGATTTCGTG
> GCTTTTTAGGATAGAGATCACCGCTAATTCCACTCGCGCTCGTTCAGCTCTAAGCTTGTA
> TCACATCGATTATTTGACATAAATAGGCGCATAGCTGTTTCATCTATTGGAGCTATTGAA
> TTATATCAGTACATAGTCTCAATCACCCGCTCATCAAGTATCAGGTTTTTTATGGGTGAT
> AGCGATATGCTAACAAGTCATCAAAAATTGTAAGTATTCCTATTTGCAGCCCTACAGGCG
> ACCGTCCTAAGCTCATTCTTACAAGTGAAATCCAAGTACGCATGCCGCTAATACTAATCT
> AAGGTATTACTGTACAATGGCATCTAGACCATATGCATGTGACATATGGACCTCTAACAC
> TAACAAACTAATTTCAGTCAAGACTGAAATTGAATAATGTTTGCTATAAAACTGAAGCGA
> CATCCACCGGTTACTAAGGGCTTGTCTACACCTTAGTTCCTCGCAGTAGAATCAATTTTT
> AAAAATATTTAAGTTTTCAGGAATGAAATGCGAGCTATGAAACGTCCCAAATTCCTTAGA
> AGATGTACGTTTGTTCACACTCGTAGCATCAGATCACAAAGAAGTTTGGATAGGTGGAAT
> GAGCCACGATCCATTATAATTATAAGATAGTTCCATGAGTATAGAGGCCTCGAACCTTAT
> CCTTTGAGTAATCACATCGTATAAAATGTTCAGCGCACTCTCCCCCCGGGATATGGTTTT
> GCCAGGTTACCTACGCAAACTCTAAATACAAAGAGGGAGCTATATAAAATAATGAGATCT
> GTCATCAAAAGAATTAATCGCACACCGCCAAAATCACTTCTCTCGGTGAATCGAGATTTA
> CCTACCCTAAGGTAACTCTTTTGTTCTAAGCAAACATCACGTATACTTTGCTTCTGACAA
> TTTGAGGAATAATGCCTTTTTACTCCGACAACAGAAGGGGCTCCCACTCACTCTTAGAAA
> GAGGATTGAACATGAATTTTCAGCCTCTATATATATACCTTCATAGTATTGACGGGAGAT
> ATACCGCGGCGTCTAGATACTCGTAAAGCCAGTGTACTTCGCAGAATCAATTCATACTCC
> ATCTCTATGATGACGAATATAGGTCAGTTCTAATGTGTGGTCTAACTTGTACTCACCGGC
> AATATCCCCATCGTGTATTTCACTCTCATTCACATTTCCATCGTTACGAAGGTAGGGCTT
> TTGGTAAACAAAGTGGACCGATATCGGATCTTTATGTATCAAGAATGAACGTCAGCAAAT
> ACATACGATGTAGGTTTAGGTACACCGCATGGATCTCCTCGCAGTCATGATTGAAACTCA
> TCGGACTTTATTAGCCAATATTGCCAGCGTCTTATTATCCATTCTTCGGATAATCACTCT
> GCCGTGTTAAAGTCAGCACACCAAGGAAAGCCACCACTTACAAAGGTAAAGCACCATACT
> AGCTCAATGGGAGCCCATTGGCTGAAATTCACCTTAAGCATGACTCTAGATAAACCGATT
> GCCTTCATTTAGGTCAGTTAAGGAAAAGACAAGAAACTGCACTCTCATTCACGAACCCCA
> AGACGGGCCTTCAGTCCAACAGTTGAACTATGGTCTGAATAGGTATGCACTAATACACAT
> TAGTAACACGGCTTATAGACGTGATGGAACGTTGGGGCATTTATCAATCGACACCAAATA
> TTCAATGCGCACATGCTGTTAATAGTTGCATAGTCTTGACCAAACTAAACTGTATAGTTG
> CACATGACTCACAAGAACAATTAGGCACATCCATATTTTCGATTTCTTTCAGTCTCACGA
> GCAGGAGAGGCTTGAACCAGTTAACGCGTCTTGCACATACCGATTTAGAGCGGTAGTACC
> AATAACGCTTTGCAATCGCTAGTGATGGTTGTGGACTGTAGATATATGATTTGTAAATTA
> TCTTGTGACTTGTGTTATTCTTAGCTCATTGTATATTAGTCTAGTGTCGTTAACATTACG
> AATAGGGCTCTCGACGCGACCTAATAGTATAAGAAAGGCTCCACGCCTTAAGGCTGTTGT
> GGAAGAGAACATCAGTCTAGATCAGGTCATATAAACTCTTACTATCACTATTTCGATAGA
> TAAGTCTAAAATGCACTCCAATCTAATTCTTGATTATAGCTTATATAAAGGCTCGGGTTA
> GCTTAAGCCTGACATGTAATATGGAATTACACTGTCTATAACTGGTCACCAGCAGTTGAG
> GTTTGAGATTTCGTGAACGTGACTTTAATAGCGTAGTGTGATCCTCTCTTAGGCTCGATC
> AGAATAATAGAGCTTTACTGTTCCGTGGAATACGATTGTGTTATGTACGAGCATTACGTA
> ACAAATCAAGTATTGTAGTTATTACTATGAATATTTTACCAGCATATGTAACGAAAAACG
> GGTGACCTGTTACTGACATGCAAGAGGGATTGCACACGAATCTAACATCTGCAGAATTCT
> AGACAAAACGCCTTGATCAGCCTAAAGATTTAAAAGCGCTCCAACTTGTATGACTAGAGA
> ATGGTAAAAATGCTCGGGGAACCTCTTGGAAATAGCTGACTATCACTAACGAAGGGTGAT
> GTTAATAATATAAGTTCAATAAATAACAACAACCATATTCACCGGAAAATCATTAGATTC
> TTAGACAATTCGCAGAATCACATTCATGTGGGTTCTAATTCATAAGTAATCGGATTAGTG
> CTATTATTCCCATGGCTGACGAGTCGTCACTTGCTATGCCATAATGGAAAAGGATTGAGA
> AGCTTCGAATAGTTCTGACTCAAAATCCGCACGGGGTTTTTCTGCAGTGACGCCATGCGA
> GATTGTACGGATGCTAACGAGGCATGATCGCTTACAGATGATGGCCGTAAACGATAGTCA
> CCATGTAATGGTATTAGTGTAGCTCTATATGAGGGATAGCATGGTGTCCCTACTACGCCT
> TATAACAGGTATGCACGGCCGTATTCTGCGAAAGGTACTTATAACGTTTTGTCCTACAAA
> AGCTTCTCGGACTTCAGAGTTAGCTGTAGTACTGTGATACATAGTTTTATAAACGTGAGT
> CCATTCGTCTAGCGGTTCTATTTCATCCTCAATGACCGAACTTCTCGTACTCTTATTCTT
> GTTCTCCGAGGGATATAACCAGAGTCATAAAGTGAAGCATACAACACTACACACTCCCTG
> TTCTCACTGATAAAAAGACAGCATTATAACGGCTAACACATACACCGAAAATATCAGACT
> AACTGCTACTCTCTAATAATTAGATAATACTCCCTTAATTCATTAATCATATTTAGCGTT
> TCTGATGAAAGGCGCCATATTAGTCATTAGTGTCCGTAGTGAATTGCACCGGAGCAGTCA
> ACCGGAATATAAATATACATCGGTTATAGATCATGAGATTATTCATTGTTGATCTATATA
> TATGAGAACGAACTAGAAAAACATCATATCACAACGGGTCTTTTTTGATTGTCCATACCA
> CGATACTACTATGATTTAATTGGATATTTGCATATCTAATGAAAGTATCTGGTATAAAGT
> CGTACGCCGCTCTAACATTAGGCTGTAACAATTTTCGCTAACAAAATAGAAGACCCCTTG
> GAGAATAGTCCTACGTACATGCAATGTCCTCTATCCTCATTGGCGCAAGCATCATTAAGT
> GAGGGATTTACATACTTAGGAAAGCTTGTGAAATAATTAGACTTCACGCTGGATAAGAAG
> GCCTGATGCTATTTGTTCGTTGTACAGTTACGATGTGATGGCACCAAAAATTTCTCAGAC
> TCGTGCAGCAAGACTTTTTACCGCAGACACCACCAGATGACGCGGTAGAGATATCCATAC
> GCCGGATTCCAGTGAAGTATGAAAGAAATTCTTATCTACACTGACAAGAGTGATCCGACT
> TTAAGTTCCTTCCCACACTCACGCTTCGTGCACGTCCTTTGGAATAAAGTAACTTTACAA
> CATAGATAAGGTGTGTTCTAAATTCAGCGACTTTATATACGTTATAGACAAGCTTCGGCC
> GAAAACGGAGACTTCATCGGACTATTTTACTTGGATGATGACATTAGTTTCACTGAGAAA
> GTAGTTAGGACATCAGACCCAAAACACAAACATCTAATCTAATGGATGTTAAACAAATTC
> GGACACGAAAGAAAGTCACGCTCGCCCAGACTCATCCCACCCCCACGTTGGCAACAAAAG
> GCCTCTATCTACGCGTTCTAACTCTAGCTATGGTAGACCAACGCAAGCCGATCATTTTCT
> GACTTTACAACCCTATCTGTTTAATAGGATAGGTAATCAAAGTCGATAACTAGAAGGAAT
> TGTTCGATCCAGGTGGGATGTCGGCACTACAGAAAAAGACGATATGAGTCATCTTATCCA
> CATCACTTGTCGCGAGAGTTAAGTTAGTCAATTAGCTCACACTATTTATTACTTGTGGAG
> AATACCTTTATGTTCTACTTACTAACATTATTGCAGCCTTTGCTGTGTAGCTTAATAGTA
> TATTAATATTAATTACCGCACTCTCCCGCTTTACTAAACACAAGTGCTAGTCACTTTTCT
> TGCTACAAAGCATCTCATACGATCGGTTAAAGCAGGATAGCTATTCATATCTTGCCAAGT
> TTCAGTTTTTAATCTTTATGGTTGACGAAAGCTGGATAATAGTTTCTTAACGACTGATTA
> TATTCTATCTTAATGTTAGCACGAAATAACCTGAAGTCTATAAGTGAATGTTGCAAATTG
> GGAAACGATCTTCGTTGCTCATTACGAATTTAAAATGTCGACCTATGAGATAGGACAGGA
> CTCTATCATGTTAGGGTAGTAAGAATCATTATCTGTACCCTTCGGTGTAGGCCTGTATTA
> GTAGATCAATTCAACCGTTAAGGTTGCCACTAAAATCAGTTGCTAACTTAAAGGATGTTG
> TAAACTTTTTTTTGACGATTTCAAAATATCGTTTACTGTGTACGCCTCTACCTTTACTAG
> TGGTCTTAAATTACCCCCCGACTTAAGAACCCTAAGAATAACGTCATCTCTTACATCTAC
> AAGCGTGACTGTAACTATTCCTATCGATACAATTGGTCGAAAATGTAGGAGAAATCCTCA
> CAGCCCTTTGCTATCGACGATTAGGCTAGACCAGTATTGCTAATATCTTTAGCCCCTAAA
> ATTCAACTTTTATGGACTATACGTATTATCGTTACTAGTCTATCCGTAGTGACCGATTAT
> TTCACAGGTGTCTGGAATTATTATTACTCTGGTGTGACTTCTAGCGTTAGCAAGGAATCG
> GTAATAACCTGAATATCGATAAGATATTTATGCAAATCGACCACTTTTGTCGTATAGATA
> CGCACTGTGAAGTGAGACTGCCAATTCTAGTTTTAAACTTCATGGGATATCGACTAGCGC
> CACGTTGGAATATGAAGCTGGTGAAAGACCGTTACTCTAATTTGCAGATTAATGATCCAA
> GTTATATGTAATAGTTAAGTCCTTACAGGGAAAGTCTTTTCTTTTTGTCGGCGATCCATC
> CAAGCCTGGCTACTGTCCAATATGCGACATTAATGTATAACATGATAAGACGCTAGGAGC
> TAGAAGCAATAACATAGTGGCGGTCTATTAGCACCAGTTAAACCGCAGAGCTAGTTTACA
> GGGTCCTCTCGGAGATCTATACCGCATATAGATAATGGAAACCGATTAATAATAACGATT
> CTATTCTTTGCATTCAACGAGACCTAAAGCTATCCGTTCATGTTTGTCTCGTCCATTGAG
> TGTCGGAAAAAGTAGAATAAGCCCCTTTTAGGTTAGGATCTTTGAGAACTGGTTACCGAC
> GTTCCTCTTGCGTACTAGAAACGTGCGGGTTTTAACAATGCCTATTTCTCTTTGATTTAC
> ACCATGTTCGCACCCCCTTGGGCAATCCTATTGTTTCGAATCGTTCTTATATTAACAACT
> AGGGTTTTAGTAATTTCTTATTGCCTTGCCCCTACCGCTCACCCTTTAGGAAACGGATCT
> CTATACTGAGTTGCTGGTCTACAAGCGTATTAACGATTGTACATGGAAATTCCAATCGTA
> TCTCAATAAGTCTCTCCCTGTAACCCTTCCCTGCTTTGAAGAAATAGGAATGTAAGTCAC
> AACTGCAAGTTTGAAGAAAGGCCGCTTAGTAGTAACCAAATCGGGTACGTAGAATAAACG
> TATCCCCTGCGCAAGAGAGCCAGTCTTAATTAGCGCACGAGTCGCACAGGATCTACAAAA
> GAGCCGGATCAATAACTATAAGATGCCACGAGTTACCCAATATCATTGATTACCTAGGAA
> AAGTTAGTCTCGTTGAGTGTCTGAATAGACGGAAGGAAGTCGTGTGTTGTAACATGCCTC
> GAGGACTTCAATTGGTATCCTTCGATACGCTCCCAGGGTACCGGGTTATACAATTCAGAC
> AACATGAGAATTAATATATCTTTAGTAAAAGTAAAAGGGTGGATTAGTAATTGTGGTGAA
> TTTGGATAATGTTCCTCCTGCAGTTATACCATGTGATACGATTTACACGAAACATCTCTG
> AGGTGTACCTATACTAAGCTTCTTTCTCTTGCAAAATACATAGAAAAGAAACAACACATT
> GTGAAGTGCGTTATTACCGAGAAAGTCACTTGTATATCAATAGAGGTATTCCACACAGCG
> GACCAAAAATCATACATCTTGATGCAGCACCTCGTTACCATCTAGATAACTCTGTTGCCT
> CGTTCCAGGATACTAGTGAATTTTAGTCCTATCTTTTCATTACCGCTAAGTGTTTCTATT
> TATTTTAAAATTTAAGGTCGGATACGGTCGATTAACTTTTTTTTGTTTGCTTCCTTGCCT
> ATAATGAGGGGTGTGCTGTGAATGTGTGGTGCACATGAGGTAGGCGCATTCCACCGCACC
> GACTTAAATTTCGTTTTTGTTAACGATAGTTTTGATTATTCCAACGTTATAGACAACCCG
> ATCCACCCTGACTACAACTCTACCATATGTCTTATTTTTAATTATAATAATAACATAATG
> GAAGCAAGAACGCTACCAGTTAGTATAGCCTCCTGTTGTTCCCGCAACCAACTAAAGTAA
> GCATTAACGAGTGCTTGCATCCCATGCTAAACCATATCACGTTCGTTTTCCCACGCCCGT
> AAATAAGATTTACCAGCCCTCAATGGTCGACAATACTAACATTTCAATGTTAGTCCATTG
> ATCACTTATTTTACTCCGCTTAGGCCCGTATATATATGGAGGTCGCTTTTCATAGATCCA
> GAACCCTACATTCCTTTAGTAGTAACTCGTCGACAGGAGTACGCTTAAGGTACCGCCACA
> AAAAGATCATCTTCTTACTTATTCATTTATCATGTAGAGGGCGAAATATTACCCCCCCCG
> CCTCATGATCTTGCGCACACTTAACGACTATCCGCTAACAAACGTGTTATTTGGATGTAA
> GCAAGTGCCAGTCAATGATATGACAGGTCCGCATAAAGAACCATCGAGACGTCTTTTAGT
> TGGCGATAGACACTTAGTTAACTCGTACAGATGACAATAGTTCATTTGACGCTACATTGA
> CCCGAAATAGCCTATAAGGCACGACAAAGCGACTTGTAGAGTTCGTCGATCCTACTCCCT
> CAGGACAATAAAACGGAATTACTTAGGATCTGCTGATGTGACCTACGCGGGCTCGTCTGG
> GGTGAGGGCTTCTTAAGCACATCGTACTTGTTCGCCGTACCTAGAGCCAGAATACACACG
> GTAGTTTAGTCAACATATAATTACCGATGTACCTGGTTTACGATGTGTCAATTTGGCGAC
> AGATGCGGAATCGACAAGACCAACAATCTGTCTTGAAATTGTGAATGATGTTTAGCACTT
> AAGGACCCATATTGGATAAAGCCTTAATTTGGTTTTAGAAGTGTCAGCACATGCATACGC
> CACGACATAAAACATGCCCAGAGTACGACCTAGTTTCACTTTAGGTCACAAAATTTGTTA
> GGAACCTGTTCAACCTGATCTTAATACGCAGTGTACGAATGCTCAGACATAACCAGATTT
> TCGGTAATCGGGATCTTAAACGACTTTAGCATAATTCTGTCAACATCGAGCGGTTACCCC
> ATGGACCCAAACGGGTAAGTGCCGTTAGGCAGAGTAATAGTACATGTTACCGATTTATTC
> AAACGTAATGCACCGAGTTTGGCACGAGCGCTCGAATGTTTATTGTCTCTTCGGTAAACC
> AAGCTAGTTATGACAGGCTTATCATTAATACGTAGGGGAGGTCCTATATCTACCCAGCTG
> TTACCCGAATTTCCGCGAGATGTCCTATCCGGTCATGAAAATAACAGGTGTGTCGATTAG
> CACGGCCAAAAATTTGATGAGTCCTTTGACAAGCTTTTCGAAGAAAAACGTCCACCTCCA
> GATATGAGCGGTTTCAGTGAATAATCCTTATTGATTGATAGCGATCGTGTCCGCTGAAGA
> GGTTCTGGGTACCTTGGAGTCTTCTAAAGTTATACTTACGAGAGATTTGACTTTCATGCA
> GTTCAACTGCAGTTGTCAATTCTTCCACCGGATAATTGCCGCCTACAACGTCGTTACCAA
> TAGGAACTATTATGTTCCAAGTGCCGTTAATTTACAGTTCTCGCAGAGATATCCAGTTAT
> ATTGTCGGACAAATATAGGCAGCTAACAGCAAAGTAAGTTTGTTAATTAACGCTTGTAAT
> GTGCAAAAATTATACTATGAAGTTGTCAATTTGGTTTTGTTTAAAGAAAAACCGAGACAC
> TCCATTGCAATTCTCAGCGGATGTACGCAGTAATTTCCAGTGGAGGAGGCATTTGATGAT
> CTATTACATTCAGGTTACCATCGCCTTAAAATCAACCGCAATCCCGCCCTCCGTGGATAT
> GGCAGCATTTATTCGTCCATTGGGTGTGCCAACTACGTTCCCTACCCCTCGATTACCCTT
> TCCCCTGTCCCTTTACCCTCTGAGGTGTGATAGGGGACGTCAGGCGGTTCCTGCGATATT
> GACAGAACTCCCAGTGTATTAAAACAGAAATAACTTCAAATCTGTTCATATACATATCAA
> GTGGTTTAAATTGATTACCATGTTTTTAAAGTCAAAAAGTGCACTCCTCACTTAATGAAC
> GTGTCTGGTCCTCCCGTTAAGAAGTGTCGTTTCAATTTATGGAGACTGAATTAAGTCGTA
> TAACTGTAATTTGCTCAACTCTCACTGTGCTTTGATCAAAAACCGTAATTCTTTAAGTCG
> CTTACCCTCACACACCGCGATGGATTTGGAGTGCGTTACACCGCGATCTGCAATATATAA
> CTATTCCTGCTATGGGGCAATTGGAAAGATCTCGTTCAATACTACACAAAGTAAGTTTGT
> TTTGCAAACTATTGAATGTCAAAACATCTTCATGTTATGATAGTCTCCACAAGCCAGAAA
> AAGGGCTCTTAGTAAACTGCACTTTATTGAGTACGTAGCCTTTTGTTCCCGTCGACTCGA
> TCTTTTATCATGTAAGAAATAATAAATTCAAGGTCCTTAGCGCATGGAATGCGCCTTATG
> TTAGTTGAAAGGACTTAAAGTGGTATATCCTTAGATTAATAATGGTAGAAAGACGATATA
> GACTCCACGGTCCCAGTCGCTAGGCACTAGCATAACGGGCGCTATACGGTTATGTGTTCC
> CGGTGTTCGTGCAATCAAATTCCGCGTTATGTAAGAAAGAATTGAACCAATATTAATAGG
> GGCCGGTCTATTATGATTCATTCCTCGAGCCCTCACCTTGAGTATGCCTTCTAGGACAGA
> AGCATTCTGATATAAAAACAGGAGATATAAAATAATTAACAATGAGGTTTGAATCAAAAT
> TATGTTCCTGTCAATAGCAGTGTCATTTCCTGGCAAATATCCATAGTTTAAGCCGTAAAT
> CTTATTAAAAGAAGGGCTGGAATACAGGCCTCCAGATATAGATACAAAGTTTGTCCAAAC
> CTTAGCGTGTCCAGTCGAAAGAATGAATTATGTTTGTCTAAATTTTCCTCCCTCTCGCAG
> ACAAGATTGAGGTCTTTTGTTTGCACATACATGCCCCATACACGATGGGCTATCAAGATA
> TGGTTAAGCTTTAATTCTGCGATCTTGTTTATCTGAATAGTTGGATGAACGTGGACTACA
> GCAAAAGGAACGAGCGTGGTTCGCAGAGAACGACAGTATTTCGGGAGATCGCAAAAAGTG
> CAGTTTAACCTATAACCCATATTGTGGGGCCTGAAGAATGTAGTCTACACGCCCCACTCT
> CTGCCTATTCTGTAATTCCTAACGATTTTCATGCAAGCCTCTCTAAGCTCCTACTTATAT
> TGTTAACTTGAAAAATGAAAAGGACTCCTGTATTTTTCTGTTCTTACAGATATTGGAGTT
> CGCCTCCTCTTGCGTTTCTAGGTACCCAGTCCTACCAGATTACGTAACGTGCTTGTCCCT
> TTTTCGTATAAGCTTAATAGATGACCCTAAAGATCGGCAACATCCGATAAGTCGCTCCAT
> TATGTCAGGTCAAAATTTGTTTAAGTATAAACGCAAGACAGCTTTATCACCACATCACGA
> CGCTACCAGTAGTCGAGCAACCATTGCTACCCGTAATGGAAGCAGTGTTTTGTCTTGTAT
> AAAAAGGCTGATTTTTGTTACGATGGAGAAATGAAATTTAAGCGTTAGCCTCATTGATAT
> GGAATTTTGTAAATGGGGTATTCAGATCATCAGGATAGTCTCCACAGTTAAGAGTTGATT
> AAGTAGCTATAGCTTATTCTATCTAGGAAAATCAGAGACACAATCTTCAGCGAATCTCAC
> AATCATAATTGCCGTTTTCATACTGCTCTCTCCAATGAAACCTCCTTGGACTGCAGTACC
> CCCTGCGGTTGCTAACTTAATGAGGATTCTCCTTCTTGTTGCTAATAGCCAATATTATTG
> AAAAGTCATTTTTATATCCTCCTTCTTGTATTATGCACAAAATCGGCACTACAATGGGTT
> ATTGTCTACAGAGTACGATTATAACGATTTGTGCATCGCACCATCATTTGACCACCTCAA
> ATAATCAACGGTCTTATAAGACCACCAACTCACTCTAATTTTTGAGAGGAAGTTGCTGAG
> GGTATGAATGTCAGCAAACCTTAAGTGTTGGGGAATCACTAACCTAGACCAATCGCCTAT
> ATTGAAAAAAAATGTATGATAAGGACCCGCAGTCCAATTTGCCGCTGAGCATTACGAGGT
> GTTCGCCAACACTATGCTAGTAAAAGGATCCGATAAGAATTCATCATGTTTTCTAGTTAT
> ATGACCTTTCGAATAAAACGCATTGCCTGAATTCAGTATGTGTAGGCAATATTTATCTTT
> TCACTTCCTACATTGGTCAGACCATTATTCGACACGTGGCGTCATTTTGTCATACCGGGT
> AATGTTGGAAACAAAACGTACTGATAAAATACTGAGTTGTAAACTCTAATCAGATAACGC
> GCTTGGATATTAAGATTCACACAGGGGTTTCGGCTGTAAAAAAACTTGTGGAGCTGTTCT
> GGGACAGATAAGTTGTACCTCGTACTTAGCTAATTAATGAACCAACTGATTACGATAGAA
> CAATTCTGAGGCCGCCAGGACAGCCAAATTTTAATCTTATAAAGCTGGAAACAGCCGGTA
> TTAGCTTCTCGCATACTTTGCCTGCATTGGTACCTTACAGATATCAGCGTAGTCATATAC
> ACCTCGGTCTCAGCTAAGCTTGTATCTCTTAGAGTAGTTCAAAGATAGTGGACAATACCT
> GTGGAATCGATTGCAGATATGGATTTATTTAACTACTGAGTCTCATTCACAAGCTAAGCA
> AGGAGCACGTTTTGGTGCCGGCATACCGATTTGCTATCATGTCAGCAAATTTGCGTTGTA
> TTCCTAGTTGCACCCATTAAGGCCACACTCCGAACCTAATTATTACATCGCAAAGACATG
> TACGAAGGACCCGATGTCGAATAGAAGGGAGGACTGTTCATTGGAAGCTAGACCAGAGGA
> ATCGCAAAGATGCAACTCTTACAATAAAAATCTAATTTCAGTCAACACGCAATTTCTATA
> AGGTTTCCGATAATAATGAACCGTCTTCCACAGGGGAATTTGCCATGCTCGTAAAAGTAG
> TTAATCCAAGTAGAAGAAATTTTGATAATGTTTTAAGTTGGCACGAAGGAATTCAGAGAG
> ATCTTACCTAACAAAGGCATTAGTAGATGTTCCTTGGTTCACACTCGGTCAATCAGAGCA
> CATACTACGGGCGATACCGGGAATGACACAACATCAATGAGATTGTTAAGTGAGGTAATT
> GACTTTAGAGGACTCGATCAGTATACTGTCACTATGAACATCGTATTAATTGTTATCCGA
> TATATACACCACCGATTTGCTTGTGCAAGGTTACAGACCCATTCGATAAATACAAACACG
> GAGCGATATTATTTAAGGAGTGCTGTCTTCAAAAGAATTATTCCCACACCGACATAAGAA
> CTTCGCTCCGTCATTCCAGATTTAAATAACATAACGTAACGCTTTGCTGATAACATAACA
> TAACCGAGAATTTGCTTAGGAAATTTGGAGCAATATTGCATTGTTTCTCAGTCATCACAA
> GGCCCGCCAAAGAACTCTGAGAATCAGGATTCAACATGATTGGTAAGACTCTATATATAT
> AACTTAATTCTTGTGTCCGGAGATAGAAAGAGGACGAGAGATACTACGAAAGAAAGTGTA
> CTTCGATGTATCAATTCAGACGCCTTCTCTATCATCAACATTATAGGTCTCGTATATGCT
> CGGCGCGATCTGCTTCTCTCCGCCAATAGCCCCATAGTGTATTTCAAGCGCAGTAACAGT
> GAAATCGTTACGAAGGTAGGGATGTTGCTTATAATTGTCGTAACTTATCGCTTATGTATC
> TTTCAAGAATGAACGGCAGCATATACATACGTTCTACCTTTAGCTACAAAGCATCCATAT
> ACTCCCTCTCATGATTGAAACTCTTCCCTATTTTGTAGCCAATAGTGAAAGCGTATTAGT
> ATAAATTCGTCGGTTTTTCACTCGCAACTGTTATACTCTGCAAACAAACGAAAGCCTCAT
> AGTACAAACCTAAAGCTACATACTTCATCATTGGCAGACCAGTGGCGGTATTTCTACGGA
> AGCATCACTATAGATATAAAGTTTCCCTTCATGTACGTCTGTTAACCATATCACAAGAAA
> CTGCTATCTCTGTCACGTAACAATTCACGCGCCTTATCGCCAAATGTTCATATATGCGCG
> GTATACGTATGAACGAATACTAATTAGTATAACGGAGGATTCACGGGAGGGATACTTGGG
> GCATTTATAAATCGTCTAAAAATTTTCTATCAGCACTTGCGGGTTATAGTGGATTACTAG
> GCAACATAATATTCTGTATTGGTCCAAATGACGCTATAGATAAATTAGCAAAATACATTG
> TTTCCATTTATGTAAGTCGAAACTCCAGGACTCCCGGGAACCAGTTAAACCGTCTGGAAA
> AGACACATTGTGAGCGGGACTTCAATGATAGCTTTCAATGAGCTTCTCATGCTTGGGGTC
> TGTACATATATGTTGGCGAAATTATCGTCTGTATTCTGTTATGCTTTGATCATGGGTTAT
> TAGTATAGTGTCCGGTTAAGTACCAATACCGCTAGAGACCCGACCTAAGTCGATAACTAA
> CGATCATCGACGTAAGGATCGTCTCGATCAGTACTTCAGTCTAGATCTGGGAATAGTAAC
> TCGTTAGTGAACTATGTCGTGTCATAACTCTAAAATGCAATCAAATCTTATTATTGAGTA
> TTGATTATATAAAGCATCCGCTTAGCTTTACCCTCAAATGTTATATGCAATTTAAAGCGC
> TTGATATCGTCTACTCAAGTTCAGGTTTCACATGGCCGCAACGTGACGTTATTAGAGGTG
> GGTCATCATCTCTGAGGCTAGTGATGTTGAATACTCATTGAATGGGAAGTGGAATACCAT
> GCTCGTAGGTAACAGCATGACCTATAAAATATACTATGGGTGTGTGGTAGATCAATATTG
> TTCAAGCATATCGTAACAATAACGGCTGAAATGTTACTGACATGAAAGAGGGAGTCCAAA
> CCATTCTAACAGCTGATCAAGTCGTCTAAAAACGCCTGGTTCAGCCTTAAGAGTTATAAG
> CCAGACAAATTGTATCAATAGAGAATCCGTAAATTCCTCGGCCAACCTCTTGCAAAGACA
> TCACTATCAATATACTACCGTGATCTTAATTAGTGAACTTATATAAATATCTACAACCAG
> ATTCAACGGAAAAGCTTTAGTGGATTAGAAATTGCCAAGAATCACATTCATGTGGGTTCG
> AATGCTTTAGTAATACCATTTCGCCGAGTAGTCACTTCGCTGAACTGTCGTAAATTGCTA
> TGACATAATCGAAAAGGATTGTCAAGAGTCGATTACTGCGGACTAATAATCCCCACGGGG
> GTGGTCTCATGTCTCCCCAGGCGAGTGGGGACGGTTGATAAACACGCTGCATCGCGGACT
> GATGTTCCCAGTATTACATAGTCACATTGGATTGCGAGTAGTCTACCTATTTATGAGCGA
> GAGATGCCTCTAACTACTTCGACTTTTAAAACCTTTCCACGCCAGTATTCGGCGAAAGGG
> AAGTATTAAGGGTTGTCATAATTAAGCTGATACCACTTCAGACTTTGCTCTACTTCTGTC
> TTTCATTGGTTTAGTAAAGTCTGTCCATTCGTCGAGACCGTCTTTTGCAGCCTCATTCTA
> CCAACTGCTCCGACTCTTAGTCTGCTTCTCCCAGCGTTATAACAAGAGGCATTTTGTCAT
> CCTTAAAACAATAATAAAGAACTCGGAGCACTGATATAATGACTGAATTAGAACCGCTTA
> AAAATACAACGAATAGATAAGACTATCGGATAAGATCTAATATGTAGTGATTAAGCCCTT
> TATTAATTAATAATAGTTACCCTTTCTGATGTAACGCGACATATTACGATTTAGTGGCAC
> GTCTGAATTGCAAAGCAGATCTCTACCCGATTTTTATTATAAATCCCGTATACATCTTGA
> CTTGAGTAATTGTTCATCTTTTTATATCTCTTCGTACTACAAATAATTAATATCTCAACC
> CGTATTGTGTGATTCTAATTACCAACAGAATACGAGGAGGTTTTTGCTTAGGGCCATATA
> TAATGAATCTATCTCGTTTATTCGCGGAACCCGAGATAACATTACGATGTAACTATTTTA
> GAGAACTTAATACAAGAAACATTGCTGATTACTCATAACTAAATGCTTGGTAATATATCC
> TCAGTGCCCCTACCATCTTTTACGCAGGGATGTAATTACTTAGGATTCATTGTGTAAGAA
> TTACAATGAACGATGGATATGAAGGCATGTTGCGAGGTGTTCCTTGGTATGTGAAGTTCG
> CAGGGCAACAAAAATTTCGCAGAATAGGCCTCAAAGTATTGGTAAAGAAGACAACTAATC
> ATCACGAGCTTCTGATATCAATACGAACGAGTCCTGTGATGGATGAAAGAAAGTCGTATC
> GAAAATGTCAAGAGTCTGCCCAATGTAACTTACTTCAAAAAATAACGCTTCCGCCAAGTA
> CGTTCGAATAAACGTAATTTTAAAAATACATAAGGGGTGTTAGAAAGTAAGCGACGGGAT
> ATAAGTTAGACTCAAGATTCCGCCGTAAAACGAGACTGATTCCGAAGATTGTTCGTGGAT
> CTGGTCATGACTTTCACTGAGTAAGGAGTTTCGACATATGTCAATAAACACAAAAATAGA
> AGCTATTCGATCTGAAAAATATTAGGACAAGAAACTATCTCACGCTAGCCCAGAATATTC
> ACTCACCCACGGGCGATACTAAAGCACTATATAGTCGCGTGATTACTATACATATGGTAC
> ACATAAGAATCACGATCAGGTTCTCAATTTTCAACAATATATGTTTATTTGCATAGGTAA
> TATTAGGCCTTTAAGAGAAGGATGGGTGAGATACTCCGGGGATGGCGGCAATAAAGAAAA
> ACACGATATGAGTAATAGGATCCTAATATCTTGGCGAGAGACTTAAGGTACGAATTTTGC
> GCAATCTATTTTTTACTTGGCCAGAATTCATGTATGGTATAAGTACGAACTTTTTTGATC
> ACTTTCATGGCTACCTGATTAGGATAGTTTGAGGAATTTCCCAAATATACCGATTTAATA
> TACACTAGGGCTTGTCACTTTGAGTCAGAAAAAGAATATAATTACTTAGGGTAATGCTGC
> ATACATATTCTTATATTGCAAAGGTTCTCTGGGTAATCTTGAGCCTTCACGATACCTGGT
> GAAGTGTTTAGTAACGAATCATTAGATTAGATCTGATTCTGTGCAAGAAATATCCTCAAC
> TATTTAACTCAATGTGGCTAATTGCCATTCGATATTCGTTGCTAAGGACGAATGTTTTAT
> CTCGAAATTTGTCAGACGACACGTCTATATAATGGTTGCGGAGGAAGAATCAGGTGATGG
> TCCCTTACCTCTACCACTCTATTACTAGAGCAATTAAAACGTTAAGCTTGCCAATATAAT
> AAGGTCATAACTTTATGGTTGTTGTTAACTTGTTTGGCTAGATTTAAATATATAGTTTAA
> GGTCGAACCCGCGACCGTTACTACTGCTCTTAAATTTCCCAACCTATTATCATCCCTTAG
> AATTACGGCATCTCTTTCTGCTAAAAGCCTCAAGGGATATTGTCCTTGAGATACAAGTGG
> TCGAAAATGTAGCAGAATTAATATAACAAATTTCCTTTCGAACTTTACCATTCAACACTA
> TGGCGAAGTGCTGGACCCAATAAAATTCAAATTGGATGGTCTATTCGTTGTTTAGTTTCT
> ACGCTATCCCGTGTCAAACATGTTTTCACAGCGCTATCGTTTTATTTTTAATCTCGGCGC
> AATGATACCCGGAGAAAGGAAGCCCGTAGATCATGAATATCGAGTAGTTTTTGATCCAAA
> TCCAAAACTTGGGTACGAGACATAAGCTCGGTGATCGCTCACGGACTAGTCTACTGTTAA
> ACTTAATGGGATAGACACTAGCCCAAAGTTCCAATAGCTACATGCGCAAAGTAAGGTTAG
> CGATTTTGCTGTGTAATCAGACAAGTGATATGTAATACTTATGTCAGGAAACCCAATGTA
> GGGGCTGGTTCGCCGCCTTCCATACTACACTGGCTACTGTAAAATATGAGACATTAAGCT
> ATTAAATCAGATGACGCTAGGAGCGACATGCATGAAAAGAGTGCCGGGATATTAGCACCT
> GGTAAACAGAACACATAGTTGTAAGGGTAAGCTCCGAGTTCGTGACAGCATATTGATTAG
> CGAAACAGATTTAGAATAAACAGGATATGCTTTCCATTCAACCTGTCATTATGCTATCAG
> TTCATGTTTGGATAGGAAAGTGACTCTCGGAATAACTAGAATATGAACCTTTTACGTTAG
> GAGATGTCTCAACGGGTTAAACACCTTCCTCGTCAGTAATAGATTCCTCCGGGTTTTAAA
> ATGGAATTTTTCTCTTTCATTTTAACCAGGTGAGCACACCCTGCCGCAATACGAGGGTGG
> CCAATACTGCTTATAGTAAAATATACGGTTGTACGTATGTCTTTTTCCCGGCAAAAGTCC
> GCTAACAAGGTAGCAAACCCATCTAGATACTCACGTGCTGGTCTACAACAGTAGTAACGA
> GTCTACATCCAAATTCAAATCGTATCTAATTATCTCGCGCCATGGATACAGTAACTGCGT
> TGTAGAAATACGAATCTAACTATCATCGCCAAGTGGCAAGAAAGCCAGATTACTTGTAAC
> CTAATAGGGGTAGTTGTAGAAAACTATACACTGAGAAAGACACCCACTATTATTTTGCCA
> ACCACTCCCAATGGTTCTTAAAAAGTCAAGCATATTTTACTATAAGAGGAATCCTCTTAC
> CCATTAGAATGGATTACATAGCAAAACGTAGTATCGGTGACGCTATGTATAGACGCATGG
> AAGTACGCGGTGGTTTCATCCAGCCTGGACTTCAATGCGTTTCCTTCGATAAGAGCACAG
> CCTACACGGGTATACATTGCAGACAACATCACAAGTTATATATCGTTAGTAAATCGATAA
> GGCGCCATTACTAATTCTGGGGAATTTGGTTAATCTTACGCCGCCTCGTATACAATGTCA
> GTCGATTTTCTACAAACATATAGCTCGTCTTCAGATACTAAGATGCTGGCTCGTCAAAAA
> GAAATACATATCTAACAAAAATGTCTCTACGGCGTGTTTTCAGACAATCTAACGTCTATA
> TCTATTCAGGTATTACACACTGCCGTCATATAATAATACTTCTTGATCAAGCACCTAGTT
> AAAAGCGTCTTAAAGCTGGGCAATAGTTCAACCAGTATACGGTTGTGTACTAATATATTT
> TATTTACCGCGAAGTCTGTATATGTTTGTTAATAGTTATGCTACGATAAGGTAGATGAAA
> TTTGGTGTGTGTGATTCAGTCCATATATTCAGGGGTGGGATGTGAATGTGGCCTGCAATG
> GACGTAGCAGAATTCCTACGCACACACTTAAATGTACTTTTTGGTAACGATACTGTGCAT
> TTTGCAAACGTTTGTCACAACACGTTCAACCATCTCGTCAACTCTAAATTAGGTAGTTTG
> TGTAAGTTTAAGAAGAACTTAATGGAAGCATGAACGAGACATGTTACTAGTGCATCCTGT
> TGTTCAAGAAACCTAAGAAAGTAAGCAGTAAACTGTCCGTGCATCCAATCATAAACATTA
> GAAACTTCCGTTTAAATACCAAGTAAATAAGTTTTTCCTCCAATCTATGCTCGACAATAA
> GAAAATTTAAATGTTAGTAAATTCTTATCTTATTTGTATCCGCTGTGCAACGTATATAGA
> TGGACCTACCTTTGCATAGATCAAGATCCATACATGCCTTTACGTCTAAATCGGCGACAC
> CACTACCATGAACGTACCGACAAATAAACATAATATTCTTACGGATGCATTTATAAGCTA
> CACCGAGATAGATTAACACCACCGACGAATGATATTCCGCTCACTGAACCACTAGACCCT
> TACAATCCTGTGATGTGCAGCTAACCATGTGCCAGGAAAGGTTATGAAAGGTCCGAAGAA
> ACAACATGAGAGAAGTATGTGTGTTGCCCAGAGTATCTTTGTTAACGCCGTCAGATCAAA
> AGACGTCATTTGACCATACTGTGTCCACAAATAGACTATAACGCAACACAAACACTAGGC
> TACACGTAGTCGAGACTTCTAACGAAGCACAAGATTTAGCTATTTCTGAGGATCGGCTCT
> GCTCACAGTACAGGGATCGTAGCGGGTCTGGCATTAGTATCAAAATACTACGTGTTCCAC
> GTACCTTGAGCCAGAATAAACAAGCTAGTGGACTCAACATTTTTTTACACATGGAACTCG
> TTTACGAGCTGTAAATTTGGCGAATGATCAGGAATCGACATCTCAAAATTTCTGGCTTCA
> ATTGGGGATTGATCTTTACCTATGAAGGAACCATTTTCGTTAATGACTTAATTTCCGTTT
> TGAAGTGGCAGCAAATCAATAACCCTAGACATATTACAGCAACAGAGTAAGAACTAGTTT
> CACTGTAGGGCAATAAAGGTGGGACGTAACTGTTCAACAGCATCTTTATTAGCTGTCTAC
> CTATCAGAACAAATAACAACTGTTTACCGATTACGGTGATTATAAGACTGTTGATTAATG
> ATCTAATATGCGAGACGGTAACACAGGCTACAATAACCCTAAGTGCCCTGAGCAAGAGTA
> TTAGGAATTCGTACACATGGATGATATCGGAATCCTCACACTTTGCCACGTGCGAGCGAT
> GGGGTAGTGTAGCTTAGCTAAAACATGATAGTGATGACAGCATTATCATTTTTACCTACG
> CGACGGACTATTTCGTACCAGAGGTTAACCGAATTGCCCAGAGATGTCAGATACGGTCAT
> CAAAATATCACGTCTGGACTTGAGAAACCAAAATTAGGTCATCAGTCCTTTCACTAGCTG
> TTCGTAGAAATACCGCATACGACACATTGCTGAGGTTGCAGGCAATAAGCATGTGTGAGT
> GTTTCCCATAGGGTACCATCAAGACGTTCTGGCGAAATGGGAGTAGTCTAAAGGTATTAT
> TAACAGAGAGTGCACGTTATGCCACTTCTACTCCACTGGGAAATTATTACTAACCATTTG
> TGAAGACTTCATAGTCGGGAACTAGACGTTAGATTAGGTGACTACTGCCGTGAATTGACA
> GTTCTCGCACACATAGACACTTATTTTCTCGGTCTATTAGAGCATGCTAACAGATATGTT
> ACGTTGTGAATTTAAGCTTCTATTGTCATAATATTATACTTGGTACTGGGCTATTTCCTT
> GTCTGGAAACAAAAAACGTCACAAGCAATTCCAATTCTCAGACCTTCTTCGAACTAATGT
> CAAGTGGAGGAGGAATGGCTGGAGCTTTTACATTCAGCTGAAAATCGAATTATATTCTTA
> ACAATTCCCCCCCTCCGTCCATATGGCTGAATTTATTACTACTTTGGGTCTGCAATATAA
> CGTCCCGTCCCATCGATTACAATGGAACAGGGCCAGTTACCCTCGCTGCGGTGATAGGGG
> ACGTCTCGACGTTCCTGAGATAGTGACACAAATCCCAGGGTATGAAAACTGTTATTTAGT
> CTAAGATGTGCATATACATATCTACTGGGGGATTTTGTTGAAAATGGTTTGAAACGAATT
> AACTGAACTAATCAAGTAATGAAAGTCGATGCTCATCCAGGGATGATCTGTAGTGTCATG
> TTATCGACAAGCATTTTAGGAGTATAACGCGTTGTTGATCTACTCTCTCTCGGAGGTCTG
> AAAATTACCTAATTAGGGAAGGACATTACCATATAAAAACCCCTTGCATTGCGTGTGACT
> TTAACCCCGATCTCAAATATATAAATTTTACTCCTAGCCGGAATTGGGATAGATCTCGTT
> AAAGACTTATCAAAGGAACTTTGGTTTGCTAACTTGTGAATCTCTAAAAAGAGGCTTGTG
> ATGATTGGCTAATAAAGCCTGTAATAGCGATCTTAGTTAACTCCAATTGATGGAGTAACT
> ACCAGGGTGGTAACCGAGTCTCCATCGTTTATCATGTATGAAAGAAGTATTTCATGGTCC
> GTACCCCAGGGAATGCGAAGTATCTTTGGGGTAAGGACTGATACTGCGATTTCCTTAGAT
> TTATAATGCTTGTAACTCCATAGTGACTCCAACGGACAAGTCCCTTGGCACTAGCATATA
> CGGCGATTTACCGTTTTGGCTTCCCCGTCTTAGTGCAAGCAAATTCCGAGGTAGCTTACA
> TTGAATTGAACCAATATGTTTAGCGCACCGTATATTAGCATGCATTCATAGAGACAGCAC
> CGTCACTATGAATGCTTGCAAAGATGCTTGCTCAGATAAATAATCGTGATATAAAAGAAT
> TAAAAATGAGGTGTGAATAAAATTTAGGGTCATCTCATGAGATGGGGCAGTTCCTGGAAA
> ATATCAATACGTTTAGCCGTAATTATTATTAAATCAAGGGCGCCAATACACGCCTACACA
> TATTGATAAAAAGGTTCTCCTAACAGGAGACTGTAATGGCGATACTTTGTTTTATGTTTG
> TCTAAATTTTACTACATATCGCTGACTACATTCTGGTATTTGGTTGCCTAATAAATCAAA
> AATAAACCATGCGCGTGAAAGTTATCGTTAAGCTTTTATTATCAGATATGCGTGTTCTGT
> ATTCGTGGATCAAACTGGACTTATGAATAACGAACGAGAGTCGTGCCCTGAGAACGACTC
> TATTGAGGGACAGCCAATAAACGGAAGTTGAAACTTGAAACCATTGTGGCGGGCCTGAAG
> AATGGTCTATACAAGACCCACGCTATGCAGAGTCGGGAATTACGATCGATTTGAATGAAA
> CCCTATAGAACCGCCTACTTAGTGGCTTAACTGCAAAAAGCTATAGGAATCATCTATTTG
> TCTCTGATGACACATATTCCACTTCGCAGCCTAGTGCCTGGAGACCTAAAAACTCATTAA
> AGATGACGTTTCGTGCTGGGACCTGGTTCGTAGTAGAGTTTTAGATCACCATAAACTTAC
> GCATCATCAGTTAACGCCATCAAGGATGGAACCGCTAAAGTGCTTGAACGTTATACGAAA
> CAATCCTGTAGCAAATAAGCACGACCCGACCAGTACTCGTCCAAAAATTGATTCCACGAA
> TGGTAGATCTGTTTTCGATTCTTTTAAATGGAGCTTTTTTGTTAAGATCGTGAAAGGATA
> GTTAAGCGTTAGCATCATTCTTTTGCTATGTTGTATTTGGGGTAGTCAGATCTGAAGGTT
> AGTCGAAACAGTTAAGACGTCATTATGTAGCTATAGCTGATGAGATAGACCAAAATAAGA
> CAATAAATCTGAACACAATCTAAAAATCATATTTCCACTGTTAAGACTCATAGATCCAAT
> GTTACCTCCTGGGACTCAAGTAAAAACGCCCGTTGAGAACTTTTTGAGCTTGCGCATGCG
> TGGGCCGAATAGACAAGAGTATGGTTAAGTAATTTTGTTAGACTCCTTCTTGGATTAGGC
> TAATTAGCGCCAAGAAAAGGCGTTAGGCTATAAAGAGTACGAGTAGAACGATTGGGCAAT
> CGATAAATATTTGCACCAAATCATTGTAGATACGCGATTTTATCACCACCTTCTCAATCT
> AATTTGTGACACGAAGTTCCTCAGGGGAGGAAGGTCTGCAAACCTTTAGTGTTCGGCTAT
> CTATAAACTAGTACTTTACCATAGATTCATATTAAATGTTTGATAACCACCCCCAGTACA
> ATTTGCAGCTGAGCATTTCGAGGTGGTCCCATACTCTATGCGTCGAAAACCATAACTGTA
> CATTTAAGATGGTGGTCTAGTTATAGGTACGGTCGAATATAACGCAGGGCCTGTATTAAG
> GAGCTCGTCGCAAGAGTGAGCTTGTCACTTCCTACATTGCGCAGAACATTATTAGTAACG
> GGGCGTAAGGTTCTCTTACCGGGTTATGTGGGATTAATTTCCTACGGATTAATTTCTCAG
> TGCTAAAAGCTTAGAACATAAAGCCCTTCCAGATTAACATTAAAACTCGCCTTGCGGCTG
> TTAAATTAATGGTCCAGCTCGTATGGGAAAGATAAGTTGTACCTACTTCTTAGCTTTTTA
> ATGTACAAAATGATTAAGATAGAAAAAGTAGGAGGCCCCAAGCACAGCAATAGTGTAATC
> TTATAATCAGGGAAAAAGCCCCGATGACATGATCGCTTACTGTGACTCCATTGGGTCCTT
> TCTCAGATAAGAGTAGTAATAGACACATACGGATCAGATAACAGTCTATATATGACTGTA
> GTTCAAAGTTAGTCGACATGACATGTGGAAGAGTGTCCAGATATGCATGTATTTATCTTC
> TGACTATAATTATAAACCTAAGAATCGAGATCGTTTTGGTGCCCGCATACACTTTTCAGA
> TATTCGAAGCTAATTTGCGTTCGAGGACTAGGTGAACAAAGTAACCCCAAACTAAGAACA
> TAAGTATTTCATCGCATAGAAATCGTACATGCAACCGTTGTAGAAGAGTACGGAGGTAGG
> TTAATGCGATGCTTGAAATGTGCAATCGCAAAGATCCTAATATTAAAAGAAATATATATT
> TTAACTATACTAGCTTTGTCTAGTAGCTTTCAGAGATTTATGTTCACTCTGAATCACCGG
> TATTTCCCAGGCTAGTAAAAGGACGTAATACAACGACATGATATGTTGATAATGTGTGAT
> GTGGGCACCTTGGAATGCACACAGAGCTTTACTAAATTTGGCATTTGTACAGCGTACTTG
> CTGATAACGCGGTCAATATCAGAAATTACTACGGGCCATACCGCGTAGCACAATACATAA
> ATGTGTTGGTGAAGTGTCGTAATGGTCTTGACAGCAATACTTAAGTTTAATGTCACTTTG
> AAATTACTTTTAATTGGTATCACATAGATAAAAAACCCATTGCCTGGTCCAACCGTAAAG
> ACCAATTAGAGAAATAATTACACCCTGAGATATTATTTTTGCACTGCGCTATTAAATTGT
> TTGTTGCCAAAAACCAATTTTGAACTTAGCGCCCTCTTTACACAGTGAAATTACAGAACC
> TAAAGCTTTGCTGATAACATTTAAGAAACGAGTATTTGATTAGCTAATTTGCAGCTATAT
> GCAATTGTTTATAACTATTAACATCGCCAGAAAAAGATAGCTGACAATCACGTGTCAACT
> TCTTGGGTAACACGAGAGAGATATTACGTAATTCTTGGGTCCGCTCTTAGAAACACCACG
> AGACTGAAGACGTATGAATCTGTAATTCCATGTATATATTATGACGAATTAGATAGCAGC
> AACTTTATACCTATCGTAGATGCTCGCCGCGATATGCTTAGATAACCAATTAGCAACAGA
> CGGGATTGATAGAGAAGGATATGGGAATGCCTGAAGATCCTACCGATGTGGCTTATAATT
> GGCGTAACTTTTAGCTTATGTTGCTTGAAAGTTTCTAAGGATCATTTTTAATTAGTTCTA
> CCTGGAGCGTAAAAGATGCCTGATAATACATCTATTCAGGCAATATATTCCCTATGTTGG
> ACACAATAGTGAAACAGTATTAGTTGAATGTAGTACCTGTTTAAATAGCAACTGTTATTC
> TATCATATAAAACGTATCCATCATAGTAAAAACCGTAACCTAATTAAGTCATATTGCCCA
> GAAATGTGCCGCTATTGCTAAGGATCAATCAATATACAGATTAAGTTTCAATGCAGGGAC
> GTATGGTAACCATATCAAAACTAACTCATATCTATGGAAACTAAAAATTCAACCCAAGGA
> TCGCCTAATCTGCATAGTTCCGAGCTATACCGTTCATCGTTGTATAAGGACGATATCCGA
> GGATTCAAGGCAGCCATACGTCCGGAAGTTATATATACTCTAAATTTTTTATTGCACAAA
> TGCAGCGGTTTAGGGCATTACTAGGCTACTTTAGTTTATCGAGTCGTCCAAAGCACGATA
> TAGATATTTGACCATATGAAAGTGGGGCCTTTTATGTATCGCGAAACTCAACCACTCCAG
> GCAAAAACTTTTACCCGCTGCATATGTAACATGGTGAGCCCGACGTAAATGTTACAGTTC
> AATGAGCTTCTCATCCTTCGCGTCGGGACTTATTGCTTGGCGAATTTAGAGTCTCTATGC
> TCGGAGGATTTCATAATGCGTGAGTTCTAGACTCGACGGTTAAGGACCTTTACCCCTAGA
> CTACACACATTAGTCGAGTACTTACCAGAATACAAGGAACGATCGGCTCCATCTCTAATT
> CACTCTTCATATCCGATTTGTAAAGAGTTAGTGATATTGGGAGTGTCATAACTATATATT
> GAAAGCAAATATTATTATGCTGTATTCAGGATAGAATCCAGCCGCTTACCTGTTCCATCA
> ATTGTTTGTTCCTTGGTAAAGCGAGTGTTAGCCGATAATCAACTTCACCGTTCTCAGGGC
> CGCTAACGGTAGTTTTTACACGTGGGTCAGAAGATAGGTCCATACTGATCTTGTTTACTC
> AGGGTAGGGGAACTGCAATTCCAGGCTCGTAGCGAACTCCAGGACCTTTATATTATACTA
> TGCGTGTGTGGTAGAGCTATTTTGTTAAACAAGTTCGTAACATTATACCCGCTAATGTTA
> ATCTCTTCAATGTGGCAGTCATATCCATTCTATAAGCTGATCTAGTCGTCTATTAAAGCA
> TGCTTCACACGTTACAGGGTTATGCCAGAATTAGGGTATCTATAGTCAAGCCGTTTATTC
> CGCCGCCATAAGATTCCTAAGACATCACTTTAAATATACTACCCGCAGCGTAAGTAGTGA
> ACTTATATAAAGATATTCTAAAAGTTTATAACCAATTGATTTAGTGGAGTACTAATTGCC
> AAGAAGATATGTCTGCGCGCGGCGTTTGATTTACTATGACCTTTTCGCAGTGTAGGAAAT
> TCCATCTACTCGACTATATTCCGTTCACAGAATCCAATTCCTTGCTCAACAGTCCTTTTC
> TGAGGAAGAATATTCACAACGCCCGTGGTCGCATGGCTACACTGCACACTGGCGTACGTG
> GATATACACCATGCATAGAGGAATCATGTTCCAACTATTACTGTGGATAATTCGATGCCG
> AGTTCTCTTCATATTTAGGAGCCTGACATGCCGCGAACTTAGTCGAATTTTATATCCGTT
> CCAACCCACTAGTAGGCCAATCCGTAGTAGTTAGGGTTCTCATAATTAACAGGAGACCTA
> TTAACTCTTTCATCTTCTTATCTCTTTCATTCGTGTAGTTTACTCTGTAATGTACGCGTG
> ACCGTAGTTTGATGACTCATTCTAACATAGGATACGAATCTGAGTCGGCTGATCACACCG
> TGTTTTAAACTGGATGTTTGGCATCATTTAAACAATAATATAGAAATCGGAGAACGCAGT
> TTTTCTCTCAATTTGAAACCAGTAAAAATACAAACTTTTGAGATCTCTATAGGATAAGAG
> ATAAGTTGTACTGTTTAAGCAATGTATGAAGTAAGATTTGGTTCACGTTCGCAGGTAACC
> AGAAATATTACGATGGTGGCGAACGTCTCTAGTCAAAACCACATCGCTTAACCATGTGTT
> TGTGAAAGACCGGAGACTTATTCACTTGAGGATGTCTGCATCTTTTGATATCTCTTCCTA
> AGACATTTAATTATTATCTAATACCCTAGGGTGTGATTCTAATTTAAAACTGAAGTAGTG
> GTGGGTTTTGCTTTGGGCCTTTTAGAAGCTTTCTTGATCCTTGATTCGACGAACAACAGA
> TTAAAGTTCCAGGGTTATAGTTGACAGAACTTATGACATCAAAAATGCCTGATTTCGAAG
> AACGAATGCATTGCTAAGATTGAATATGTCCCCATACAATCTGTTACGCTCGCTGGGAAT
> GTATTACCTTTCAGGCTCTTAGAAGTACAATGATACATCCAGATCTAGCAAGCTGCAGTG
> GTCTTCCTGCGTATGTGAAGTGCGCAGCCATAAAATTATTTCGATGAATACGCCTCATAG
> TATTGGTAAACATCAAAAATAATCTTCTCGACCTTCTCTGTGAATTACCAACCTGTACTC
> TCATGGTTCATACTAAGTAGGATCGAATAGCTAAACTCTCTGCACAAGGGTACGTAATTA
> AAAAAATAACCCTGACGCATACTAAGTGCCTTTAAACGTTAGTTTAAAAAGTCATTTCCG
> CTCTGAGTAAGTAAGAGTCGGGATATTACTTAGACTAAACATTACCAACTAAAACGAGAA
> GGATTACCAAGAGTGTTAGTCCATCTGCTCATGACGGGAAAGCACTTAGGTCTGTCGTAA
> TATCTCAATATAATATATATTAGATGATTTTCCAGCTGATAATTATTACGACAACATTCT
> TTCTCAACATACAAAAGTATATTCAATAAAACTCCGGCCATAATTTTCCAATAGATAGTA
> CACTGAGTTATAGACATTTCGGACAAATAACAATCAACATAAGGTGAGCAATTTTATAAA
> AGTGAGCTTTTTGTCCATAGGTTAGATTAGGACTTTTAGTGTTCCATGGCTGACATAATC
> CGGGGATGGCCCAAATAAACAATAACTACTGAGCAGTATTAGGTTCCTAAGATCGGCGAG
> ACAGTCTTAACGGTCGATTGTTCAGATATCTATGTTTTTCTGCGCCAGAAGTAATGGTTG
> GTATAAGTTAGATATTTTTGGATCACTTGCATCGCGACCTGTTGACGAGAGGTTGTGGTA
> TTTAACAAATAGAACCAGTTAATATAAAATTCGCAGTGTAACTTTGAGTCAGAAAATCAT
> TATATTTACTTAGCGTAATGATCCATACAGAGTATTAGATTCCAATCGTGCTCTGGGTTA
> TCGGGTGCCGTCAACTTACCTGCTGATGTCTTTAGGAAAGAAGCTGTTGAGGAGTTAGGA
> TGCTGTGATAGATAGTTAAGCAACGATTGAACGCTATCTGCATTTTGCCCATTACAGAGG
> AGTTCCTATGGAACATGGTTTTAGCTACAAATTTCTCAGACCAAACCTATATAGAATCGT
> TCCGGTCGATCTATCAGGTGATCGTAAAGTACCTCTTCCAAGCTTTGTCTTGTGAAAGTA
> TTAACGTTTCCTGGACAATATTATATCGGCATTAAGGTATCCTTCTGGTTAAAGTGGTTG
> GCTACAGTGAAATATTTAGTTGAAGCTCGTACAAGAGAACGTGTCTTCGCCGATTAAATT
> TACAAAACTAGTATCATAACTTAGAATTTACGAATATATGTATGAGTAATCACGCTAGGG
> TTAGTGTAAGTGACAGTAAAGTGGTACAATATGTAGCTCTATTAATATATCAAATGTCAT
> TTCCAACTGGTCCAGTCAACTCTTGGCAGTAGTGATGGACAAAATTAATTGCTAAGGGGT
> TGCTAGTGTACTTGTTGAGGGTCGACGCTTTAACGTCGCAAACTTGTGGTATCACCGCTA
> TCCTTTTATGTGGTATAGCGGCGCAAGGATTCACGGAGAAACCAAGCCCGTAGTTAATCA
> ATTGACTGTTCTTTTGGAGCCTTTGCCTAATATTGGGGACGTGTCAGAACATAGCTCTTC
> GCTCTAGGAATAGTAGACGGTTAAACGGATTGCGATTGACTATTGACCAAACTGCCAAGA
> GCTACAGCCGCTTACTAACGTTAGCGATTTGCATCTGGATTCAGAATACTGTGTTCTAAG
> ACTTTTCTCAGGAAACCCATTCTAGGGGAGGGTTCGCCCACTTAAATAATACACGGCATA
> ATCTAAATTATCAGTCATTAAGCGTTTTAATCTGATCAAGAGTCCTCAGTCTTCATTGAA
> ATGACTCCCCCGAGTTGTCAACATCGTATAAACAACTCATTCGGGTAACCCGAAGAGACC
> TCTTAGTGTCAGCTGTGTCATTAGCCTATAACATTTAGTATAAACAGGATATGATTTCAT
> TGAATACTCTAAGTTTGCTAGAAGGTAATGGTGCGATAGGAAAGGCACTCTACCTATAAC
> GACTAGATCAAAATGGGTCCTGTCGAGAGGTCTCAAAGGCGTAAACTCCTGACGAGTCAC
> TAAGAGATTCCGCACCGGGTTATAATGCAAGTGGGCGCTTTCAGTTTAAAATGCTGACAA
> AACACGGCCCAAATACGAGGCTGGACTATACGGCGTTTAGGTAAATATTCCCGTGTACGT
> ATGTATGTTTCAAGGCAAAAGTAACAGATAAAGGTACCAAAACCTTATAGATTATCACGG
> GCTCCGCTTAAACACTTGTATACAGTCTTAATCCATAGTAATAGACTTTATAATGTTCTC
> GAGCAATCGATAAAGGAAAGCAGTTGTACAAATACCATTCGTACGATATTCGCAATCGGG
> CATCAAACCAACATTACGTCGTAAATTATACCCGTAGTTCTTGATAACTTGAAAATGACA
> AACACACAAACGAGGATTTTCCCAAACTCGACAAATCGTTATTAAAAACTCAACCTTATT
> TTAAGTTATCAGCAATCCTCGGACAATTGAGAAGGCAGGAAATAGCAATACGGTCTATAC
> GTCACGCGAGCTTGAGAACCTTCGTACTACGCGCGGCGTTATTCAAGACTCCAAGTATTT
> GCCGTGCATGACTTAACAGAAATCCCGAAACCCGTATTCATTGATCACTTAATCACTTGG
> TATAGTGCGTTACGATATCGATAAGCCGCCATGACGTTTTCGGCGCTATGTCCTTAATCG
> GAAGAAGCATCGGATTAATTCTCTGTACATGTTATACAAAAAGATAGCTCCGCGTAAGTT
> TAGATCATGAGGGATAGTCAAAAAGTATTTCATTTCTTTAAAATATGTCGCTACGCCGTG
> TTTTAACACTTTCTATCGTCTTTTTATATTCTCGGATTAAAAAATCACCTAATATTAGAA
> GAATGAGGCATCAAGAAAATAGTGAAAAGAGTCTTTAAGATGGGCAAGACTTAAACCAGT
> ATACGCTTGTGTACTAAGAGATTTTATTTTCACAGTTCTCTGGAGAGGGTTGTTTATAGT
> TATCCGACCATTACCTAGATGTTATGGGGGGGCTGTCATGAAGGCCATAGTTTCTCCCCG
> CGGAGCGCTATGGGGCCGGAAATGCACCGACCACAATTAATACCCTAACAATTTAATGTA
> CGTGTTCGTAACGATTCTGTGCTTTTTGAAAACCTTTGTCAAATAAACTTCAAACATCTA
> GTATAATATTAATGTGGGAGTTGGTGGTAGGTTTTGTAGTAATGAAGCGTTCATTCTAAC
> AGTAATGTGACTTGTCAAGCAGCGGCTTAAAGATACATAAGATTCGTTGATGTTTACTCT
> CAGTCATTAAAATCAGAATCATTTGATACGTCCGGTGAAATACCAACGTAAGTTGTTGTT
> AATCCAAGATAGGCTACAAAAGTAGATATTGTATTGCGGACGAAATTCTTATCTTATTGG
> TAGCACATGTCCAACCTTGTTAGATCCACCTACAGTGGAATAGTTAATGTTACATTAAGG
> CCGTTTCGTCTTTATACGACTAACCTCGAACAGGAACCTTACGAAAAATTAACTGATTAT
> TAGGAAGGAGGCTTTTTGAAGCTTCACCGAGATTGTTGTACAAAAACGAAGATTCATAGT
> CAGATCTATGAACCAATTGACCAGTACAATACTGTGTTGTCCTGCTTACAATCGCACACG
> ATTGGTGTTCTAAGGTCACATGTAACTACATGACTCTACGATGGGTCGTCCACAGTCTAT
> ATTTCGTATAGACGTAACAGCTAATGACGTAATTGGTCCATTCTGGCTAAACAAATTCAC
> TTGAACCAAACACATTCACTAGGCTACACGGACGCCAGAATTATAAAGAACCAAAAGATT
> TACCTTTTTCTGACGATAGCATCTGCTCAAAGTACACGCAGAGGAGCCCCTCTGCCATTA
> GTTTCATAATACGACGGCTTCCACGTTCAGTGTCCAACATTTAAATACCTAGTGGACTAA
> AATTTTTTGGAAACAGCGAAAGCCGTTTAGTGCGGGATTTGGCCACAATCATCACGATTA
> CTAATCTAAAAATTTCTCGATTCTATTGCGCATTCATCGGTACATATGAACCTAAAAGTG
> TCCTTTTTGACTTATTTTCCGTGTTCAACTCGCAGAAAATCAATAACAATACAATTATTT
> AAGCAAAACACTTAGAAAGAGGTGCTATGGACCGAAATTAAGGTCGGACCTAAATCTTAT
> TAAGCTTATTTTGTACATCGCTTCCTAGCAGAACAAATATCAACTGGTGACCGTTTACGC
> TGATTTTAAGAATGTTGATGTTTGAGCTAATATGCCACACCGTAAAAAAGCCTAAATTAA
> CCCTATCTCCCCGGAGCAACAGGATTTCGAATTCGGACACATGGTGGATTTACGAATCAT
> AACACTGTCCAAACTCCCAGCGATGGGGTTGTCTAGATGACCGAATACATCATACTGTTC
> TCACCAGTTTAATGTTTTACGACCCCTCGGAAGTGTTCGTAAATCAGCTTTAACCAATTG
> ACCACTGTTCTAAGTTAACCTAATCATTAGATCACCTCGGGACTGGACAAACCAAATTTA
> GGTCATCTCTACTGTCTCTACAGGTGACTTCTAATAACGAATAAGAAACATTGCTCACCG
> TGAAGGCAATAAGCATGTGTGAGGCTTTCACATAGGCTAACATCTAGTCGTTAGCCCGAA
> ATGCCAGTAGTCGATTGGTTTTATTTACACTCAGTGCTAGGTATGCAACGGATTATCCAC
> TGCGAATGTATTACTAACCATTTGTCAACAATTAATACGACGGAAATTGTCCTTAGTTTA
> GCGGAATTCTCCAGTGTTTGGTAACTTATACATCTCAGAGAAACGTTGTTGCTACCTATT
> TTAGTGCATCCGTAAACATATCTTACGTTCGGAATTTAACCGTCGATTGTCATTATTGTT
> TACGTGCTACTGCGATTGTGCCGTGTCTGGTATCTTAATAAGTCACAAGAATTGCATATG
> ATATCACCTGCTTACATCTATTGGAATCTCCACCTCCAATGGCTGCAGATTTTAAAGTCA
> GCTGAAAATACAATTATTTGATTAACATTTAAACACCTCAGTCCATATGGATCATGTTTT
> GACGAATGTGCCGCTCAAATATAACGTAAAGTACAATACTGGAAAATGGAAAAGCGAAAG
> TTAAAATCGCTCCGCTCTTACCCCAACGCTCCACGTTACTCACTTTGGGACACATAGAAC
> AGGGGTTGTAATCTCTTTTTTAGTATAAGATCTGCAGAGTAATTGATTCTCCGGGTTTTT
> CTGGTAATGGGGTTGTATCGATTTATCGCAAATAAGCAAGGAATGTAACGCGATCCGCAG
> AAACGGTTGATCTCGACTGGAATGGTAGCCACAAGCATTTTTCGACTAGATCGCGTTGTT
> CATCTACGAGATCGCGCAGGTCTGATAATTAACTTTTTAGGGAACGACAGTAAAATATAT
> AAACCCCTTCCATGGCGTCTCACTGTATAACACTGCTCAAAGATAGTTAGTGGACTCAGT
> GCCGCAATTGCGTTAGATATACTTATAGACTTATAAAAGGTTCTTTCGGGTCATAAATTG
> TCAAGCTATAAAATGAGGATTCGGTGCTGTCGATAATATACACTCTAATACCCAGAGTAC
> TTTTCGCCAAGGGATGCACGTACTACAAGGGTCGTAAACGACTATACATAGTTTAGAATG
> TTTCTTAGATGTATGTAATCCTCCGGACACATGGCAATCCCAAGGTGCGTTCGGCTTTCC
> TAGGTTACGCCGTTTTAATTACATGTTGATGCCGTGTAACTACATAGTCTATAAAACCGA
> AATGTACCGTCCCAATAGAAGATACCCAGATTGACCCGTTTCGCTGCCCCCGCGTACTCA
> TAGCTTATTAACACGTTGCGTACATTCATGTGATAAAAGTGGTTTAGCCCACCGTATTGG
> AGCATGAATTAAGAGAGAAAGATAAGTCACGTGCAATGAGTCCTAAGTTCATGGATCAGA
> GAATTAATCCTGTTTTAAATGTTGGATATTTCAGCGGGCATTAAAATTTAGCGTAATCGA
> TTGAGATCGCGAAGGTAATCGAATAGAGCAAGTCGTTTTCAACTTTTGAGTATGTATTCA
> TGCCAGCCTTTAAACCAAGACACTTTGTGTGTAAATCGGTCTAATAAAAGGTGACTGGAA
> TCGACATTCTTTCTTGTTTCGGGCTAGATTGGGTAAGAAAGATACATGACTACAGTCTCC
> TAGGGGGTGGCATATGAAATCAAAAATAATACTGCCCAGTGATAGTTATCCTGATGAGGG
> TTGGATCACTTAGGCGGGTGAGCTATTCGTCCTGCAAACTCCAATTATCAATTTCCTACG
> ACACGCGGGACCTGTCTAACAATCTTGTGACCCACAGCCATTAAACGCAACTGGATAATT
> GTAACAAGTGTCGCCCCCAGGATGATTCGTCGATTAAACACAAAAGATATCAAGTGTCGC
> GAATTAAGATACAGGGGAATCAAACAAGATAGTACCGAATACGTTGTGGCTTTTCGGCAA
> ATAGCTATACCAATCATCGAGTGGGATCGGATGAAACTGATTCCTCTGACAAGAAGAGGG
> ACGGGAGACCGTAAAACGCATTAATCATGACCGTTCCTCCGGGGAACTGGGTACTAGTTG
> AGTTTTTGATCTAAAGATACTGACGATTCATAACTTATCGCCATAAAGGATCGAACCGAT
> AAAGGGCGGGATCGTTATTACATACAATCATGTAGCAAATATGAACCAACAGTACTCGAC
> TCCTCATAAAAGGCAGTAAACGATTCGTACATCTCGTTTCGAGGCTTTTAAATCGAGCTT
> TTGTCGGTACATCCTCATTGCTTTGTTTAGCGGTTGCATAAGGCTGTTCCTAGGTGCGAT
> TTCCCCGAGGAACTGATGATCCTGACTAGAATCTGTGTTGACGTCATGATCTTCATTTAC
> ATGATGAGATAGACCATAATAACACAATAATTAGGAACACATGCTAAATTGAATATTGCA
> ACTGGTAAGAATCATAGATCAAATCTTTCATAATGCCAATCATGGAAAAAAGCACGTGCA
> GTTATGTTGGTGCTGGCGAATGCGGCGGCAGTATTCAATAGTGTTTGCTTTTCTAAGGGT
> GTTAGAAGACTGCTTCGATTAGCATAATTTGACCATAGTAATGGCCTTAGGCTAGAATCA
> CGAACAGGAGATACTTTGCGCATTCGATAATGATTGGCAAATAATCATTGTAGATTAGCG
> ATTTTATCTCAAACTTATAAAGAGATGTTGTCACACGAACGTCCTCTGCCGTGCTAGGTC
> TCAAATCAGTTACTCGTCCCCTTTATAGAAACTTCTAATTGACAAGTGTGGCATATTAAT
> GCGTTGTTTTCCAACCCAACGACTATTGGCAGATGAGAAGGTACTCCTCGGACAATTATA
> GAGCAGTCGTATTCCTTAACTGTTCTTTGATGATGCTGGTATACTTTTAGGTACGGGACA
> TGATATACAAGGGCATCTTTTAAGGAGCTCGTCCAAAGAGTGAGATTGTATATTAATAAA
> TTCCGAACTAAAGGTTGACTAAACGCCACGATGGTGCTCTGAAACGCTTATCTGCCTTTA
> TTTTCCGTCGGAGTAATTTCTCTCGGCTATTAGATTTGAACATATACACAGGCCAGATGA
> TCTGGAAAAATCCCCTGGCGCAGCTTATATTAATGGTCCACAGCGTATCGCAATCATTAG
> GTCTAAATACGTAGTACATTTTTAATCTTAATAAGCATTAACAGACAAAATGGAGGACCC
> ACAATCCAAACAAATTGGGTTAGATTAGATTCAGCCTAAAAGACCCGATGTCAGGAGCCA
> TGAATGTCACGCAAGGGCGTCATGTATCTGATAACACTTCGAATAGAAAAAGACGGATCA
> GATTACAGGCGTGATATGACTCTACGGAAATGTTAGTCCAAATGAAAGCTCCATGACTGG
> CCTCATATGCTTGTATTTATATTATGACGAGAATTATAAACAGAACATTCGTCATCCTTG
> GGCTCAACCAAGTAACTGTTCAGATATTCGAACATAATTTCACTTCGTGGAAGTCGTCAT
> AAAAGTATCCAAAAAAGAACATCATAAGGATGTAATACCTTTGAATTCGTACATCCAACA
> CTTGTAGTTGAGTTCCGAGCTAGCGTATTGCCATGATTCAAATCTGCATTCCCTAACTGC
> ATAAGATTTATAGATATATATTTGGGAACTATTATACATTTGTCTAGTTCCGTTAACTGA
> TTTAGCTTAACTATGAATAACCCGTAGTTCCCAGGAGACTAAAAGGACGGAAGAAATCGA
> CTTGATTTGTGCATTATGTGGGTTCGGCCATACTTCCATTGAACTCAGTGCTTTACGAAA
> TTTCCAATTTCTACTGCGTAAGGCCGGATAAAGACCTCATTATCTGATATTTCTAACCGA
> CTTAAACCCTAGCTAAATAAATAATGGTCTTGGTGATCTCTCCTAATGCTAGTGTCACCA
> AGACTTAACTTGAATGGAACGTTGAAATTACTTTTTATGCGGATCACATAGATAAAAAAA
> ACTGTGCAGGCGCAAACCGTAAAGAAAATTTAGAGTATGTATTACTCCCTCACAGTGTAT
> TGTTCCACTCAGCTATTATATTCTTTGTTGACATATAACAATTTTCAAATGAGAGACCTA
> TTGAATCTGGGAAATTAAAGTAACGTTAGATGGCAGGAGTAAATTTATGAAAACACTAGG
> GCATTACCTAATGGGCACCTAGATGCAAGGCGGTATAACTATTATAATCCACAGAAAAAG
> ATAGAGCACTTTAACCTGGCTTATGCTTGCGGATCAAGAGAGAGTTAGTAAGTAAGTAGT
> CGCTACCCTCTGTGTAACACCAACACACTGTAGACGTATCAATCGCGAAGGACATCTTTA
> TATGATCTAGAATGAGATTGAAGATAATTTTGACCTATAGTAGTTCATCGCACAGTTATC
> CGTAGATAACCAATTTGAAAATGACGCGTGGGATAGACATCGATATCGCAATGACGGAAC
> TTCCTTCCCATCGGCAGTTTATTTCGACTAAATGTGACATGAGCGTGAGTGATTCTTGCT
> TACGATCATTTTTAAGTACTGAGAACGGGTCAGTATAACATGAATGATAAGAAATAGATG
> CAGGCTTTAGATTACCTAGGTTGGTCAATTTACGCAATCACTAGGTCGTGAATGGACGAC
> CTGTTTATAGAGCAAATCTTATTCGATCATATAAATACTTTCAATAATAGGTAATTAAGT
> TTCATAATTAAGTAAGATTGCCATCAAATGTCCAGCTTTGGATAAGCTTCATGATATAGA
> CTGTTTAACTGTAAAGGAAGCGTACGATCGGAACATTTTCTATACTATAGCATATAGATC
> GAAACTTAAAATTATACACAAGGATCCAATAATCTGCTTAGTTCACAGCTAGTCCGTTCA
> TAGTTGTATATGGTCGTTATACCAGCTGTATACGCTGCCATAAGGCCCCATGGGAGATTG
> ACTATAATTTGTTGATTGAACAAATGCACCGGTTGACGGCATTTATACCATAATTTAGTT
> TAGCGAGTCCGAATAAGCTAGATATACTTATTGGACAATATGAATGTCGGGAATTTGATG
> GATCGACAAACTCATCCTATCAAGCCTAAAACGGTTAAACGAGGCATATCTAAATGGGTC
> TCACCCTCGTAAATCTTACAGTGCATTGACAGTCGATTCATGCCCCTAGCGTATGAGTGC
> TTGCAGATTGGAGACTCGCTAGGAGCGGTGGAGGTCATATGCCCTGTGGTCTAGTCGCGA
> CCCTTATCGTAATTGTCCCAGACACTAAACAAATTTGTAGTGTACTTAACAGAATACAAG
> GATCCAGAGGAGACTTATCTTATGATCTAGTCTGATCCGATGTGTATAGAGGTACTGATA
> TTGCGACTGTCTTTAAGAGTTATGCATAGAAATGAGTTGTAGGCTGTAGTCAGGAGTGAA
> TCCAGAACAGTTCAGGTTAAATCTATGCGTTGTGCATTGGTAAAGACAGTGTTAGACGAT
> AATCATCTGCTCCGGGATCTGCCAAGATTACGCTAGGGTTGTCACGTCCCGATGAAGAGA
> GCTCCATACTCATCTTCTTGTATCAGGCTAGCCCAACGCCATGTAATGCAGCGTTCCGAA
> CTCATGGTACTTTATTTTATTCTTTCCCTCGGTCCTACAGATATTTGCTTAATCATGTGA
> GTTAAATTATACCAGCTAATCGTAAGCTATTCAATCTCCCTGGAATATAAATGATTTAAC
> ATCATATTCTACTATATTTTACAAGGCTGATCAAGTTACTCGGTTTTCACACAATTAGGC
> GTGATAGACTCTAGACCTTTTTGAAGACCACATAAGAGTCCTTTGACATAAAGTGAAATT
> TAATACCCGCTGAGTATGTAGTGAAAGTATATTAAGTTATTATTAATCTGGATAACCATT
> TCATGGTCTGGAGTACTATTGCAAAACTTGATATGGATGCGCCCGGACTTTGATGTACGT
> TGAACTGGTACCAGTGGACGAAATGACAGCTAATCGACGATATGCAGTGCAATGATGACT
> TTTCCTGGCTAAACAGGACTTTTATCACCTAGATTTTTAAAATACCCCCGCCGAGCATCG
> CTACAATCCACTCTCGCCTACCTGCATATAATCCATCCAGACAGGTATCAGCTGAAAACT
> TTTACTGTCGATAATGCGTTGCACTGGTCGAGTAATAGTTTGCTCCCTCACATCCCGAGA
> AAGTAGTACAAGTTTTTATACGTTCATACCAACTAGTACCACTATCCCTAGGAGTTACCG
> TGCTAATAATTTTCAGGAGAAATAGGATCTCGTTCAGCGTCGTATCTATTTATGTCGGGT
> TCTTTACGATCGAATGGACGACTCACACGAGTGGCATCAAGAATTATAAATTAGCAGAAC
> AAGAGGTGGAGGATGAGAAAACACTGTTTTAATCTCCATGTTTCGCTTAATTTATTATAG
> TATATACAAATAGCACATAGCTGTTTTTCTATCAATGTGAAAACAGTTATATTTATAACT
> TTTCAGATCTATTTACCAGTACAGAGATGTTGGTCTGTTGTACAAAGGTAGGATGGTTGA
> TGTCGTTCAAGGTAGCAGCTTTCCACAATTAGTTACATGGTCGCGAAACTAGCTTGGCAT
> AACAACATCGATTAAACATGTGTTTGTGTAAGACAGGTGACTGATGCTATGGACGATGGC
> GGATTAGTGTGTGAGATATTACTTAGAATTTTTATGATGTTATATTAAACGAGGCGGGCT
> GGCGAATTTAATAATCTAGTAGTCCTGCGTTTGCATGTCGGAATGTTAGTTGCTTTAGTG
> AGACTTGATTCCACGTACAACAGAGTTAAGTTACAGCGTTATTGTTGACACTTATTTTGT
> CTTCTAAAAGGCATCTTGTAGAAGAAAGTATGCATTGCGAAGATTGAAGATGGCCAAATT
> AATGATGGTAACATCCCTGGGTATGTAGTACCTTTAAGGCTCTTACTAGTTATAGGATAC
> ATCCAGTTCTTCCAAGCTGCACTGCTCGTAATGCCTATCGGTACTGCCCACCCATAATTT
> TTTGTACATCAATACCAATAATTCTATGCCTTAACATCTATAATAATATGATACACAGTA
> TCTGTGAATTTACAAACTCGAATCGCATCCTGCATTCTTACGACGTTACTATAGCTATTC
> TCGATCAAATAGCGTAAGTAATTAAATATATAAACATGACCCATACGAAGGGCCTTGATT
> CCTTAGTGTAATATGTCAGTTCCCCGCTGAGTATCGAACACTACCCTGAGTACGGACTAT
> AAACAGTAACAACTTTTAACACAAGCATGAACTACTGGCGTAGGCCAGATCCTATGCTCG
> GGAAAGCACTTTCCTCTGTCCTAAGATCTAAATTTTATATTTATGACTTGATTTTACTGA
> GGATTATTTGGACCAATACTTTCTTTCGATACAGACAAATCTAGATGAAATAAAAATACC
> CACATTATTTTCAAAGAGTTAGTACACGGAGTTAGAGAAAGTTCCGTCTAATTACATTAA
> ACTTATCCTGAGATAGGTTATTAAAGTGAGCGTGTTGTCAATTCCGTTGATTTCCAATGT
> TAGTCTTCCATCGCGCACTGAATACCCCCAGCGACCATATAATCTTTAAATACTGAGCTC
> GATGACCTGAATATGATAGGCCACACTCTATGTACCGTACATTGGTCACATATATAGGTT
> GGTAGGCCAATCATGTAAGGGTTCCGAGAACTTACTTATGGTGGCATAAATGGAAGCGCG
> TCATCTTGACCAGTGGTTCTCCTTGTTAACAAATAGAAACAGGGTAGATTAAATTCCCAG
> TCTATAGGGCACTCAGAAAATCATGAGATGTAATGACCGTAATCATCATGTAAGTGGATG
> AGAGTCAAATCCGGATATCCGGTTGAGGCTCCAGGCTACTTAAAGCCTCTTCTCGTTAGG
> TAACAAGCTGTTCAGGAGTGAGGTTGCTCTCATACTTAGTTAAGAAAAGAGTGTAAGATT
> TCTGCATTTGGCAATTTACTGAGGACGGCATATGGTACTTGCGTTTTGATACAAAGTTCT
> CTCACCTAACCTAGATTGATGCGTTCCCCTCGTTCTATATCCTCAGCCTAAAGGACCGAT
> TCCAAGAGTGGTATTCTCATAGGATTAACGGTTCCGGCAAAAGTTTTTATCCGCATTAAG
> GTTTCCTTCTGCTTATAGGGGTGCGCTACAGGGATTTTGTGACTTGAACCGACTAAAACA
> CTAACGGTAGTAGCAGAGGTTATGTAAAAAAATAGGTTCTTAAATTACTTTTTACCATGA
> GAGGTATCAGTAATCAAGCTACCCTTAGTGTAAGTGACAGTAATGGCCGACAATATCTAC
> CTCTTTGAAGATATAAAATGTAAGTTACAAATGGTACAGTATAATAGTGGCAGTACTCAT
> CCTCAAAAGTTTTGGATTAGGGCTGCCTAGTGTACGTCGTGACGGTAGACGATTGAAAGT
> CGATAAATTCTGGGATATCCCATATACTTTTTGGTGGTATAGACCACCTAGCATTAAACC
> TCATACCATCAAACTAGTTAAGCTTTTGACTCTTCTTTGGCAGAATTTGACTAATAGGCG
> CGACCTCTCAGTACATACCTCTTCCATATACCAATTCGAGTAGCTTTTTAGGATTCCCTG
> TCAATAGTCACAATACTGCCTTGTCATTAAGCCGCTTTCTAACGGTACAGTTGTGCATCT
> CGTTGAACAATACGCTGTGCTAAGTATTTTCGAACCAAAAAAATTCGACGCCAGGGTTAG
> AACAATTAAATAATTCAAGCCATTAGCGAATTGAGCACTATGGTACAGTTTTAAGATCTT
> CTACAGTCCTCACTCTTCATTGTTATCTCTCAACCCAGTTGTCAAAATCGGTTAAACATA
> TAAGTCGGCTAACCCGAACAGACCTCTTAGTCTAACATGTGTCAGTACACTATAACATGT
> TCTTGTTAATCCAGTGCAGTGCATTGATTAATCTAAGTTTCAGTGAACGTAAGCGGGCCA
> GACGAAACGCTATATACCTTTTTAGACTAGATCAAAATGGGTCCGGTCCACAGCGATCTT
> ACCCGGAAAATAAGGAAGACGAACTAAGTCATTAAGAACCCGGTGATATTCCAAGTGGGA
> GAGGGATGGTTATAATCCGGACATAAAAAGGCACATTGAACACCCTGCACTATACGCAGG
> TGTCGTAATTAGTACCGGCGTCCTAGCTAGGTTGAAACCCAAAAGTAACAGATAAACCGT
> CATTTACATGAGACTTTATCTACGCAGCCGAGTAATAACTTGGTTACAGTAGTATTACAT
> AGGAATTGACGTTAGAATGTTAGACAGAAAGCCTTAAACGAAAGCACTTCTTCTTAGTAC
> ATGAGTTAGATATTACAATTCGGCCTTCTTTCCAACATGTAGTCGTTAATTTGACCCCTA
> CGTCTTGTTTAATTGAAAATCACAATCACTAAATAGAGGTTTGTCACATACTAGAAATAT
> CCTGATTATTATCTCAACATTATTTTAAGTGATCTCCAATACTAGGTAAATTGTGATGCC
> AGGAAATACCAATTCCGTCGAGACCTCTACAGAGCTTGACTACATTCCTACTAAGACCGC
> CGTTATGAAAGACTCCTAGGATTTCCCGTGAATGACTGAACAGAAATCAAGTAAACCCGT
> GTATTTCATCTATTAATATCTTCGTTTAGTGACGGACGTTTTAGTTATCCACCATGGAAG
> TTTGAGCCCCTAGGGCCTGATGCGGAACAACAATACGTGTAATGCGATCTACTGGTTATA
> AAAAAAGAGAGATCCGAGTAAGTGTAGATCATGAGCCATACTAATATTGTATGTCTTTTA
> TTTATTATATCTAGCTTCCCACGGTGGTAACTCTTTCTATAGGAGTGTGATAGTATCCGT
> GGAATAAATCAACTAATTTTAGATGAATGAGGCTTCATCATAAGACTGTAATCAGTCTGT
> TACATCCCCAAGACGGAATACAGTAGTCCCTTCGGTACGAAGTGATGTGATTGTAACACT
> TCTAGCGAGTGCGTGGGGTTTTCTTTTCCGAACTGTACCTACTGGTTATGGGGGCGCTCG
> CATGAACGAAATTGTTGATCCCCGCCCAGCGCTATCGCCCCGCAAATCCTCCGACCACAT
> GGAATAACATAACAAGGTTTTCGAAGGGGGCCTTAACATTAGCGCCTGGTTCAAATACTG
> TCTATATTAAACTGAATAAAGCTACTATTAGAGTAATGTGCGAGGTGCGCGTTGGTGTTC
> TAGTTATGATGCCTTCATTCTAACAGTAATCTGTATTCTCAAGAAGCGGCTTAAACATAA
> ATAACTTTCGTTCATCGTTACTCTCACGCATTAAATTAAGATTAATGTGATACGTACCGG
> GAAATAAAAACGTTAGTTCTGGGTAATAAAAGATTGCCGACTATTGTAGTTATGGGATTG
> CGGACGAATGGCTTATAGGTGGGCTAGAACAGCTCAAAACGTGTGAGTTCCTCCTAAAGT
> GCATGTCTTAATCTTAAAGTATGCAAGGGTAGTCTTTAGACCACTATCATAGAAAAGCTT
> ACGTAACAAAATTTATATGATTAGTAGGAACGTGCATGGTTGATCATTATAACACATTCT
> GGTAAAAAAAACAACATTCAGAGTAACATATAGCAAAATAGTCAACAGTTAAATACTCGC
> TTCGCATGCTTACATTCGCAAACGATTGCTGTGCTATCCGAACATCTTTCTAAATCACTC
> TACGAGCGGTCGGCAAAAGTCTATAGGTCGTATACAAGTATCTGATATTGTAGTATTGGC
> TACATTATGGCTAAACATATTCAAGTGTACCATAAAAATTAAATAGCCTACACGGACGAC
> AGAATTAGAAACAACCAATAGATTTACATTTTTAGCTCCTGAGCAGATGAGAAAACTACA
> CCCAGACGACACCCTCTCCAATGACTTTAATAATAAGTACGCGGAAAACGTAAGTCTCAA
> ACATTTAAATACATTCTCGTCGATTATGTGTTGGAAAAAGCGTAAGACGGGTACTCAGCG
> ATTGGGCCACAATCTTAACCATTACTATTATAAATATTGAGCCAGGATTTTCCGCTTTCT
> TAGGGAAATAGCATCCTAAATGTGTCCTTTTTCAAGGTTTTGCCCGGTTCTACGCCATCA
> AATGAATTTACAATACTATTTTTTATCAAAATCTCGTACAAAGTCGGGATAGGGACCCAT
> ATTAAGCGCGCTCCTAAATCTGATTAACATTAGTTTGTACATCGCGTAATTGAACATATA
> ATTTAATATGGTGAAAGTTTAACCTCAGTTTTACTATCTTCATGTTGCAGCTATTATCAC
> TCAACGGAAAAAACCATAAATTTAACATTTCGCAAAGGACAAACTCGATGTCCTATGACG
> TAAATGCCTGCATTTACGTTTAATAACTCGGTCAATACTCACACACTTGCCCTTCGCGAC
> ATGACCGTATAATTCATTCTCTGCTAACCAGGTGATGGTTGTACGTACCCTCCCAAGTGT
> TAGTAAATCACCTGTAAACTTGGCAAAACTCTGCGAACTTAACCGAATCTTTTGATATAC
> GAGCGACTGGACATAACAAATTTTCGTATTATCTAAGGGCTATTCAGGGGACTTCTTTTA
> AACAATAACAATAATTCATCACCGTGATCGATTTTACAAGGTCGCACGCTGTAACTGACC
> CGAACAGCTTCTACGTAGCCACTAAGCCCACTACGAGTTTCGGTGTAGGTACACTCTCTC
> CTACGTATCCATCGGATTAGAATAGCCCATTGGAGTAATAACCATTTGGCAACAAGTAAT
> ACGACCGTAATTCTACTTACTTTTGCGCAATTAGCAACGCTTGGGTATCGGATACATATC
> TGTCAAAAGTTGTTGAGACCTATTTTTCTCAATCAGTAATCATTTCGTTACGGCGCTTGT
> TTACAGTAGATGCTAATTATTGGTGAAGTCCTACTCCCATTGTGCAGTGGAGCGTTTATT
> TATAACTAAAAAGAATGGAATAGGATATCAAATGATTACATATATGGGAATCTCCACCTC
> CATGCGATGCTCAGTTTAATGTATCAGGTAAATACAAGGTTTTGATTAAAATTGAAAAAA
> AGAACGAATGAGCCATCATGTTTGGACGAATGTCCCGATCAAATAGTACCGAAACTAAAA
> GACTGGTAAATCCAAAACCCAAACTGAAAAGACATCAGCGCTGACCCCTACGATACAACT
> TAATCACTTTGGCAAACATAGAAATCGCGTTGTTTTATCTTTGTTACGATTTCATCGGAT
> GTGTATTTGATTCTCCCGGTTTTGCTGCTAATGCGGGGCTATACATTTTTAGCATAGAAG
> ATACGTAGCTAACGCCAGCAGAAGAAACCGTTCTTAGCGACGCGATTCGTAGCCACTAGA
> TTTGTTCGACGTGATACCGTTGTTCAGATTAGAGATAGAGCACGGATCATATTTAAAGTT
> TTACGCAACGAAAGTTAAATATATATAAAAATGCATGGGACTCTCAAGGTATAAAACTGA
> TAAAAGTGTGTTAGTGGAAGAAGTGACCCAATGCCCTTTCTTAGACTTATTCTAGTATAA
> ATCCTTCTTGCGGGTCATATATTCGCTTGAGATATAATCAGGATTCGCTGCTGTCCAGAA
> TATTCAATCTATTTCCCAGAGGTCTTTTAGCAAAGGCATGCACGTAATTCAAGGGGCCGA
> AAACACTATAATTACGGTTGATTCTTTCTTACATGTATGGATTCCTAAGGAAACATCCCT
> AGCACAACGTGCGGTCCCCTTTCCTAGGTTTCGCCCTGTGAATGTCTTGTTGTTGCAGTC
> TTTCTACAGTCTCTAGAATACCCAAATCTAAAGTCCAAAGTCATGATACCCACAGTGAAA
> CGTTGCGATGAAACCGCGGACTCATAGATTTGGAACACCTTCCGTTATTTCTTGGCATAA
> TTGTGGTTGTCCCCAAACGATTGGTGCTTGAAGGAAGACACAAAGATAAGGATAGTGCAA
> GCAGTCCTATCTTCATGGAGAAGTGTATTAATCCTCTGTGAATTCTTGGTTATTGCTCCG
> GGCATGATTTTTGACCGGAATCGATTCTCATCCCCAACGTAATCCATTTGTGAATGTAGG
> TTTCAACGTTTGAGGTGGTTTTCTTCCCACAATTGTAAACAAGAATCTGTGTCTGTAATT
> CCGGCTAATTTAACCTCAATCGAATCCACATTCTTTCTTGGTGCGGGCGAGTTTGGGTAA
> GAAAGAGACATCTATAATGTATCCTAGGGGCTGCAATATGTATTCAAAATTAATACTGCA
> CAGTCATACTTAGCCGGTTCAGGGTTGGAGAACTGAGGAGGGTGAGCTATTACGCCTGCT
> TAATCCTATTATCATTTTCCTTACTCACGCCGGAAATCTCTTACTATCGTGGCACCCTCT
> CAAATTATACCCAACGGCTTAATTGTTAAAAGTCGCGCCCCAAGCATCATTCGTAGATTA
> TACAAAATAGATAGCAAGTCTACCCTATGAACATACTGGGCATGCATTAAAGATAGTAAA
> GAAGAAGGTCTGCAGGTTAGCATAATTGATTTTCCTAGAAGAGTGGGGGAGAGGAGCAAT
> ATGTGTACTCGGACAACAAGACGCAAGCCACTCCGTAAAACGAATTAATCTGCAACGTTA
> CGCAGGCGAAAGGCGGACTACTTCAGGTTTTCTGATAAAGTTTATGAACATTATTAACTT
> TTACAAAGAATCCTGCCAAACCATTAAGGCCGGGTTACTGTTTACATTCTATAAGGTAGA
> TAATATCAAACTACACTAATCGACTACTAATTAAAGGCAGTAAAACTTGCCTACATATCG
> TGGACAGGAGTTTTTTTCCACATTGGGTCGGTACTGACTCTTTCCTTTCGTTTCACGGTC
> AAGATGGATGTGCATAGGTGCGTTTGCCCCGTCGAACTGATGATCCTGTCGAGAATATCG
> GTTCTAGGCAGGATCTTCAGTGACATCTGGACATACTAAATAAGAACTATATAATGAGCA
> TCAATTGAGATATTGATGATGGCAACTGGGATCTAGAATAGAGAAAAGCTTTAAGAATCC
> CTATCATCGTAAAAAGAAACGGCACTTATGTTGCTCCTGGACAAGCACGCCCAACTTGTC
> AATTCTCGTGGCTTTTCTAAGGGTGTTAGAAGAAGGATTCCATTACCATAATTTGACAAT
> ACTATTGCACGGTCCAGAGAATCTCGAACTGGACTTACTTGGCGAATGACATAATGATGG
> CATAATAAGATTTGTTGATTACAGAGGTGTTATAAAAATTAGATAGAGTTGGGGTCTATA
> CAACGGCAGATCCCGTCCTTCCGATCATTTAAGGTTCGCGGACCATTTATAGTTAATTCT
> AATTGAAAAGTCTGGATTTTTTATGCGTGCTGTTAATAAACATCGAATTGGGCAACAGCT
> CATGGTACTCCGCCGACAATTATAGTGCAGTACTATTAATTAACTCTTCTTTGATCATGC
> TCCTATACGTTTTGCTAACCGACATGTTTTACATGGCAAGCTTGGATCCACATACTACAA
> TCTCGGTCAGTCTATATTAAGTAAGTCAGAACTAATGGTGGACTATACGCCACGATCCTG
> AGATGTAACCCTTTGCGGCCTTTATTTTACGTACCTGTTTTTTATCTCGGAGATTAGAGT
> TCATCTGATACACAGGCAACTTGTTCTGGATAAATACCAGGCACCAGCGTATATTTATCC
> TCCTCAGCCGATCCCTATCATTTCGGCGTAAGAAGTAGGTCATTTTGAATCTTAATAAGC
> AGGTACAGACTAAATCGACCACCAAAAATCCTATCAATTTCGCTTAGAGGAGATTCAGCC
> TATAACAAAACTGCTCAGCAGACATGAAGGGCAAGCATGGCCGTAATGTATCTGAGATCA
> CTTCGAATTGAATAAGAACCAGAACAGTTCACGCGTGATAGGTATCGTCGGATTTCTGTC
> GACTAATGTAAGCGCCATGACTGGCATCAGTGCATTCGTGGGATAGTAGCTAGAGATTGA
> TAAACAGATCATTACTCATACGGGGCCGCAAACATGTAACTGGGCACTTATGCCATCATT
> TGTGCACTTACTCGAAGTCCGCATAAAACTTTAAAATATAGAACTTAAGATGGAGGTATT
> ACATTTCAATTCCTAAATCAAAAACTTCTACTTGTCTTACCTCCTAGCGTATTGACATCA
> GTCTAATCTCAATGACATTTCTGAATTAGAGGTATACTTTTTTAGTTGGGATAGATTATA
> CATTTCGAGTGTTCAGGGAACTCTTTTAGCTTAAATATCAATAACCCCTAGTTAAAACCA
> GACTATTACGTCCGATGAATTACTATTCTTTGGGGCTTTTTCTGGGTTCGCCCATACTTC
> CTTTGATATCTCTGATGTAAGATATTTCCAAGGTCTTATGAGGAAGGCCGGATATAGACC
> TAATGATCTCATATGTAGTACCCACTGTAACACTTCATATATAATGATTGCTCTTCCTGT
> TCTCTACGAATGCTAGTCTATCATAGACTTATCGTGAAGCGATAGTTCATATGAAGTGTT
> TTGCCGATAAAATTCTGTAAAATAAATGTCAAGCCGCAATCCGGTAACTAAATGTACTCT
> TTGTATTTATAAATCACTGTGTTTTGTTCATCGCACAGATGATTTTCTTGGTGCAAATAT
> AAATATTTTCATAGGACACAACGATTGAATATCGGTTTGTAAACTTAAGTTACAGGGCAG
> CAGTTATTTTATCATAACTCTAGGGCAGGACATTTTGGCATCATTGTTCAAAGGCGGGAG
> AAATATGATATTCCAAACAAATACATACAGCTATTGATACTCGATTATGCTTGCCGTTCA
> ACACTGTGTGTGTAAGGATGTAGGCGCTAACCTCTGTCTAACACCTACACTATCTAGAAC
> TTTCATTAGCGTAGGAAAGCGTGATTGGATCTACAATGAGAGTCATCATTATTGTGTACG
> ATACGACTTCAGACAACACTGAGCAGGACAGAAAAATTGTCAAAATGAAGCCTGGCATAC
> ACATCCATATCCCTTTCAAGCTACTTCAGTACCAGCGCCAGTTGATTGCCACGAAAGGTG
> ACAGGAGCGTCAGTCATTCTTGCTTACCATCATTTGTATGTACGGAGTAAGGGTCAGTAT
> TACATCAATCAGAAGAAATAGATGATCGCTTTAGATGAAAGAGGGTCGTAAATTGTCGCA
> TTAACGAGGTCGTGATTCGACGAAATGTGGATAGACAAAAGCGGTTTAGATAATATATTT
> ACTTTAAATAATACGTATTTAAGTTTAAGAATGTACTAAGATTCAAATCAAATCGCCACA
> TTTGCATAACCTTAATGATAGTGTATCTTTTACTGGAAAGCATCCCTACGAGCGGTTAAT
> TTTATATTATTTAGAATAGAGAGCGATACGTTAAATTATAAACAACCTGACAATTAGAGC
> ATGTCTGAACACCGTGTACCTGAATACTTCTAGATCGTCCTTATAACACCTGGATACCCT
> CACTTAACGAACCATGGGTGTTTGACTATTTTTTGTGGATTCATCATATCAACCCCTTGT
> CCCATGGTAGACCATAATGTTGTTGAGACTCGCCGAATATCATACATTGTCTTATTGCTA
> ATTTTCAATGTCCCGAATGGGAGCGTTACACTTTATAATAATAGAAACCATTAATCGGTT
> TAAACAGCAATATCTAAATGGCTCTCAAACTAGGAATGCTTAAAGGGATTGCTCAGTAGA
> TGCAGGACCCGACCCTATGTGTGCTGCCACTTTGGTCACGAGATAGCAGAGCTCCAGGTA
> TGATGCCCTGTGGTAGAGTCGCGAACCGTATCCTAATTGTAAAAGTCAATAAACTAAGTT
> CTACTCTTAGTTAAAGATTAAAACCTTCCAGACGAGAATTATCTTAGGATCGAGTATGAG
> ACCTTGTCGTTACACGTACTCATAGTGCCACGCTATGTTAGAGTTTTGCATAGAATTGAG
> GTGGTGCCTCGTGTCTCCTGTCTTTCATGAACAGGTCAGCTTAAAGATTTGCGTTGTGCA
> TTCCTATACACACGCTGACAACAGAATATTAGGATCACGGATATGCCAACATTAAGCTAC
> GGTGGTAAACGCCCGATCAAGAGACCTAAAGAATCATATGCTTGTATAACCCTACCCCAA
> AGCATTGTAATGCAGACGTCCGTAATAATCCTAAGTGATTTGATTAGTGCACTCGCGCCT
> TCTCATTGTGGCGGAATAATCTGACTTAATTTTTAAAAGCTAAGCGGTAGATATGAATTC
> TCCATCGAATATAATTGAGTTATCAGCAGATTCGACGATATTTTACAAGCCGGATAAACG
> TTCTCCGTGTTCAATCTATTACCCGTGATAGTCTATTCAACGTTTGGAAGAACAATTAAC
> AGGAATTTCTATGATAGTGATAGTTTATTAAAGCTGACGTTCTTCGCTTAGGTTTGTTTG
> TTATTATTAATCTGGATAAACTTTTCAGGGTCTCCAGGTATTTGGCAAATCTTCATATGG
> ATGACCCCCCACTTGCAGGTTAGTTGAAATGGTACAACTCGTCCAAAGGAAAGATTATAC
> AAGATAGGAACTGCAATCTTGAATTTTCATGCCTATTCACGAATTGTAGCACCTAGTTGT
> TGAAAATACACACGCCGACAATCGATAAAATCAAATAGCCCCTAACGGCTGTTAATACAT
> CATGACACCTAGATGCTGAAAAAGTGTAATGTCCATATGGACTTGAACTCGTAGAGTAAG
> TGTGTCCTCACTCTCAGCAACACATAGTACTACTAGGTGTTATAAGTGAATACAATCGTG
> GACCACTTTACCTACGTCTTTCCCGGAGATGTAGGTTAACCAGTAATAGGATATAGGTAA
> GAGTAGGAGAGAGGGATGTACGCGTCGTTAAGAGCGAATGGAAGACTCAAACGAGTGGCA
> TCAAGATTGAGAAATTAGCAGAACTAGAGCTCGAGCAGCAGAAATAACTCTGTTATTCTC
> CATCGTTCGATGAATGTATTATTGTAGTTACAAAGACCTCATACCTCTTTTTATATAATG
> GTCTTAACACTTTTATGTATAAATTGTCTCTTATAGTTACCAGTACTGAGTTCTTCGTAT
> CTTGTACAAAGCTTGCTTCGTTCATGTCGGTAAAGGGAGCTCCTTTAAACAATGTGGTAC
> AGCGTCCACATACTAGATTCGAATATCATATTACAGTAAAATTGGCGTTGTCTATCAAAC
> GTGTATGATGCTAGGCTCCATCGAGGATGAGGGTGTGTGATATTAATTAGTATTTTTATG
> TTGTGATATTAAAAGACCCGCGCTGGAGAAGGTAATTATCTACTACTCCTCCCGGGGCAG
> GTCCCAATGTGTGTTCATTGAGTCAGACGTCTGTACACCTAAAAATCTGTTATCGTACAC
> CGTTATTCGGGAAACTTAGTTTCTATTATAAAAGCCATCTGGTACAAGTTACTTTGCATG
> CAGATCTGTCAAGATCGCAAAATTAATGAGCGGTACATACCTGCCTTTCTAGGTACTGGA
> TGGAGAGTTCTTGGTATAGCATAATGACTCTTCTTCCAACCTCAACTCCGAGGAAGCACG
> ATCGCTACTGACATCAAATTATTTTTGGGACATCTAGACCAATAATTCGTGGCCGTAAAA
> TCTATAATTTGATGATACTAAGGAGATCTGAATGTACATACTCGAAGCGCTTCCTGATTT
> ATTTCGACGTGACTTTTCATATTATAGATCAAATAGCCTTACGTAGGAAATATAGATACA
> GCAACAATACGAACGGAATTGTTTACGTTCGGTATTATGTATGTTCACCGCGCACTTTCG
> TTCACTACCCTGTGTTCGGTCTAGATTCTGGAAAAACTTTTAACTCTACCAGGAACTACT
> CGCGGACGCATGATCCGATGCTAGGCATAGCTCTTTCCTCGCTACTATGTTAGAAAGTTT
> ATATTTATGTCTTCAGTTGAATCAGCTTTATGTGGAACTATAATTTAGTTAGATACAGAC
> AAATCTAGATGAAAGAAAAATAACCAATTTAGTTTCAAAGACTGTCTAAACGCACGTAGA
> GTAAGTGACGTATATTTACTTTATAATGATCCGGAGATAGGGTATTAAACTCACAGGGTT
> CGAATGTCCGTTCATGTCCAATGTTACTCTTCATGCCCGCAATGTATAACCCCTGCCAAA
> ATTGTATATTTTTATACTCTCATCGATGACCTGAATTTCATACGACACTATCTAGGTTAC
> CTACTTTGGGAACATATAGTGCGGGGTAGCCCAATCTTCTAAGCGTGCCGAGTACGTACT
> TAGGGGGCCATATAGGCAAGCCACTAAGCTGCTACTCTCCTTCTCCTTGGGAAAATAGAC
> AAAAACGGTTGTTTATATTACAAGGCGATAGGGCACGAACTATTTAATGAGATGGAATGA
> CACGTTTCATAATGTAACTCGAGGTCTGGAATTTCCGCATAGCCCGTTGAGCCTCAAGGA
> TACTGTAAGCAGCTTCGAGGGACCTTACTACATCGTCTGCTCTGACCTTCAGCTCATACT
> TTGTTAACATTACAGTGTTACATTGAGCCAGTTGCAAATTTAATGAGGACGGAAGATCCT
> ACTTCCGTTGTGAGAATAAGTGATATCTACTATAAGAGAGTGATGCCGTCACCTCCTTAT
> TGATCCGCTGCCGAAACGAAAGAGTAATACAGTGCTAGTCTCATTCGATTAAACGTTAAG
> CCAATAGTTTTGATCCCATGTTAGCTTGCAGGCGCCGGTTACGCCGGCCATTCTCGGTTT
> TTGTGTCGGCTACAGACTAAAACACTAACGCTAGTAGAACAGGTTTGGTAAATAAAGAGG
> TTATGAAAGTTCTTGGTACCATGAGAGCTATCAGTATTCAAGATACCCTTACGCGAACGC
> AATCTATTCGCCGACTTTTGCGTCATCTTTGTTGAGTTATTAGCGAAGGGACTTAGGCTA
> AACTATTATAGTGCCACTTCTCAGCCTAAATTGTTTTGGATTTGCCCTGCCGACTCTACG
> GCGTGACCGTAGTACAGTGAAACTACATTAATGCTCGGATATAACAGAGAATGGGTGGGG
> CTTGACACCACATACCAGTAAACCTCTTTCCTTCAAACGTCTGAAGATTGTGAATCTTCG
> GTGGCTGAATTTGAATTATAGGCCCGTACTCTATCTACATACAGATTACAGATACCAAGT
> CGAGTAGCGGTTTACGATGCCCTGTCAATAGTCAAAATACGCAATTCTCATTAAGAACAT
> TTAGAACCGTTCACTTGGCCAGCGCCTTGATCAATTCGCTCTGCGTTCTAGGTTAGAACC
> TTTAAATTTCGTCCCCACCCGGACAAAAAGGAATGAAGTATAGCCAGTAGAGAATTGTGC
> TCTATGGTTCAGTGGTATGATCTGATACACTCCTAACTATGAATGCTTTTCTAGAAAACC
> ACTGCTCATAATCCGTTTATAATATATGTACCCTATCACGAACAGAAATATGACGCTAAC
> ATCTCTATGGTCAATTTAAATGGGTCTTGTTTATCCAGTGCAGGGAATGGATTAATAGAT
> CGTTCAGTCAACGGATGCCGCCCTGTCCAATCCATAGAGAACTTGTTAGTATTGTGATTA
> AGCCCTAAGCTACTCACCGATATTACCAGGTATATAAGCAACACGAAAGTAGTCTTGAAG
> AAAACCCGGTTATGCCAACGCCCACAGGGATCGGGATAATCAGCAAATAAAAACCAACAT
> TGTACTCCAGCCAATTGTACCAGGTGTCCTTATTTGTAAACGCGTACGTGCGAGCTGGAA
> ACCAAAAACGAAAACATATTCCGTAATTTAAATGAGTCTGTAGATACGCAGAAGAGTATT
> AAAGTCGTTAATCGAGTATGAATTTCGAATTCACGTGAGTTGCTTAGACACAAAGCCTTA
> ATCCTTAGAACGGCTTATTTGTAATTGAGTTACAGATTACAATTCCCCATTCTTTCAATC
> AGGTACTCCTTAATTTGAACACTTCGGCTTCTTTAAGTCAAAAGCACTTTCTATAAATAC
> AGGTTGGTAAAATAATACAAATTTCCTGAGGATTTTAGAAACATGATGGTTAGTGTTATC
> ATAGAATACCTAAATGCTCATCCATCCTAAGTCATTTTACCTAGTGACCGCTACACACCT
> TGTCTAAATTACTTCGTACACACCCCGGATGAAACAATACTACGATTGCAACTCAAGGAC
> TGTAAACATATCAAGTAAAACCGTGTATGGCATCTATTATGATATTCCTTGTGTGACGGT
> AGTTTTACTGTTCAACAATGCTACTTGGACCACCTTGCGAAGGTTGACCAACAACAATAC
> CTGTAATGAGATCGACTGCGGATTATTTATGTGACAGACGACTAACTGTACTTATGCACC
> CAGACGAATTTTCTTTGTATTTTATTTATTATAGCGACATTACAACGCTGGGAACTATTT
> AGTTACGAGTGTGATTGTATACGTGGAATATAGAAAATAAGTTTTCTTCTATCAGCCTGA
> ATCATAAGACGCTAATCACGATGTTTCAGCCCATTCAAGGAATAATCGAGTACCTTCGCG
> TAGTAGTGAGGGGTTGGTAACACTTAGAGCGACTCCCTGCGGTTTTCGGTTAACTACTGT
> AAAGTCTGCTTTGCGCCCCCCGCGAAGCAACGAAAGTCTTGATAAAACCCCTCACATTGC
> CCCAACCATTGCATACCTAAACTTGGAATTACATAAATAGGTTTGCGAAGGCGGCCGTTA
> CTGTAGCGCATGGTGCAATTACGGGCTATATTAAACGGAATAAAGAGACTATTAGAGTTA
> TCTCCGACGTGCGCGTTCCTGTTCTTCTTATCTTGCCTTAATTATTACACTATGCGCTAG
> TCGAAACAAGAGGCGGATACTTTAAGTACTTTAGTTCATCGTTAAGAGAACGAATGAAAT
> GATCTTTATTGTCTTAACGAACCGGAAAGAAAAAACTTTCTTCTGGGTAATAAAACAGTC
> CAGAATATTGTTCTTATGCGATTGACCTACTATGGATGTGAGGTGGGCGTCAACAGCTAA
> AAAAGTGTGTCTGCATAAGAAACGCCATGTCTGATTCTTAAAGTATGCAACGGTACTAGT
> TTGAACACTATAATAGTAATGCTTAAGTAACAATATTTTTATCATGAGGAGCTACCTCCA
> TGGGTCATCAGTATAACACTTTCTGGTAAAAAAAACTACATGCTGTCGAACATATAGCTT
> AATAGTCTAAACTTATTTAAGCGCTGCGCATCAGTTAATTACAAATCCTTTCCGCTGATT
> TCCGAACATCTTTATTAAGCAATATACCTGCCCTCCGAAAATCTATAGAGGGACGTTACA
> ACTATATCATATTCTACGATGGCCTAATGTATCCATAAAATTTGTCTAGTCTTACATAAT
> ATTTAAATTCCAGTATACGAACACTCTAGTAGAAACATAATATTCTGGGACATTGGGAGC
> TACTGACAAGATCAGATAACTAATACAACACCTCACCCGATCCATGGTCGTTAATATGTA
> CTACCCGGAAAACGTAACTCTAAATCTTGTATATTAAGTCGCCTAGATTATGGGTTCGTA
> AATCACTAAGAACGGTACTCACCCATTGCCAAAATAGCTGAACCTTGAATATGATAATTT
> TTGAGACAGGATTGGCCCATTGATGACCGTAATTGCTTAATTAATCGGGACGGTTGCAAG
> GTTGGGAACGGGTATTAGACATCATATGAATGTTAAATTCTATGTGGTATCATAATATAG
> TACTTACTCCGCATAGCCTAACATTGTTTCCGCCCTAAGTTAGCGGATTAACATGAGGGT
> CTAAAGACAGTAATTCATCTTATATGTTATTATCGGCAAACTTGAACATCAGGTGTTCTA
> GCGTCATCTTGCAGAGATTTTCAATCAACCGTTAAATCAATAATTTTTAAAGTTAGCAAA
> CCTCATTATCCTTGTACTATGACCTATATGCCTCCTGTTACCTTGAATATATAGCGCAAT
> ACTCACACACTGCCCCGTCGAGTCAGGACAGTTTAATTCTGTAGCTGATATAATCGTGAT
> GCTTGTAACTACACTACCAAGTCTGACGAAATAACCGGTTAAATTGGCAAAAATCTGCGA
> ACTGAAAAGATGATTTTCTTATACGACCCAATCCTCATTAATATTTTTCCGATGATCGAA
> GCGATAGTAAGCGGAAGTCTTTTTAACAATAACAATATGGCAGATACCGCATCCATTGTT
> CAAGCGCGCTCCCGGTAAATGACCAGAAATGATTCTACGGAGCCACTTTGCAATCGACGA
> CTTTCCGTGTTGGTTATATATCGCATACGGAGCAATACCAGTAGAATAGCACATTCGTGG
> AATAAAATGGTCGAATATAGTATTAACAACCTAATTCTAATTTCTGGTCAGCAATTAGAA
> ACGCTTGCCTATAGGAGACATATATCTCAATACGTCTGGAGAACTATTTGTCTCAATCAC
> TTATATGTTAGGTACGGCGCTTGGTTAAACGAGTTGCGATTTTTTCGTGTACTCCGTAGC
> CCATTGGGAAGGCGAGCCTTTATTTTTTACTATATTCAATGCAATTGGAGATATAAGCAG
> GACATAGTTGCCAATCGACTAATCAATGCCATCATCAGTGGTATCGATCAGCTTTTGAAA
> AGGTTTGCAGTAAAATGGAAAAAAAGAACGAATGTGCCATATTCGGTGGAACTATCGCAC
> GAGCAATGAGTAACGAAACTAAATGACTGCTAAAGCCAAATCACAATCGGTAAAGACAGC
> ACAGATGTCAACTAACAGAATACGGAAGATCTGTCGCTATATTTCAAATCCCGTGCTTTT
> ATAGTTGGTACGATTTCAGAGCATCTCTATGTCATTAGACCCCTTTGGCGGCTAATCCCC
> GGCTTTACATTGTTAGATTAGAACATACCTTGCTTTACACTGAAGATCAATACCTGCTTA
> GCCACGCCATGCCGTCAATATACATGGGTTCCAAGTCTTACACGGCGGAAGATTACACAT
> ACACATCCGAGCTTTTGTAAAGTTGGACCCTTACAAACGTAAAGTTTTATAAAAAGGAAT
> GCCACTAGATAGCTATAAAACTGAGAATTCTGTGTTAGGGGAAGAAGTCAACCTTTGCAC
> TTTCTGAGACGGATTCTAGTATATTTCCTTAGGGACGCGAATTTAGGCGATTCAGATTTT
> ATCACCATGACCTCATGGCCAGTTTTTTAAAGATTTGTAACTCAGGTAGGTTAGAATACC
> CTGCCTACTAAGTAATCCCGACGAAAACAATAGAATGACGGGTGATGCGTTATTTCTTCG
> TTGGATTAAGAACCTAAAATCCCTTGAACTACCTGACGTACCCGTTCCTACCTTTAGCAC
> TGTGAAGGTATGGGTGTTCCACTCGTTATAATGTCTATAGAATAACCTATTCGAAACTCC
> ATAGTCATCTTTAACACTGGCTAAAGGTGACAGGAAAAACACGTAGAATTCATTTGGAAA
> TACGTCAGTTATTTCTTGGCTTAATTCTCCTGGTCAAAAAACGAGTCCTCATGCATGGAA
> CTCTCTAACATAACGATAGTGATTGCACGAATATCTTCATCCAGATCTCTTTGTATAATC
> TGTGTTTTCTTGCTTATTGCTCAGCGATTGATTTGGGTCACGAAGAGATGCTCTGCCCCA
> TCCGAAGACATTTGTCAATGTACGGTTAAAAGTTTCTCGTGCTTTGATTCAAACAATTGT
> ATAAAACTATATGTGTCTCTATTTACGGAGAATTTAACCTCTAGCCAATACAATTTATGG
> AGGGGTGAGGCAGAGTTTGGCGTACAAACAGAAATCTATTATGGATAAGTGCCCCGCCAA
> TATGTTTGAAATTTGTATAATCCACACGCTTTCGGTGAAGGTTCACGCGTCGAGAAATGT
> GCACCCTCAGATTGTACGCCTGATTTAGCATAGGAGAATTTTAATTACTAACCACCCAAA
> TCTCTTACTATAGTCGCTCACTATCAAATTTTTACCATAGGCTTAAGTCTTAAATCTCGC
> CAAAAAAGCTTCTTGCCTACAGTATAATAAATACAGAGAAACTCGACCCTTGGTACTTAA
> TCCCCTTGAATTAAACTGACTTAACAAGTAGGTCGCCAGGTTACCATTTTTCATTTTCAT
> TGAAGAGTCGCCCAGAGCTGCTATATGTGGAATAGCACAACAACACGCAAGCCTCTAACT
> ATATAGATGTATTATGCTACGGTACGAAGCCCAAAGCCCGAAGTCTTCACGGGGTCTGAT
> AATCTTTAGCAACATTATGAACTGTTACAAAGATTCCTGCCTTAACATTTTCCCAGGCTT
> ACTGTTTAATTTATTTAAGCGTCATAAGTTCATAATAAACTAATAGTAGACGAATTTTTC
> GCAGTAATACTTGACTTCAGAGACGGGACTCGAGTGGTTTGACACATGGGGGCCCTAATG
> AAGATTTCATTTCGGTTCACCGTCAAGATGCATCGGAAGTGCGGACTTGGACACGTCCAT
> ATCATCATAAGGTCGACTATATCGGTTCTACGATGCTTCGTAAGTGTCAGCTGCTCTGTC
> TAATTTTGTTATATATATTGACCTTAAATTGAGATATTGATGTTGGAATAGCGGATCTAG
> AAGACTGAATTGCGTTAAGAAGCACTAGAATCGTAAAAACAAACGCATCTTAGCGTGCTC
> AGCCACAAGCACCACCAACTTGTATATTCTCGTGCAGTTTAGATCGCGCTGTCTACAAGC
> AGGACTGGTCAATTTGGTCAAAATTCTATTCCACGGTCCAGACTATCTACTAATCCTCTT
> AATGGCACAATGACAGTTTCTGGCCATAATTAGATGTCGTCTGTACACTGGTGTTATAAT
> AATGAGATACACTTCGGCGCTATACTTCCGAAGATCCCCTCATTCCGAGCATTTAAGGTT
> CGACGAACATTGAGACTTTAGTATTAGTCTAAAGTCTCCATTTTGTTTCAGTGCTGTTAA
> TAAAAATACAATTGGCCATCAGCTCATCGTACTACGACCAAAATTAGACTGAACGACTTT
> TAATGTTATCGTATTGCTTCATCCGCCGAGTAGGTGTCCTAACCGAATTGTTTTAAATCC
> CAAGAGTGGTTCCTCAGACTAAATTCTCGCTCAGGCGATAGGAAGTATGGCACATCTAAT
> GGTGCTCTTTAACCAAAGATCCGCAGATCTAAACCGTTGCGCAATTTATTTTAAGTACCT
> CTTTTGTAGATCCCAGTTTACAGGTCATATGTTTAAAACGAATCTGCTTATCCTTATAGA
> AAAGGCACAACAGTTTTGTTAGCCGAATAACACGTGCCATATATGTTCGGCGTAAGAAGT
> ACGTAAGGTGGTTGAGTATTTACATGGTACTGTATTATTCCTCCTAAAAAAATAATATCA
> TTTTCCCGTTCAGGTCTTGAACAATTTTTCAAAACTGCTATGCACAAAGGTAGCGCAACA
> ATGCCCCGAAGCGATATCTGATAACGTACTTGTCTATAAGTACCTGATCAGTTAACGAGT
> GTGAGCTAGAGTCGCATTTCTGTCGAATATTCTATCAGACTTCTCGCGAATATGTGCATG
> CGTGGGTGAGGAGCTAGTCTTGGATATTAACTTCTTTACTAAGAAGGGCCCGAAAACATC
> TAAATCGGAACTGATGACATAATTTGGGAAAGGACTCCAACTACGATTAAATCGTTAAAA
> TATAGTAATTATGTTCCTGCTATGACATTTCTATGACTAATTCATTAAATGCGACTTCTC
> GTAACTCATACACGATGCAATTCAGGATATTATCATTGAAATTTATCAATTAGTGGTTTT
> CTTTGTGAGTGCCCTTAGAGTATTCATTGCGAGTCGTAACGGATCTCTTGGTCAGTATAG
> AGCATTATAACCTTGGGAAATCCAGAAGTTTTCCTACCTTGTATTACTATGCTTTGCGGA
> TGTTGCGCGCTGACCCCATAAGTCATTGCATATATCTCAGGTTAGTTAGGTACATGGTAG
> TATCACGAACGAACCTTTTACAAAGATTGTGATCATATGTAGTAAACAATGTAACAATTC
> ATATTTTATGATTCCTCGGCCGCTTAGCTACGTTGCATAGGCTATAATACAATGATCGTC
> TTGCGATAGGGCTTTTGTAGTGGTTGGACGTGAAATGTCTGTTTAATAAATCGCAAGCAG
> AATTAACGTATCTAAATGGTCTCTTTCTTTGTATAAATAACTCTGGTGGCTGCATAGCAC
> AGAGGTTTTTATGGCTGCAAATATAAATAGGTTCTTAGCACACAAAGATGGAATATCCCT
> TTGTTATCTTAACTTACAGGCAACCTCTTATGGTATCTTAACTCGTCCCAAGGTCAGTTG
> GCCATAAGTGTGCATTCCACCGAGTTAGATGATATTAAAAACTTTTTCTTACACATATTG
> ATAAGCCATTATCATGCCCCTTATACTCTCTCTGTGTTACGTTCGACGCCAGAAAATATC
> TCTTTATAATAATCTAGCTACTACTTGATTTACACTAGGAATGAGTGTGTGCATCTACAA
> GCTCTGTCATCATTATGGTGTAAGTGACGTCTGAAGACAAAACTGTGAAGGTCAGTTAAA
> TGGTCAAAATCTACACTCGCTGTCACTTACTGATACATTTCAACCTTATTAAGTAAATGA
> GCAACGTGTTGGACAAGTTAGCTCTAAGGTCCCTCAGGCTTTATTCATTAACATATGGTG
> GATGTAAGGACTAACCCTAACGATTTATTCAAGCTGTACAATGACTTCATCCATTTACAG
> GAAAGTCCGGCCTAAATTGTCCATTTAAAGTGCTACTCTTTCCTCCAAAGCGGGATACTC
> ATTAGAGGTGTACTGAATTTTTTTAATTGAATGATGTCGTATTTAACTTTAAGTATGTTC
> GATGTTGCAAATATAATCGAAACAGTGCCAGTTCATGAATGATAGTCTATCTGTTTAGCG
> AATCCATCACTAAGTGACGTTAATGTGATTTTATTTACATGTGAGAGCCATTAGTTATTG
> GATAAAAATCCTGACAATTTGAGCATGTCGGAACTCAGTCTAACGGATGACGTCTAGTTC
> CTACTGTTAAATCATCGATTACATCAATGTACCAAAATTCCCTCTGTCAAGAGTTTTGCG
> GGAGTCATAATAGCAACACCGTGTACCATGGTAGTCAATTATGGTCTGGACACTCGAACA
> ATTTCATACTGTGTATGTGGCCTAATGTGCTTTCGACCCAAGGGCTGCCTTACAATTTAG
> ATTAATAGAAACCATTAATAGGGTTAAACACCATGTTATTTATCCCGATAAAACTACGAT
> TGAGGTATCGCATTGCTAAGGACATGAAGCAAAAGACACTATGTGTCAGGCAACTTGGGT
> CAAGACAGTCCACACCTCCTGCGATGTTGCACGCTCCTAGTCTAGACTAACGGTTCCTAA
> TTGTAAAACTCTAGAATATATGGTCGACTCTTAGTTAATCTTGAATACCTTAATGACCAC
> AATGATAGTTGCATAGAGGATGTGAACTTGTCGTTACTCGGTCGCTGAGGCACAAGCGAT
> GTTACAGTTTTGAATTCATTTCACGTGGTCCATCGTCGATCCTGTCTTGAATCAAAAGGT
> AACCGTAAAGATTTCAGGTCGCAAGGCCGTTTCACTCGCTGTCAACTGTTGATTAGCATA
> ACCCATATCCAAACAGTAACATACGCGGCTATACGAAAGATCTTCAGACCTAATGTAGCT
> GAGGCTTGTAGATCCCGTCACCTTAGAATTCGAATCCACACGTCACTTATAATCCTAAGG
> GTGTGGTGTAGTGAAAGACCGCCGTCTCATTGTGCCGGTTTATTCTGACGTTATTGTTAA
> AACAGTTGACGTACAGATGATTGAGAAATCCATTTGAATGCAGTTATAAGATGATTCGAC
> GAGTTTTTAAAACCAGCATAAACGGTATCCCGGTGAAATCTTTTTCCACTCAGTCTAGAT
> TCAAAGGTTGGAACAAAAATTATCACGAATTTCTATGATACGCATTGTGTAGTAAACATC
> ACGTTCGTCGCTTACGTGTGTTTCTGAGGAGTAATCTGCATTAAATTTGAAGGCTAGCCT
> CGTATTTGCCAATTATTCTTTTCGATCACAAACCACGTGCTGCGTAGTTCTAATGGGACA
> ACTCCTACTTAGCAAACAGTAGACAAGTTTGGAACGCATATCTTCAATTTGAAGCCAGAT
> TATCCAATGGTAGCACATACTTGTTGAAAATAAAAACCCCCACATGACAGTAAATAAAAT
> AGCCAAGTAAGCATGTTTATAAAGCATGTATCCTAGATCAGCAATTAGTGGTATCTACAT
> ATGCACTGCAACTCGTACACGATGTCGGTCATAAATCTATGAAACACTTACTACGAATAC
> GGGTTTGAACGGAATTAAATAGTCGAAAAATTTAAATTCGTCGGTAACGCAGATGTTGGT
> TATCCTCTAATTGGATATACGGATCACTAGGAGAGAGGGATGGACGCGTCGGTTACAGAG
> TAGCCAACACTATAAAGACGCGCAGCAAGATGGAGTAATTTCCACTACTTCACCTCGACC
> AGCAGAAATAAAGCTGTTATTATACATCGGGACATGAAGGTTTTATTCTTGTGTATTAGA
> CATCTTACATCTGTTGATAGATTGGGCTTAAAACGTTTTTGTATTAATTGTATCTTAGAG
> TGTCATCTTCTCAGTTCTGCGTAGCTGCTTCAATGCGTGCTTCCTTCTTCTCCGTATACC
> GACATCAGTTAAAATTTGTCGTACTGCCGACACTTACGAGATTCCAATTTAATATGACAG
> TTAAATGCGCGTGCGCTTTCAAACCTCTATCAGGATAGGCTCCTTCGACCATGACGCGCT
> CTGAGAGGAAGTACTATTTGTTGGTGCTGAGATTTAAACTCCCCCCATCCACTTGGGATT
> TAGATTCTTCTAATCACGGGGAAGCTCCCAAGCGGTCTTCATGGAGTCTCAAGGCTGGAC
> AACTTAAAATCTGTTATCGGAATCACTTTGTCGGCTATATTAGGTGCTATTATTTATGCA
> AGATGCGACATCTTACTTTCATGGCAGTTCTGTCAACAGCCAAAAAGTAATCAGCCGTAA
> ATAAATCCCTTGCGTGGTAATGGATCCAGAGTTATTCGTATTCCTTTATGAATCTGATTA
> AATCAGCATAGCAGAGGAAGCACGTGACCTTAGCACATAAAAGTATTGTTGCGAATGATT
> GTACAAGATGTAGTGGCAGTTTATGATATTAGTTGATCAGAATAACGAGATCGCATTGTA
> ATTAATCGAAGACATGACTCATGTAGTTACACCTGACTTTTCAGTTTATACAGAATATTC
> CCTTACGTAGGTTTTTTTGTTAAAGCAAAATTTACTTCGCAAGTCTTTAAGGTCGGGTTT
> TTCTATCGGAACACAGCTCTTTACTTATATAACCTCTCTTAGGTCTAGATTATGGTAATA
> AGTTTTAATATACCTGGAAATTATCCCCGTCCAATCAGAAGATCATACCCATACATAGGT
> ACTAGCGAATATGTGAGATTGTTTATTGTTTTGTCTTCTGGGGAATCACCTTTTGGTCCT
> AATATTATGTAGTGACATTATCTAAATTATTCTGCATAGATTAATAACCAATGTTGGGTA
> ATTCTCTGTCGAATACCTCGTTCTCTATCTGAACTATATGTTATTGATAATGTTACGCTC
> ATTCGGGTTTATTCGCTCACGCTGCGAATGTAACTTCTGGTACAAGCGTTCGATGAATGC
> CACATATCTAGAACAAATGACAAAATTGTTTATTTTTAGTAGCTCATAGTTGTCCTCAAG
> TTCTGACCACAATATATAGCTTACCTAATGGCGGAACTTTGAGTGCGGGCTACCACAATA
> TTCGATGCCTGAACTCTTCGTACTGAGCCGCCATGATAGGCATGACACTAAGATGCTACT
> CTCCGGCGCATTCGGTAATTTGTCTAAATCCGTTGTGTTTAGGAAAACGAGTTAGCGCTC
> GATCTTTTTATTCTGTGCGTAGGTAACGTTGATGAATGTATCTCCAGCTCTGGAATTGAC
> GCAGAGAACGGTGACCCTCAACCATAAGGTAACAAGATGCGAGGGTCCTTTATTCAGCGG
> CTCCTCGCTCCTGCAGCGAATTATTTCGGAACATTACTGGCTTACATTGAGCAAGTTCCA
> AATGGAATCTCCTACCAAGTGCCTAATGCACGGGTCAGAATTTCGGAGATCTAATATAAG
> AGTGTCTTCACGGAAACTACTTATTGATCCGATGACGAAACCTAACAGTAATTCACTCCG
> AGTATATTTCGTTTTAACCTTAACCAAATTCTGTTGTTACCATGTTACCGTGAAGGAGCA
> GGTTTCCCCGCCCAGTATCCCTTTGTCTCTAGGCTTCAGACTTAATCTATTACGCGACTA
> CAACTGCTTTGGGTATTTAAGTCGTGATGATAGGTATTGGGTAATTCTGTGCGAGCACTT
> TTAAACATTCACGGTCGCGTTCGCTATCGATTCCAACAATTTTGAGTAAGATTGCTTCTG
> TGATTTGCGAACGGAATTAGCCTAATCGATTATAGTCCATCTTAGAAGCCTAATTTCTTT
> TCCATTTCCCCTGAAGACTCGAAGGCCGCTACCGACTACAGTCATACGACATTTATGAGC
> CGTGATAAAAGTGAAGGGGTCCGCCTTGACAACACATTCATGGAAAACTATTTAATTAAA
> AAGTCTGATGATTGTCTATAGTAGGGCCCTCAATTGCAATTTGAGCACACTAAGCGATCT
> TATGACAGATGACAGAGAAATTGTCGTCTACCGGTTTACCTGGAAATGTCTAGACTAAAA
> TTTAGCAATTCTAAGTATCAACATTTAGTTACCGTAACTGGGCAAGAGACTGCATCTATT
> ACCGCTGAGTTCTAGGTGAGATACTTTAAATGGAGTCCCCACCCGGACAAAAAGGAATGT
> TGTATACAATGTTCAGTTTGCTGATATATCGTTCACGGGGTTGATCTGATTAACTAAGAT
> ATAGGATTGCTTTTCTAGAAAAAATCGGCTATTAAGACCTGTATATTATATCGACCCGTT
> AAACTTCTCAAATAGGTCGATATAAGCTCGATCGTCAAGTTATATGCGTATTGTTTATCC
> TGTCCAGGCATGGCATTAAGAGTTCGTGAACTCATACGATCACCCACTGTACTTTACATA
> GAGAAATTGTTACTATTCTGATTAAGCCCTAACCTAATCTCCGAGATTACAACCTTTATA
> ACCAACTACATAGTTCTATGGAACAAAAACCGCTTTTGAATTCGCCCACACCCATCCGGT
> TTATCACCTATTTTATACCAAAATTCTACTACAGCCAATTGTACCACCTGTACTTTTGTC
> TAAACGCGTAAGTGCGAGCGGGAAAACATTTTCGTAATCTGATTCACTAATTTTAATCAC
> TCTGTAGATACCAACAACAGTTTTATAGGCCTTAATCGAGTATGAATTTCCATTTCTACT
> GACTTGCTGAGACACATTCACTGTATCCTTACAAAGGAGTATTTCTAATGCACTTACTGA
> TGACATTTACCCATGATTTAATTATGCTACGACGTAAGTTGTAAAAGTACGAGTCTTTTA
> GTCTTTAGATATTTATATATATACTCCTGGCGAAATTAATACTAATTGAAGCTGGTTTTT
> AGATTAAGGTGGGGTACTGTTATAATTGAAGACCTATTTGCTCTTCCATCCTTTGTAATT
> GTACCGAGTGTACGATACACTCAGTCTATAAAGGAATTAGTACAAACCACGGAGCATTCA
> AGAATACGATTGCAACGCATGCTAGCTTATCATATAAACTTTAAACCTCGATGGCATATA
> TTATGATATGACGTGTCTCACCCTACTTTGACTGTTAAAAAATGCTACTGGCACAACAGT
> CCCAAGCTTGACCTAATACATGAACTCGATGCAGATCGTATCCGGTGTATTTATCTCTCA
> GAACACGATCTCTACTGATGCACCCAGTAGATTTTTCTTTCTATGTGAGGTTTTTTTGCG
> ACAGTACAAAGCGGCGATATAGTGAGTTACGACTGTCAGTCGAGAACTGGTTTATAGAAA
> AGTTGTGTTCTTCTAGCACCATGATTATTAACTAGCTTTTCACGAGGTTTATGACAATTC
> TAGCATTAATCGTCTAAAGGCCCGTACTTCTCTGCGCTGGCTAAAACTGAGACCCTCTCA
> CGCCGCTTGTAGGTGAACTAATGGTAAGTATCCTGTGCCCCCACAGCCATGCATCCAATG
> TCTGGATAAAACACATCACATTGACACAACATTTGCATAACTAATATTCCTAGTAAATAT
> ATTCCTTTGACTACCCCCACGTTAATGTACACCATGCGGCATTTAAGCGCGATATTATAA
> GCATTTATCAGTCGATTACTGTTTGCTCACTCCGCAGACTTCCGCGTCTTCGTAGCTTCA
> ATTAATGATTAATCTATGAGCTAGTCGAATCAACACCAGGTTTATGTATGTTATTTACGT
> AATACTGTAGAGATCCATTGTATTGATCTTTATGCTCTTTACGAACCGCTTTGTAATTAC
> GTTCGTAGCCCGTAGAATTCAGTCAACAATATTCTTCTGTTGCCTTTCACCTACTTTCCA
> GGTGAGCTGCCAGTCATAACCGAATTAAGTCTCTCTGAATAAGTAACGCATTCTATGATG
> ATGAATCGTTCCAACCCGACGAGTTTCTACAATATAATACTAATCCTTAACTTAATATTT
> GTTTAGCTTGTCGTCCTAACTCAATCCGTCTTCAGTATAAATATGGATGCGTATAATTAA
> TACTGGATCTCGAAATGAGTCCTTAATAGTCTAAACGTATTGAAGACAGGCCAAGCAGGT
> AATGACATATACTTTCAGCGGATTTAACAAATTCGTTAGTATGCTAGATTACTCCCCGAC
> CAAAATCTAGTGTCCGACGTTACTACGTTATCAGTTTCTACGATGGCATAATGTAGCCAG
> ATTATTTGTATAGTCTTAAATTATATTTATAGTCAAGTATACCTACAATCTAGGACTTTC
> TTAATATTCTGGGTAAGTGGGACATAATCACATCAGCAGATATAGTATAAATCAACTCAA
> AAGAGAAATGCTCGTGATGTTGTACTACCAGCAATAACGAACGATAAATATTGGTTTTTA
> AGTAGACTACTTTTTGGCGGCCTATATCACTTTCAACGCTTATAACACTTGGCCAATATT
> GATGATAATTGAATTTGAGATTTTGGCACACACGATTGGCACATGGATGACCCTATGTCA
> TTAATTTATCGCGAAGGGGGATACGTTGGCAAACCGGATTACAAATAATTTCATTGTTAT
> AGTATATGTGGTATCATTTTATACTTATTACTACCCATTGCCTAAATTTGGTTCCCACCT
> AAGTTAGAGCATGATCATGACGGTCGTATGACACGAAGTCATCTTATTTGTTATTAGCCG
> CTAACTGGTAAAGCTCGGGTTATAGCGGATGCTTGATCAGTTGTGCAATATAACCTTTTA
> TAAAGTATGGTTAAAGTTACAAAACCTAATTATACTGCTAATTGGAACTATATGAAGCCT
> GTGAACTTGAAGATATAGCGAAATAAGAAATCAATGCACCGGCGAGTATGCTAACTTGTA
> TGATGTAGCTCAGATAATCGTCATCCGGGGAACTAAAATAAATACGCGGACGTAATATCA
> GCTTAAATTGGAAAATAGATCAGTTCGGTAAACATGATGTTCTGATAAGACACTAGCCTA
> TTTAATTTTGGTCCGATGATAGTAGCGATAGTATCCCCAAGGATTTGTAACATGTTATAT
> ATGGCAGATAACGCATACATTGTTCATGCGCGATCCAGGGAAATCTAAACTTATCAGTAT
> AACGTCAAACTTTGCAATAGTAGACTTTACCTCGTCGGTATATATCGAAGAACGTGCATT
> ACCAGGTCAATACCACTTTCCTCGTAGTTAATGGGCCATTATACGATGTACAACCTTAGT
> AGAAGGTCGGGTCACCTAGGAGAAAACATTCCCTATACGTGTAATATATCTATATACGTC
> GGCACAAAGTGTGGTCTAATGAACTTTTATGTGACGTACCCACCTTCGGTTAACGACTGG
> AGATGGTGTCCGGTACGAAGTAGAACTGGCGCAACGCCAGACTTTAGGTTGTAAGATATT
> CATGCCAATTCCAGATATAAGCAGGAATGAGTGGCCATTAGAATAATAATTCACAGCATA
> TCGGGTATCGATAACCTTTTGAATTCCTGGGCAGGTTATGGCATAAAAAGAAACAATCTG
> AAAGATGCGGTCCTACTTGCGAAACAGATTTGTCTTAAGATACGTAATCAAGCCTATTGA
> CTTATCAATATCGGTATACACAGAACACATCTAAAATTACAGAATAAGGTAGATATGTCC
> ATATATTTCAAATACACTGCGTTGAGAGGGGGGTCGTGTTCTGACCATCTCTATGTCTGT
> AGAACCCTGGGGAGCATTTTCACCCCCTTTACTTGGTGACATTAGTTCATTCCTTCATTT
> ACAATGAACATCAATACCTGATGACACTAGCCTTGACGTCAATATTCATGGCGGACTACT
> CTGACACGGCGGATCAGTACACAGACACATCCCAGCTTTTGGTTACTTGGTACATTACTA
> TCGTTATGTGTTTTTAAAAGGAATCCCAAGAGATACCGTTAAAAAGCAGATTTCTCTCTT
> TCGCCTACATCTCAAAATTGCAAATGTATGAGTAGGTTTCTAGGTGATTTACGGAGGCAC
> CCGAAGTTAGGAGATTCAGTGTTTTGATCCTGGACCTCAGCGACTCTTGTTTAAAGAGTT
> GTAAATCTCCTAGGTTACAATTCCCTGCATACGTAGTATTCCCGACCTTAACTAGAGTAT
> GAACGGTCATGAGTGAGGTATTCGTGCCTTGAAGAACCTATAAGAAATTCAAATTACGCA
> CGGAACAGTTAAGTCCTGTACAAATGGCAAGGTATGCGTCTTCAACGAGTTAGTATCTAG
> ATACAATTAACTATGAGAAACGAAATACTAATCTGTAAATATCGCTAAACGGGACAGCAA
> AAACACCTAGAAGTCATGTCCAAATAAGTAACGTATGGATTCCATTAATTCGCCGGCTAA
> AATAAAGTGTCCTCATGCATCGATCTATATATCAGAACCATACGCATTCATCGAAGTTAT
> GAAGCCTCATCTCTTTGTTGAAGAGCTGTTTTATTCCTTTTGGATAACCCATGCTTTTGG
> CTAACCATGACTGGATATGACACTTACGTTGAATTTTCTCATTCGACCGGTAAAACTTGC
> TCCTGCGTGGATTAAATCAATGCTTTAAAACTATATCGCGAGCGTTTTACCGAGAAGTTA
> TCCGATAGACTTGAAAATGTAGGGAGGCGTCACCCACTCTTGCCCGTACTATCTCAAAGA
> TAGTATCGAGAAGTCCCCAGCCATGTGCTTTGATTTTTGTTGTATCAAAACGATGTAGGT
> CAACCTTAACCCGTCCTGATATCTCCACCCGCACAGTGGAAGAATCATTTAGAATTGGTG
> ATTGTGAAGTAATATACAACCAAAGATATTTATAGACTCGATAAATATCAATGGTTTAAA
> TTACCATTTAGGCTTTAATCGACACAAAAATCATGATTGACGACTGGTTTATAAATTCAG
> TCAATCGAGAAACTTGCTTCTGAATCCCCTTCATTTATACTGTCTTAACAACTACCGCGC
> AAGCTGACAATTTTTCAGTGTAATTGATCACTCGCCCTGACCTCATTTATCTGGAATACC
> AATTAATCTACAAACCCTCTAACGTTTTACATGGTTTATCCTAACGGAACAACCACTTAC
> CCCCTAGTCGGATCGGGGTATCATTATCTGTAGCTAATGGATGATAGGTTAAAATGATTC
> ATCACTTAACAGTTTCCCACCCTTACGGTGTTATTTATTGAACCGTCATTTGTTAATAAT
> AATATTAGACTAGAAGAAGTTTTCCATCGATTAATTCAAGTATGAGACGGCACTCCAGGG
> GTTTGAATCAGGCCCGACCTTATGAAGATGTCAGGGCGGTTAAACCTAATCTTCCAGCGG
> AAGTCCGCACTGGCAAAACTCCTTAGCTGCTGAAGCTAGACTTTATAGCGTATACCATCC
> TGAGGAACGCTAAGATCCTATGTATAATGTTCTTATATTGTTTGACCTTATATGCAGTTT
> TTCATCTGGCAATAGCCCTTATACATGTCTCAATTCAGGTATCAAGCAATAGATTACTTT
> TTTCAAAACCATATTTGCGGCATAAGCCACATCCACCACCAACTTCTATAGTCGCGTGCA
> GGGGAGTTCCCGCGGTCTACAAGCAGGAATGGTCAAGTTGGTCAAATGTCGTTGCAAACG
> TAAACTCTTGATACTAATCCTATGTAGGCCACATGCAATGTTTCTGGCCATAAGTTCATG
> GCGTCTGGTAACTCCGGTGATAATTAGGAGATTCACTGCGCCGATATAATTACGAACATA
> AACTCAGTAAGAGAATTGAACCGTAGACCAAAAGGGAGTCTTTAGGAGTAGGCTAATCTA
> TCCATGTGGTTTCACGCAGGGGAATAAAAATACTATTCCCAATAACATAATCCGAATAAC
> AACAAATGTAGACTCAACGAATTTTAATGTTAGCGTATGGCTGCTGCAGCAGTGTACGTG
> TCAGTACACTATTCTGTGTAATCCAAAGAGGCGTTACTAAGACGAATTTCTACCTCAGGC
> GAGTGGATCTATCGAACATATTTTCCGCCTAGTTTACAAAACTTCAGCAGAGCTTAAAAG
> GTCAGCAAGGGTTGGGAACGACATCGTTGGGAGATACCAGTGTTCAGGGATTATCTGTAA
> AACCAATCTGCTTAGCCTTTTTGAAAACCCAAAACAGGTGTGGTTGCAGAATAACACCTG
> AAATTTATGTTACCACTTTGTACGTCCTAAGGGGCTTGAGTATTTTCATGGTTATCTATT
> TTTACTCATAAAAAATGAATATAATTGGCCAGGTCAGGTCTGGATCAATTTTTATAAAAT
> CATATCATCAAAGCTAGCCATACAATCCAACGAAGCGAGATCTGTTATAGTACTTGTCTA
> TATCTAACTGATATCTTATCCACTCTGTGCTAGACTACCATTTAGGTAGAATATGCTATC
> ACAATGCTAGCCAAGATCTCAATGACTCGCTGACGTGATACTCTTGCTGTTTATCTTATT
> GAATATGAACCCCAAGAAAAAATCTATAGCGCATATGTGGACTTATGTTGGCAAAGGACT
> CCTTCGACCATTATTTAGTGAATATTTACTTATTATCTTCCTCCGTTGAAATGTATTTGA
> CGTATGAATTATAGGAGTAGGCTAGTAAATAAGTCACGTTGCAATGATCGATTTGAGAAT
> TCAAAGTTATCAAGTTCTCGTTGTCTGTGTGTCTGCCCTTACTGGAGTAAGGGCCAGTCG
> GAACCCATATCTGGGTCAGGATAGTGATTGTTAAAAGTCGGAAATCAACTAGTTTTACTA
> CCTTCTATTACTATGATGGCCCCATGGTGAGCCCGGACCAATGAAGGAATGGCATATATA
> GCAGGGTACTTTGGGAATTCCGAGTAGCACGTACCAACCTGTTTCTAAGATTCTGAGATT
> TGGTAGTAAAAAAGCTAAAAAGTCATATTGTATCTTGCAGAGGAAGCTTAGAGAACTTGC
> AGACGCTATAATTCTAGGTTACGCTTCACATACGGATTTGCTACGCGGTGCAACTGATAT
> GTATCTTTTTTAAATCGCAACCACATTTAACCTTTATTATTGGTATATTGCGTGGTATAA
> AGATATCGCGTGGCGGAATAGATCACTGCTGTGGAGGCCGGCTATGTTTTATTGGGGATT
> TCCTATCTAACAGGCTATATCCCTTTCGTTTCGTAACTTTATCCCAACATCTTATGGGTT
> ATTTAATAGTCCCATCCTAAGTTGCCAATAAGTCTGAATTCCACCGTCTTAGTGGTGATG
> AAAATATTTTTATGTATCATATTGTTAAGCCAGTTGCAGGCAACTGATTCTCTCTCGCTC
> GTTCCTTCGACGACAGTAAAGAGCGATTTATAATAATATAGCTTCTAAGTGATTGACACT
> TCCTATGAGGCTGTCCTGATTATTGCTCTCGAATCATTAGGCTCTAACTGAACTCTGAAC
> AAAAATAGGTCAACGTATGTTAATTGCGATTTTTCTACACTCCCTGTATATGACTGTGAA
> ATTGATACATTATGAACGAAATCACAAACGTGTTGGAAAAGTTAGCGCTAAGCTCACGCA
> CGCTTTAGGCAGTTAATGATGGGCGTTCGTAGCTCTAACCCTAACGTGTTATGCAAGATC
> TTCTATGACTGCATCCAGTGTCTGCTAAGTCCCGACTATTGTCTACATTTATACTCCTAC
> GCTTGCCTACTAAGCGGCTTTCTAATTACACCTGGACTGATGTGTTTTAAGTGATTGTTG
> TACTTTTTAACGTGATGTTGCTTAGATCTGGAAAATATTTGACAATAAGTGCCTGTTAAT
> GATGCATTCTCTAGCTGGTTAGCCATTCCTTCACTAACTGACCTTAATGTGATTTTAGTG
> TCATGTCTCTGACTTTAGGTTTTGGATTAAATTACTGAATTGTTGACCATGTCGCAAATA
> AGTCGAACGCATGTAGGCGTGTTCCGACTGTGTAATAATCGATTAAATAAATGTAACAAA
> ATGCCCTCTGGCTAGTGTTTGGCGCCTGGCATATTTGCATAAACGGCTACAATGCTACTA
> AAGTTGGGTCGGGTCAATAGAACATGTTAAGTATGTGTATGTGGCCTAATGTGATTGCGA
> CCCTAGCCCTCACTGACTATTTAGATGAATAGAATAAATTTTTACCGGTATACTCAATGT
> GAGTTATCCAGAGATAAAGACGTTTGAGGTATCCCATTGATATCGACATCAACCAAAAGT
> CACGAGCTCGCAGCAAAATTGCCTATACACAGTCCACACCGCATCCGATCTTCAAAGCTC
> CGACTCGACACTAAAGGTGACGTAGGCTAAATCTATAGTATATTTCGTAGAAGCGTAGGT
> AATCTTGTATTACTGAATCAACACAATGAGAGTTGCTTACTCGATCTGAAATGCGAGTTT
> CTACGTAGATGTCGCAATAGAGAGCTTACTCTGTGCATTTCTTTTCTCGGCCTCCAGACT
> CGATAATCGCTTGAATCTAAACCGATCAGGATTGAGTGCACGGCGCAAGGACGTTTAAAT
> AGAGGTAAAATGTTGATTACCATAAACCAGATCAATAAAGTTACAGTACCGGCTATAAGA
> AACATCTTCTCTAAGAATCTAGATGAGGAGGCGAGATCCAGTCAAATTACAATTCGTATC
> AACAACTAACTTAGATTCATTAGGGTGTGCTGTACTCAAAGACAGAAGTATAAGTCGCCA
> CGTTGATTCGCAAGGTATGGTGTAAACAGTTCACCTTCAGTGCATTGAGAAATACATGTG
> TATGCTCGGTTATCATGAGTACTAGAGTGGTTTATTCAAGCTGATTCGGTAGACCGGTGA
> TATATTGGTACACTCAGTCTAGATTAAAAGGGGGCATCTAAAATGTTCTCCAAGTGATAT
> CATTCGCTTTCTGTAGTAAACATCAACTTCGTAGATTACCTGTCTTTCGGTGGTGTTTTA
> GCCTGTTAATTGGATGCCGAGAATCCTAGTTGCATATTATTCTGTGCCTGCAAAAAAATA
> GGCATGCGTACTGCTAAGCCGAAATAGACTACTTTGCAATCAGTAGAATACTGTCCATCG
> CATTGATTCAAGTGGAAGCAAGATTATACTAGGCGACATAATTCTGGTGCTTATTTAAAA
> ACAACTCATGACAGTATTGAATAGAGAAAAGTAAGCATCTGTATAATGAATCTATAATTG
> ATCAGCAATTACTGGTAGCGACTGTTGCAATGCAAAGACGACACGATCTCGCTCATAAAG
> ATATGAAAAAATTTCGTCGTATTCCGCGGTGAACGCATGTAATTACTCCTAATAGTGAAA
> GTACTCGGTAAACCAGTTCTTGGTTATCATCTAAGTCCTTAGACCGATCACGACGTCACA
> GCGTTCGAACCCTAGGGTACAGACTTGCCTACTAGATAAACTCGCCATGATTCTTGCAGT
> TAGGTCATCTAATTCTCAGACTCAACATCTTATAAAGCGCGGTTGAGAATGCGGGACATG
> TTGCGTGGTTTCTTGTGTATTTCAAATATGTCATAGGGGGAGTGATTCCGATTTAATCGT
> TTTGCTTGTTAGGGGATCTGAGTCTGTAATCGTATCTCTGCGGACTAGAGGCGTATTTCC
> GTCATTACTTCTGCGACCGATACCCTCATCAGTTAATATTGCTCCTAATGCCGACAATTA
> AGACAGTCCATTTTAATATGACTGGTTAATGCGCGGGCGCGTTCTAAACGCTAGCTGCAG
> AGCATACTGCCACCATCTCGCGCTCTCAGAGGTAGTTCTATGGGGTGCTGCGCTGTGGTA
> AACTCCACACAGCCACTTGCGTTGTAGAGTCGTAGAAGAAAGGCCAAGCGAAAATGCGCT
> CTTAAGGGACGCTCAACGCTGGAATAATTATTATATCGTTTCCGAATAACGGTGGACCCT
> ATATGTGGGGATATGAGTTTTCAAAGAGGCGAATTCTTAATTGCATGGAACTTCTCGATT
> CTGACAATATGTATTCTGACGTAAAGAAAGCACGTGCGTCCTAAGGGATCCACAGGTATT
> CCGATTCATGTATCAATATGAGGAATTCAGAATAGAACACCTACAAAGTGACAGTAGCAA
> ATAAATGTTTTGGTCCCTATGATTCTAAATGATGGAGTCCAACTTTATGAGTTTTGTTGA
> GCAGTATAACGAGAGCGCTTGCGTATTAAGACTTGACATGAAGCATGTAGGTACTACTCT
> ATTGTCAGTTTAGACAGATTAGTCACGTACCTTCCTTTTTTTCTTTATCCTAAATGTACT
> TACCAAGGCTTGAAGGTCCCGTTTTTCGATCGGAAAACACCTAGTGACTTATAGTAAAGC
> TCGTACCTATAGTTTATCCTAATTAGTTTTAATATTAATGCTAATTAGACACGTACAATC
> AGAAGTGCAGACCCTTTCATAGGTAAGACAGAAGTTCTGAGTTTGTGGTGTGTGTGCTAG
> GATCGGCAATAACATGTTGGTCCTAATTGTATGGAGGGACTGTATCTATTTTAGTCTGCT
> TTGTTTTTGTAAAAATGTTGGGGAATTCTCTCTAGTATACATAGGTCTCTATCGCAACGA
> GTTGTTATTGATTAGCTTAACCTCAGTCCCGTGGTTTCGCTCACCCGGCGAATCGAACGT
> ATGGGAATAGCGGTAGAGGAATGAAACATATCTTGAAAAAATCAATAATGTCTTGAGTGT
> TAGTAGCTCATACTGCTAAGCTTGTGATGTCCAATATAGAGACCTTAACGAATGGCCGAT
> ATGTGTCTCCCGCCGTCCAAAATATTCGTTCACGCAACTCTTACGTATGTGCCGCCATGA
> TTCCCATCAAAATATCAGGCTAATCTACGGAGAAGTCCGTTATTTCTCTTTATCCCTTCT
> GGTTTGGAAATCGACTTTCCCATACATATTTTGATGCTCTGCGTAGCTAAACTTGATGAA
> GCGATCTCCTGCTATCCATTTGAACATGAGAAACGTCTCCAGAAACCATTAGGTATCAAG
> AGGAGACCGTAATTTATTCAGACGATCATAGCTCAGGAACAGATGTATGTCGGTTAATTA
> ATCGCGTAAAGTCACAATGGGCCAAATGGTATCTCCTACCATCTGAAGTATGCACGGGGC
> ACTATTTCGCAGATATAATTTAAGTCTCGCTGCAACGAAAAGAAGGAGTCTGAAGATCAA
> GTTTACTAACACGAATTAACGCAGACGAGATTTCCTGGTTACCGGAACAATTTTCTGGTC
> TGAAAATCGTTCCGGGAAGCACCACGTTTACACCCAAAGTATACCTGTGTCGCTACCCTT
> AACAAGTATTATATTTACCGTCGACAAATCCTTTCCGTTTTTTAGTCCTGAGGTTTCGTA
> TTCGGTAATTCTCTCCGTGATCGTTGATACAGTAAAGGTCGACTTAGATATAGTTGACAA
> CTATTGTCACTAAGAGGGCTTCTGTGATTTGCCATCGCTATTAGCAGAATAGAGTTGACG
> CAATAGTAGATCAATATTTTCGGTGCCTGTTCCAAGCAAGTAGCGTACGACGCTACCGTC
> TAATCGCTTAAGAAATTTAGCAGCCCTGTTAAAACTCAAGGCCTCCGCAGTCTAAAAAAA
> TTCATCGATAAAGATGTAATTATAAAGTAGGTTCATGCGCTAGAGGAGCGCCATCATGGG
> CTAGTTGTCCAAACTAAGAGATCGTATGTAACAGGAAAGAGTAATTGGACTCTACACCTT
> TTACTGCAAATCGATAGTCGATATTTTACCAATTCGAAGTATCAAAAGGTAGTTAACGTA
> TATGCCCATGAGACTGCATATTGTACAGAGCACTTATACCGGACTTAATTTAAATGGACT
> AAAATAAACCAATTATAGCTTTCTTGGATTCAATCTTCACTTGGCTCATAGTGCCGTATC
> GCGGTTCAGATGATTATAGAAGATAGAGGATGGATTTGATACAATAAATCGCAGATTTTG
> AACTGTTTATGAGATCGACAAGTTAAACTTATCTAAGAGCTAGAGTTATGCGCGATCGTA
> AAGTGTTATCCGGAGTCGGTAGAATCTCATCCCATGCCTTGTAGAGTTCGGGATCGCTTA
> CCTTCACCCAATCTAATTTACAGACACTAAGTGTGACTAGTCTGATTTTCACCGAACCGA
> ATATCACAGATTTAAACCTTTAGTACCTTATACATACTTCTATGGTACATAAACCCCTGT
> GGAATTCGACATATCCCATACCGTTTTGAACATATGTTTTTAAAAATTGCTTATAAACAA
> TAGTCTACATCCGCGACGTTTGTCGAAAACACTAAGTCACTCAGCCATTAAATTTTAGTT
> ATCTGTTTAACGAATGGTAAGCTCTAGCGTCAGAACATCAACTCGTTTATACGACTGTAT
> ACACGTGCAATGTACTTGGATACGCTCTTGAGGACTATATTTCAAGGTTTACTTTCATAG
> CAGTAGTTCTAATGCACGTACTGTGGTAATTGAAAAAGGATTTAATTATCCGAAGACGTT
> TGGTCTAAAAGTACGAGGATGGTACGATTTTCATATTTATATATTGACTCCTGCCGATAT
> GTAGAATATTTGAAGCTCGTGTTTAGATTAAGCTGGCGTTCGCTGAGAATTGTAGAAATT
> TTGGCTATTCAATCCTTTGTAATTGGAAAGACTCTAACATAAACTAAGGCTAGTAAGGAA
> GTACTAAAAAAAACGGTGCATTATAGAAGTCCTGGCAAACGCTTCCTAGCTTATATTTGA
> AACGTTAAAACGCGTGGCATGATTGGTTCATAGGAAGTCTCGCTACCTACTGTGAATGTT
> AATAAAGCCTACGGCCAAAAAAGTCCCAAGCTGCACCTTATTAATGAAATCGTTGCACAG
> AGTATCCCGTGTATTTTTCTCTAAGAACAAGTTAGCGTCTGATCATAAATCTACATTTTG
> AGTGCGATGGGAGGGTGTTGTGACACAGGAAATACAGCCGTTATAGGGACTGTACACGCG
> CTGTCGAGAACTCCTTTTTTGATAAGTTGGGGTCTTATTGCTCAATCATGATTTTCTACC
> TTTTATAGAGCGTTATCAAAATTCTACCTTGAATAGTCTAAAGGACACTACTTCGCTCCC
> CTGCCGTTATAGGACACACTCTCACGCACCGTGGACCTGAAATAAGCGTAACTATCAGGT
> CACAAAAAACACATCCTTACATTCTAGGCAGAAAACAAATAACAGTCACAAAAAATTTGA
> ATAAATAATATTCCTTGTTATGTTATTCCGTGCACTACCACCAACTTTATCGACACAAGC
> CGCATTTGTACCGAGAGTTGTTTAGCTTTTTTCAGTAGTGTTCTCGTTGCGAACTACGCA
> CACGGACGCGGAGTAGTTGCTTCAAGGATGGAGTTATAGTTGACCTACGAGATTCTTCAC
> CACCTTTATGTTTGTTAGGGACGGATGACGGTAGACATACATGCTTTTCATCTTGTTGCG
> ATGTAACTAACCCTTTGTATTTACGTTCGGAGCCCGTTGATTTATGTAAACTATTTGCGT
> AGGTGCACTGGCAACTAATTTCCAGCTGTCCGCCCAGTATTATCAGAATTTACGCGCTAT
> CAAGAACTATACCATGCTAGCTTGAGGTTTCGTTCATTCCCGAAGACGGTCTAATAGTTA
> AGACTTATCAGGAACGTTATTTTTGGTGAGATGCTCCTCCTTAAGAATGCCCGATTAACG
> AGAAATATGGAGCCGTTTTTTTTATTATGCATCTCCATATGTGTCATTTATTCGATTATA
> GGTTTGTACACAGCACAAGAACGTATTGAAATTTAATGGAAGCGCAGTTAACTTATGAGT
> TAGTTTGATAGAGTACTCACAGACCAATATAGAGTGTCCGAACTGTATAAGTGATAAGTT
> GATAACTGCCCAGTATCGTGACAGTTTATTTCGATTCGCTTAATTTATTTGGATAGTAAA
> CTATAACTAATATATTCGTCTTTATTAATTGTATGGGTAAGGCCGTCAGAATCTAATCAG
> AACATTTAGTATAAATCTACTATAAACAGAAATCCTACGGATGTTCTAATTAAACCTATT
> ACGTTCGAGATTTATGCGTTTGTAACTACAAGACTTTTGCGCGGCCTTTATAAATTTCAA
> ACCGTAGAACACTGGCCAAATATTGAGCATAATGCTAGTTGAGTTTGTGGCTCAATCCAG
> TGCAAAATGCATCACACTATGTCATTAAGTTTTCGCCAAGCGGGATTCCGGCCCAAACCC
> GATTACAATTATTTTCATGCTTATTGTATTGCTGGGTTAATTTGATACGTATTTCTACCC
> TGTCACTAAATTTGGTTAACAAATAAGTTTCACCTGGTTAAGCTCCGGAGTATGACACGT
> AGTAATATTAGTTCTGTTTAGACCCTAAAGGCTAAAGATCCGGGTAGTCACGATGAGGCA
> TCACTGGTGATAGATAAACTTTTTTAAAGTTTGGTTAAACGGACATTACATAATTAGACT
> GCGAAGTGCTACGTTATCAAGCATGGGTAATGCATGTTAGACCGAATTTAGATATATATG
> AAAACGACACTATCCTAACGTGTTTGATCTACAGCAGTTAATCCGCTTCCGGCGTAATAA
> AAGAAATTCGAGCTAGTTTGATAACCGTTTATGCCATTATAGAGCACTTAGCTTAACTTC
> ATGGTATGTGAACAAAATAGCATATGTAATTTGGGGAACAGCAGACTTCACAGTGTATCA
> CCTAGGAGTTGTTAATTGTTATTTATCGAAGATAAACATTAAATTCTTATTCAGACATAC
> AGCGATAGCTAAACTTATCAGTAGAACCTCAAAATTTCAAATACTACTCTGGAACGCGTC
> CGTATAGATACAAGTACCTGAATGAACTGGTCATGACAAATTGACTCCTTGTTAATCGGA
> CATTATTCGTTGTACTAAAGTTGGAGAAGGTAGCCTAACATTGGACATTACAGGCCAGTT
> ACCTCTATGAGAGCGATTTACCGCGCCACTAAGTGGGCGAGAATGATCGTTTATGGGACG
> GAACCACATTCCGTTATCCTCTGCACATGGTGGACGCTTCGAAGTACAAATGGCCCAACC
> ACACAAGGGAGGGTGTTAGATTTTATTGCAATGTCCTCTGATAAGAACGTATGACTGCAC
> TTGACAATAAGAATTCAAAGAAGATCGCCTTTCCTTAACATTTTCTATTCCGGGGCTGGT
> TATGGCTTTATTTCTTACAATCTCAATGATGCCCGCCTACTTGACAAACACATTTGTCGT
> AACTTTAGTTTTCTAGCCTTTTCAATTTTAAATTTACCTTTTCTAAGAAAACAGCTAAAA
> TTAATGAATAACCTTCATAGCGACATTTATGTCTTTTAAACGCAGGTGTGAGGGCGGTAC
> TGTTATCACATTAGCGTGCGATGGACAAAAAGGGCCAGCAGTTGCAACCCAGTGAATGGG
> TGACATGTCTTATTTAAGTCAGTTACAATCAACTTCTTTAAAGGAGGACAATACACTGGA
> CCTCAATATTAAGGCCGGAATACGCTGTAAAGGACCATCTGTTCTATGTCAAATAACAGA
> TGTTGGTTACGGCCTAAATTAATATCCGTTTCTGTGTTTTATAGCAATCAAAAGACATAC
> AGTGTTATAGCTCATTTATCTCGGTCGCCTTCATCGAAAAATTGCAAAGGTATCTCTACC
> TGGATTCGTGTTTGAAGGACCCAACCCATGTTTCGACATGCACTGTTTTGATAATGCACA
> GCAGCGAATCTTGTGGATTGAGTGGTAAATCTCCTACGGGTCATTTCCATCAATACGTAC
> TATTAAACAACTTTAATAGTCTATCTACCCTCTTCACGGAGGTATGAGTGCCTTGAACTT
> ACTATATGAAATTCATATTACGCAACGAAAAGGGAAGTAAGGTACAAAGCGCTTCCTAGC
> CGGCTGCAACGAGTGAGTATCTAGAGTCTTGTAAATTTGACTATAGAATTTCTATGATGT
> AAATATCGATTAACCGCAAACCTTTAAAACCTACATGTATGGTCCTTATAACGAACGTAG
> GGATGCCATGTTGGAGAAGGCGAAAATTAACTCGCCGAATCATTCCTTCTATATTTATGT
> TACAGACGCATTCATCGAAGTTAGGATGAATCATATCTTGGTTGAAGAGCGCTTTGAGGC
> ATGTGGCAGAACACATGCTTGTGCCTAAACTTCACTGGATATGAAAATTAACTTCAATGG
> TCTCTTTCGAACCGGATTACGGGCTACTCCGTGGAGGAAATAAAGGCTTTAATTCTTTAG
> CGCGAGCGTTGGAACCACTTGGTTTAAGATACACTTGAATATGGAGGCAGGCCGCACCCA
> CTCGGGCCACTTATTTCTCTATGAGTGTAGCCAGAACTCCCAACAAATGTGCTTTCATTT
> TTCTTGTAGCAAATAGATGTAGCTCAACCGGATCCCGGCCTCATAGCTCAAACAGCTCAG
> TCGAACAAGCAGTTACAAGTCGTGATTGGGAAGTTATATAAAACATATGAGAGTTATTGA
> CGACATAAAGATATATGGTTTAAATTACCAGGTTCGAGTTTTTCGACAAAAAATTCATGA
> TGGAAGACTCGTGTATTTTTTATCTCATTAGACTAAAGTGCTTATGTAGCCCATGCATTG
> ATTCTCTAGTATATTCTTCCGAGAAACCGGTAAAGTTGTAAGGGTAAGTCTTCACTACCA
> ATCACATCATTTAGCTCCAAGACCTATTATTCTACATACAATATAACGTTTTACTTCGTT
> GATCATTACGGTACATCAAATTTCAAACTACTAGGATACGGCGATCAGTTTAGGTAGATA
> ATGGTTCTTAGCGGAATATCTTTAATCAATTAAATGGTTAAAACCATGAAGCGGGTATGT
> ATTGATCACTATTTTGTGATTTAGTATAGTTGACTACTAGATGGTTTACATCGTTTAATG
> CAAGTATGACAACCCAATCCACGCGGTTGAATAAGCCCCCACCGTATCAAGAGGGAAGGG
> ACCGTATAACGATTCTTCCAGCGCAAGTCACCACTGGCAAAACGAATTAGCTGATGAAGC
> TACTATTGTGACCGGATAACATCATGACGATCGCTATCATCATATCTATAATGTTCTTAG
> AGTGTTGCTAATTATATGCTCTTTGGCTGCTGCCATTACACCTGATTCATCTATCTTTTC
> AGGGTTCTTCAAAGTCATGACTTTTTTAATAACCATAGGTGCGGCAGAAGCATATTCATA
> AAAAATAGTCGATTGTAGACGCAAGGGGACTTACCCAGCTATTATTCCTCCAATCCTAAT
> GTTGGGATAATGTAGTTGAAAACCTAAACTATTGAGACTTAGAATATGTAGCCAAAATGC
> TATGTTGATGCAAATTTGTTCTTGGAGGATGGTAAATCCGCGGAGTTTTTGGTCTGTATC
> TGACCACAGAGAATTAACATCAGAAAAGAAGTAACTGATTTGTTCCGGACACCAAAAGGC
> TGTCTTTTCGAGTTGGATATTCGAGCAAGGGGGTTGAACGCAGCGGAAGTTTATGACTTG
> GCCAATTATCAGATTCCGTAGAACAACTATTGGTGTATCATAGAAGTGGTAGCTTAGAGG
> AGGCATGATGAACAACTCTACCGCGAAGTTAACTATGCGGTGTATTAAATTCAGGCCTGA
> ATAACAAGAATTTAGACATATCCACTGTGCTTCTTTCCAAATTAGTTGCCGCCTAGTTTA
> AAATACTGAACAACTGCTTTAAACGTCACAAAGGGTGGGGTACGTAAGAGGGGCGTCAGA
> CAACTGGTATCGGATTATCTGTATATACAATATCCTGAGACTGTTTGAAAACCATAATAA
> CGTGTGGTTCAACAATATCAACTCAAAGTGATGGGACCACTTTCTACGTCCGATCGGCCT
> TCAGGTTGTTCATCCTTATCTATTTTGACTAATAATTATTGAATTGATTTGGAAACGTAT
> CCTATGGATAAAGTTTTATTAAAGCAGATCATATATGCTTCACATTCATTCAAAAGTTCA
> GTGAGATCTTATACGACTTCTATTTTTCTAAATCTTATCGGATACACGCTCTCATAGACG
> ACATGTGAGCTACAATTTGATTTCACAATGATAGACATGATCGCAAGCACTCCCTGTCGT
> CAGACTCTTCCTGTTTATATGATGGAAGATGTACCCAAACATTAATGCGTTAGACCATAG
> CTGCAATGATGTTCCCATACCAAGAATTCGAACATGTTTTACTGAATTGTTTCTTAGGTT
> CTTAATCCGTGCTATGGGATTGCAAGTATGATTTTTAGCACTAGGATAGGAAAGAAGTAA
> CCTGCAAATGATCGAGTTGAGAATGCTATGTTAGAATGTTCTCCGTGTATGTGGCTCGGA
> CCTGACTGGTGTATGGCACTCGAGGAACCCTTAGAGGCGTAAGGTTACTCATTGTTAAAA
> GTCCCATTTAATCTACTTTTAAGAAATTCTTTGAATAGGATGGCACCATCGGCAGACAGG
> AAAAATGTAGGAATGCATTAGATAGATCCGTTCTTTGGGAATTCCGACTAGAAACTTCCA
> ACATGTTTATAACTTGCTGAGATGTGCGTCGTAAATAGCTTTAAAGGAAGTTTGTTTCTT
> GCAGAGGAACAGGACAGAACTTCAAGTCCAGAGAATTATAGCTTACGATTCACTTTCGCA
> TGTGCTACGCCGGCCAACTCTTATCTATCTTTTTTTTAGACAATCAACATTTAAACTTTA
> GTTTGCCTATAGTGAGTGGGTGTAAGATATAGCCTCCAGGAAGACATAACTCCTGGGGAG
> GCAGCATTTGTGTTATTGCGGATGTCCTATATTACTGCCTTGAGAAAGTTCGTTTAGGTA
> CGGTATCCAATAATCGTTTCGGTGATGTTAGAGTAAAATCCTAAGTTCCCAAGATGTCTC
> AATTAAACCCTCTTACTGCTGTGGAATTTATTTGTATGTATCAGAGGCTGAAGAATGGTG
> CAGCAAACTGATTATATAGAGCGCGTTACTGCCTCCAAACTTAAGAGAGAGTTATAATTA
> TAGAGAGTATTAGGGATTGAAAAGTCCTATCACGCTGTCCTGAGTATTCCTATCGATGAT
> GTTGGCGCGAACTCTACTAGCATCTAATATAGCTCATCCTATCTTATTGGCGATTTTGAT
> AAAAGACATGTATATGAATGTGAAATTGATAAAGTAGGAACGAAATCACAATACGCTGCC
> AATACTTTCCGCTATCCTAAAGATCCATGGAGGCAGGTAATGATGCGCGTGCGTACCTCG
> TTAAAGATAGTGTTATGATTGATCTTCTTTCTCTGAAGAAAGGGTATGCTTTCTCACCAA
> GATTGGCGAAATTGATACTCCGAAGATTGAATACTAACACCCTGTCTATTTTCACCGCGT
> CTCATGTGTTTGTAGGGATTCTTCTACGTTGGTTAGGGATCTTGCGTACTTCTGCAAATG
> ATTTGACAATAAGGCCATCTTAAGGATGCTGTCTCGAGAGCGTTACCCTTTAATGAAAGT
> ACTCAACGGTTGCGCTGTGTAGGGTCATCTCTCTCAATGTACGTTTTCCTGTATATTAAT
> CTATTGTTCACATGCTAGCATATAACTCGTAAGCATGTAGGAGTCTGAAGAAGCTGTAAT
> AAGCCTGTAAAGAAATCTTACAAAATGAACTATGGATACTCTTGGGCCCCTCGATTATTT
> CAATAAAACGCGAAAATCCGTCTAATGTTGCGTAGCCTCAAGACAAATTGTGAAGTATCT
> CTAGCTGGAAGATTGTGATTGACAAAATTGCCCTCACTGAATATTTTCTTGTAGTCTTTA
> AAGGTTTACCGGTTTAATCAATGTGAGTTTGAAACAGATAAAGTACTTTCAGCTATACAT
> TGCATATCCTATGCATCAAAAACTAAAGTGCTCGAACCAATATGGCCGATACTCACTCAT
> CTAAGAATCCCATCTGCAAACAGACGACTAGACAATTAACCTGAAGTTGGCGTTATCTAT
> AGTTTAGTTCGGACTAGAGGTCGGTATATTCTATTAAGGAATCTAATCTAGCTGACGTCC
> TGACTCGAGCTCAAATGCGACGGTATACCTACATGTCGAAATACACTGCGGTATCGGGGC
> ATGTATTGGATACGCCTAAAGACGACATAAGCGATTGATTATTATCCGATCACGTTTCTG
> TGCACCGAGCATGGAACTGTATATACAGCTATAATCTTCTTGACCTGAAACCTGTGAAAT
> TATGGTAAAGTACAGCCGATAACAAACTGATTATCTAAGAATCTACATCACCAGGCGTCT
> TAAAGTAAAATTACAAGGCGTTGAATATACGAAAGTTGATGAAGTTCGCTGGGCTCGTCG
> CAAACACACAACTAGATGTCGCAACCTTGATGAGCTACGTTGGCGGTAATAAGTTCACCG
> TAAGTGCATTGAGAAAGACTTGTGTTTCATCGGTTATCATCTGGACTACTCTGGGGTATT
> CAACATGATTACGGAGAAAGCGGATTTATTGGTAAACGATGTCTAGAGGATTACGGGCCT
> TATAATTGGTTATCCATGGGAGTTCTGTCGCTGTCGCTTCGTTAAAGATACGGACTACAT
> GTCCTCGCGTGAGCTCGTGGTTGAGCCTGTTAATGGGATCCCGACAATACTAGTGCCATT
> TGAGGATGTGACTGAAAAAAAATAGGCATCACGACGGATTTGCCCTATTAGAAGAATTTC
> CTATAAGTTCAATACTGTCCATAGCATTGATGCTAGGGGATGAAACTGTATACTAGCCGT
> CATAAGTATGCGGCTTTTGTATAAAAAACTATTCAATCTTTTGAATAGACAAAAGTAACA
> ATCGGTTGTATCATGCTATAAGTCAGCACATTTTACGCCTTGAGAATGTTCAAAGCAATA
> GACGACTCGTTCTCCCGAAGATAGATATCATTATATTTAGTACTATTCCCCGGTGTTACC
> TTGTATTTACTACTAATAGTGAAAGTACGACGTAAACCACTTCGTCCGGTTAATATTTGT
> CCTGAGTACCATCTCGTCCTCACTCCCTGCCTACACGACGGTAATCACTTGAATAATAGA
> TTTACTACCCATGATTCTGCCTCTTTGGTAATCTTATTATAAGACTAATCATCTTTTATA
> CAGCGGTTGAGAATGACCCAATGCTTCCGTGGTGTAGTCTGTATTTCTAATATGTAAGAG
> CGGCAGTCATTCCGAGTTTATACGTGTGCGTGTTAGGCGAGATGAGTCGCTAATAGTATA
> TCTGAGCACGACAGCCGTATTTCACGCATGACGGATGAGAACGTTTAACTAATAACGGTA
> TATTGCGACGTATCAAGAAAATTTACTCAGGACATGTTATGATCTATCGTTTAGCACACG
> CAGAGTGATTTAAGAGTGCTCCAGTCCATAATGACACATGCTCCACAGCGCTCTCCTACG
> TATTGGGCGTCCTGAGCTCTGGTTTACTAAACAAAGACTATTCCGTTGTTGAGTAGTAGA
> AGAAACCCCATCCGAAATTGCGCTAGGAAGGCTCGATATACCAGCCTATAAGTTTTATAT
> CGGTTACGTATAAAGGTCGACCATATAGGTCCGGAGTGGAGTTTTCAATCAGCCGTATTA
> GTTAGTGAATCCAACTTATCGATTCTGAAATTTTCGTTGCTCAACTTATGAAAGAAAGTC
> AGTCCGAAGCCTTAAACACGGAGTACGTGTCATGTATCAAGAGCAGGAATTAACAATAGA
> ACACCTTCAAACTCACAGTACATATTAAATGTTGGGGGCCCTATGAGTCTAATTCTTGGA
> CTCCAACGTTATGAGTGTTCTTCTGCTGTATATCCTCAGAGATTGCGTATTTAGACTTCA
> AAGCAAGATGGGAGGGACTAAGCTAGTGTAACTGGAGACTCATTTGTAAAGTTACTTCCT
> TTGTGTCTTTATCATTATTGTAATTACATAGGCTGGTACGTACCCTTGTGAGTTAGGAAA
> ACACATAGGGAATGATAGTAAAGCTAGTACCGAGTCTTGATCCTTATTACGGGTTAGAGT
> AATCCTTAGTAGACAACTAAAATCTCAACTGCAGTAAATTTAATACGGAAGACACTAGTG
> CTCACTTTCGGGTGTGGGTGCTAGGATCGCCTAGATCAGGGTGCGAATAAGTGTAGGGTC
> GCTATGTATATATTTGAGTCTCATTTCTTTTTGTAAATATCGTCGGGATTTATAGCTACT
> ATACATACGTCTAGTTAGCAAAGTGTTCGTATGCTTTAGCTGAACATATGTCCCCTGGTT
> TAGATAAACCGCACATGCGAACGGATCCGAATTCCCGTAGAGGAATCAAACATAGATTCT
> TAAAAGCAATTATGTCGTGAGGGGGTGTAGAGAAGACTGCTAAGCTTCTGATCTAAAATA
> TAGAGTCCGTAAAGTATGCACCATATGTCTCTCACCCCGTCAAATTGATGACTTCAAGCA
> AATAGTACGTAGGTCAACCAATCTTTCCATTCAATAGTTCAGCAGAATAGAACCAGAAGG
> ACCTTTTTTCTATTTATAACGTCTCGTTTCGAAATACACTGTCACATACTTAGTGGGATG
> CTCTGCCTTCCTAAACTTCATCATGCGTTAGACTCCTATCCATTGGAACATCTCAAACGG
> CTAAAGATTAATGTAGCGTTCAACAGGACACCCTAAGGTAGTATGACGATAATAGATAAG
> CATCACATGTAGGTAGCTTATTTTATCCAGGTATGGCACAATCGGCAATTGCCTAGATAA
> TACAATCTGAAGTAGGAACCCCGATCTATTTCCCACTGAGTAGTGTACTCTCGATGCAAC
> CATAAGAAGGAGGCTGAACATCAACTTTACTTTATCGTTTTATAGAAGTCGAGATGGACT
> GGTTAACGGATCAATTTTCGCGGCTGAAATTCGTTAACGCAACCACAACCGGTAAAACAA
> ATCTATACATGGCGCGCTACCAGTAACTAGTTTTATAGTTACAGTCGTAATATCCGGGCC
> CTTTTTTTCTACGCTGCTTTCCTAGGCCGTAATGATCTCAGTCATAGTGGATTATGTAAA
> GCTACACTTACATATAGTGGACAAATAGTGGCACTATGAGGCATTCTCTGTTTTCACTTA
> CCTAGTTCAAGTTTACTGTTGTCGAAATAGTAGATCAAGTTTTTCGGGGAATGGTAAAAG
> CAACTAGACTACCAACATAAACTAGTATCGATTTACAATGTTTGCACAACTGTGATATCT
> CTACCCCGAACAAGTCTATAATATGTAATCGTTTAAGATGGAAGGATTTACGAGCTTCAG
> GCGATAGACGACCCCAAGATTGGGATTGTTGTCCAAAATTAGAGTGAGTATCTAACAGCT
> ATCTGTAATTCGACTAGTAACCGGGTAATGCAAAGCGATTGTCGATTTTGTACATTGGAG
> ATCGTTAATATGGGACTTAACCTATAGCCCAATCACAAGGCTTATTGTAAAGAGCACGTA
> GTCCGCACTTAATTGTTTTGCACTAAAATAAACCTATTATTCCTTGCTTCGTTTAAATCG
> TCACTTGGAGCATAGTGACGTATAGCCGTTCTGAGCAGTATAGAAGATAGTGCATGCAGG
> TGAGACATTAAATAGCAGATTTTCAAAGGGTTATGTGTTCGAAAACTGAAAATTATATTA
> GACCTACAGTTATGAGACAGACGATAGGGTTAGCACGAGGCGGTTGAATCGCATCCCTTG
> CATGGTTCACTTACGCATAGATTAACTGCAAAAAATCTAATTGAAAGTCTCTAAGGCGGT
> AGAGGAGCATTTTCAAAGTACAGAATATAACTCTGGTAAAAAGTTTGTTCATTATACTTA
> CGTAGATCCTTATTAAAAACCTGTGCAATTACAAATATCAATGAACCTGTTGAACATATG
> TTTTTAATTATGGCTTATAAACAATTGTCTTAATAAGCGAAGTTGCTAGTAAACACGTAC
> GCACTCACCCTTTAATTTTTACTTATATGTTTAAAGATGGGTTTGCTCTAGCGTCTGTAA
> ATCAAATCGTGGTTACGACGGTAGACTCGTGCTTGGGAATTGGATAAGCTATGCAGCTCT
> ATATTTCAAGCTTTAATTTAATACCACGAGGTAGTAGGATAGGTATCTGCTATTGGAAAA
> TGGAGGGATTTATCCGTACAAGGTTCGGCTAAAACTACCACGAGGGTTCGATTTTCATAT
> GGAGTGTTTGTATAAGCCACATTTGTTGTATTTGTCAACATCCTGGGGACTTTATGCTCC
> CCGTAGCTGAGAATTCTTCTAAGTTTGCAGATGAAAGAATTTCTATGGGGTAAGACTCTA
> ACAGTATATAACGAGAGTATGCAAGGACTTATAAAAAACCTGATTTATTCAAGTACTGGC
> ATAACATTCATAGATTATATTTGATTAGTTTAAACGCGTGCCATGAGTGGTGCTGTGGAA
> CGCGAGATACATAAGGGCTAGCTGAATATTGCATTAGGCCTAAAAAGGCAAAACCGGCTA
> ATTATTATTCTAAGAGTTGCACTGACTAGAACCTCTTTGGTTATATATCTAATACTTAGC
> GTAGGATCATAAATCTACTTGGGGAGTGAGTGCGCTCGGTGGTGTCACTATCGTAATACA
> CCCCTTAGTGGCTCTGTACTCGCGATCTCCTGAAAGCCTTGTGTCATTACTTCGCGTATG
> AGTCATAAAGCTTGATGTTATACAGTTGATACTCCGGTATCAAATTTATACCTTGTTTAC
> TAGTAACCAAACGTATTAGATCCCATCCCGTTATAGGACTCAATAGAAACCACAGGCGAC
> CGCATATTAGCGTAACTAGAAGGTCAAAAAAAACAAATCATTAATTTCGAGCCTGAAAAA
> AAATAAAAGGCAAAATTAATTTCAAGTAAGATTATGACTTCTTATGTTTGTACGGGCACT
> TAAAACAACGGTAGCGTCACATGCACCATTGGTACCCACTGTGGTTTACATTGTTTATCT
> ACTGGTCTCGTTCAGAAATAACAACAAGGAACCGGAGTAGGTCAGGAAAGGATGCAGTTA
> TAGTTCACAGTCGACATTATTAAAAACCTTTATGTTTCTTAGGGAAGGATGACGGTTCAC
> TTACATGCTTTGCTTATGGTTCCGATGTTACTTAACATTTCTTTTTAAGGGAGGACCACC
> TTCTTTTATCGAATCTAGTGGAGTAGGTGCAATGGAAAATAATTGAATCCTCTCCGCAAA
> CTATTATCACATTTTACGAGAGAGCAAGTTCTTTACAATGCGAGCTTGAGCTTTCGTGAA
> TTACAGTACTCGGTCTAATAGTGTTGTAGTTTAAGGTACGTTATTGTGCGGGTGATGCTC
> CTAAGTAAGAATGCACGATGATCGTGTTATAGCGAGCAGTTTTTTTTATTATGCATCTAC
> TTATCTGTAATTTTGTCGATTTTACGTTTCTTCAAAGCAAATGATCGTTTGCAAATTTAA
> TGGAACAGCAGTGAAATTATGAGGGTGGTTCATTGAGTAATAAAACAACATTTGAGACTC
> TCCCAACTGTATTACTGAGATGTGGAGTACTGCCAAGTTTCGTCAAACTTTTGGGCGATT
> CGAGGTATGTTGTGGGTTTCTAATCGTGTAATAATATATTCCTCTTTATGATTTGGAGCC
> CTATCGCCCTCAGAAGCTAATATCATCTTTTAGTTTAAATATAATATAAACTCAATTCCT
> ACGCTTGTTCTTAGTAAACCTTTTACGTTACAGATTGATGCGTGTGTATCGACAAGTCTG
> GTGCCACCAAGTTTTAAAGTTATAACAGTAGATAAATGGCAAAATATTCAGCTTAAGGCT
> AGTGCTCTTGGTCCCTAAATACTGGCCAAAAGCCAGCTAAAGTTCTCATGAAGTTTGACA
> CTACCGGCATTACGGCCCTTAAACCAGGACAATGATTTGATTGCGTTTTCTAGTGCGCCG
> TGATTTTGAGACGTATTTAGAACATGTCAATAAATGTCGTGAACAAAGTACGTTCACCTG
> GTTATGCTCCCGACTATCAATAGTTCGATTATGTGTGCGGTTGTCAACATTTAGCCTTAA
> CATACGCGTAGTCACCATCAGGCATATCTGCTCATAGATTAAATTTTTGAATCTTTGCGT
> TTTCGGACATTTAAGATTGAGAATCCGAAGTCCTAAGTTTGCAAGAATCGCTAAGGCTTC
> TTTGTCACATTGTACATATATAGCAAAACGACACTATCATATAGTGTTGCATCGACAGCA
> GTTATTACGATGCACCCGTTAGTATAGTAATTAGACCTACTTTGATAACCGTTTAGGCCA
> TTTTAGAGCACTTAGCTTAACTTCTGGGGATCTGTACTAAATTGAATATGTTTTTGGCCG
> AACTGCTGACTTCACTGTCGATAACATACGAGGGCGTTATTCTTATTGTTCCATCATAAA
> CATGAATGGCGGATTCACACAGAAACCCTTTGCTAAAATTTTCTGGAGTACCTAAATAGT
> TCAAAGACTACTAGGGAAAGACTACGTTGAGAGACATGTAACTCATTGTAATCGTCTTGT
> AAAATGGAATCCTTCTTTTGCCCACATTTTTACTTCTAATAAAGTTCGAGTACCTAGCCG
> AAAATTCGTCATTACAGGCAAGTGACCTCTATGTGTGAGATTGTACGACCATCTAACTCG
> CCGAGATTCATAGTTGATCGCACCGTACAAAAGGCCCGTATACTATCCACTTCGTCGACG
> CGTACAACTTCAAATCGACATTACAATCAAGGGTGGGGGTTACTGTGTATTGCATTGGAA
> TCTGATTTCATCCTATGTCGGCAATTGACAAGAAGAATGAAATCAAGATACCCGTGACTG
> ATAAGTTTCTATTCCGCGCATCCTTTTGCCTTTTTTTCTTACTTGCGCAATCATGACCGC
> ATTATTCACAAAATCATTTCTCGTTACTTTACTTTTCTAGAAGTTTCAATTTTAAATTTA
> CCGTTTCTATCATAACAGCGAAAAGTAATCTATTACCTTCATAGCGAAATTTTTGTATTT
> GAAAAGCAGGGGTCACCGCCCTACTCGGATCAAATGAGAGTGCGATCGTCAAAAAGCCCC
> ACAAGTTGAAAACCAGGGTATGCCGGTAATGTCTTATGTAAGGAAGGTAATATCATATTA
> TTTAAAGCAGCTAAATACAATGCAACTATAGTGTATGCCCCGAATTCGATGTATACCACC
> ATCTCGTATATGTATAATAACTCATGTGCCTTTCGGCCTAAAGTAATTTACGTTTCTCTG
> TGTTTTTCCATGAAATACACATTCACTGTTTTAGATCTTTTAGAGAGGTACAATTCTTAG
> ATTAATGCAAAAGCGAGCTCTACCTGGAGTCCTCTGTGAAGGTCCCAAAACATCGGTCCA
> CAGGATCTCGGTTGATAATCCAAAGAAGACAATCTTCTGGATTCACGGCGATATATACGA
> CCGGTATTGTAAAGCAAGTAGTTCGTTTAAACAACTTTTATACTCTTGCTAACCGATGCA
> CGCAGGTAGGACTCACTGCAACTTAATTTTTGAAAGTCATATTAAGATACCAAAACGGAA
> GTAAGCGTAATAGCCCTTCCGAGCACGAGGAATACACGGTCTTGAGACAGTATTGTTAAT
> TTGACTTTACAATTTCGATGATCTTAATATCCAGTTAACCCAATCATTTTAATACTACAT
> GTATGGGCATTATAACGATACGTGCCAGGACATGTTGGAGAACCAGATATTTTACTCGAA
> GATGCATGACTTATATATTTATGTTAATGTAGAATTAATACATGTGAGCATCAATCTTAG
> AGTGCGTCTACAGAGCTTGGAGGAAGGTGGCAGAAAAAAGGCTGGGCCCGAAACTTCTAT
> GCAGATCAAAATGAACTTCAATGGGAGATTGAGTAACCGATTAAGGCATAAGCAGGGCTG
> GAAATATTGGCGTGTATTATTGTGCGACAGAGTGGGAAACTCTTCGGTTAAGATTCAATT
> CAATATCGTCCCACCACGAAAAAACTAGGGAAACTTATTTATATATCAGTCTTGACTCAA
> CTAAAAACAATTCTGAGTGCTTTTTGCTTGTTGAATATACATGGACCGCTACAGGATAAA
> CGAATCTTAGCTAATAAACATAACTCCTACAAGATGGTTCAAGTCCTCATGCGGTAGGTA
> GATAATAAATTTCAGAGGTAGTCTCGACATAAAGTGATTTGCGGGTAATTAAAAGGTTCC
> AGGTTTGACACAATAAATTAAGGATGCAACTATCGTGTTTTTTGTATCTAATTAGACTAA
> AGGCCTTATCTAGAAAATGCATGGTTTATCTAGTTTATTCTTAAGACAATCCGGTAATGG
> GGGATCGCGAAGTCTTATAGACAAATCTAATCAGTGTGAGCCTTGTAATATTATTATAAA
> TTAAATAGTTAGTTTTTATTCCTTGAGCAGTAACCTAAATAAAATTTAAAACTACGACGA
> TACCCCGAGCTGTTTAGGGTCATTATGCTGCTTACCGGTATTTCTTGAAGAAATGTTATC
> GGTAAATAAAGGTACCGCGTATGGTGTCTTCACGATGTTCTGATGTAGTTTAGTTGAAGT
> CTACTTGGTTTAAATACTTTTAGGAAACGATCTCAACCCTATAATCCCCGGGCAATATCC
> CCACAAAGTAGCTACAGGGAAGCGACCGGATAAAGATTCTGAATCACCATCGAACAAAGC
> CCAAAAAGAATTAGATCATGAACAGACTATTGTGACAGGAGTACTGCAGCACGATCGCGA
> TCAGAATAGCTAGTTGGGGATTAGTGTCTTGCTAATGTTTGGATCTGTGGATGATCCATT
> TTCAAATGAGTCTTCTATCTTTTCACCGTTATTCAAAGTCTTGAAGTTTTTATTTACAAT
> AGGTCACCAAGATCAATATTAATAAAAATTAGGAGATTGGAGACGCAACCGGACTTAAAC
> ACCGATTATTCATCCAATCCTAATCTGCCGATATTGTAGTGGAATACCGAATCTAGTGAG
> AATTAGAATAGGTAGCCAAATTGCTATCTTGATCCAATGTTGTTATGCCACGATCGTATA
> TAACCGCTGTTTTTCCTCTGTATAGGACCACAGTGTATTAACTTCTGAAAAGAAGGAACT
> CATGGGTTACCGACAAATAATGGCTCTAGGTTCGACTTCCATTTTAGAGAATGCGCCGGG
> AAACCAGCGGTTGTTTTTGAATTGGCAAATTATCAGATGAACTAGAAAAAATTTTCGTCT
> AGAATACTAGGGGTTGCTTTCACGTGCCATGATCAACAACTCGAACGCGAACTTAAATAG
> GAGCGGTATGAAATTCACGACTGAAGATCTACTATGGAGACAGATCCACTGTCCTTCGTT
> ACATATTAGTTGAAGCATACTGTAAAATAATGAACATCTCAGTTAAACCGAACAAAGCCT
> GCCCTTAGTAAGACGGCCCTCTGAAATCGGGTATCCGATGTGCGGTATTTAATTTAGCAG
> GTGAATGTTTCTATTCAATAATAACCGGGCCGTCAACTTGATATACTCAAAGTGATCGGA
> ACAAGTTCTTACTACGATCCCCATGCACGTTGTTAATCCGTAGATAGTTGGAATAAGAAT
> TTTTGATGTGATTGGGAAACGGATCCGAGGCTTAAAGGGTTATTTTAGAAGTTAATATAT
> CAGTCAAATTATTGAAAAACTTCACTCTGAGCTGATACGAATGCGAGTGTTATTAATCTT
> ATCGGTTAATAGATCTCAGTCACGAAATGGGACCGACTAGTTCAGTTAAAAAGGATACAA
> TTGAGAGAATGCACGCCAGCTACTCAGTATATGCATCTTTTTAGGATGCTAGATCTAACA
> AAACATTTATGAGTTTCACCTTAGCTCCTATGATCGGCCCATACCTAGAATTAGAAAATG
> TTTGACGGTTTTGTGTATTAGGTTCTGAATAACTGCTATGCGAGTGCTACTTTGATTTTT
> ACCACTAGGAGACGTAAGAACTAAACTGCATAGCATCCAGTTCACATTGATATGGGAGAT
> TCGTATCCGTGGAGGGCGCTCGCAAATGTCTCGTCTATCCCAATCGACGATAACTTAGAG
> CCCTAACCTTTCTCATTCTGTTAACGACCTTTGAATATACTGGTAAGTAAGGATTGGTAG
> TGCAGCGAAAAAGCGGCACAAAGCAAAAATGTTCCAAGGCATGTGTGAGATCCCTTATGT
> CCCAATGCACACGTGATACTTAAATAATCTGTATAACTTGATCTGATGTCCGTCGTAAAT
> TGCGTTATACGATGTGTCTTGATGGAACACCAACAGGACACTACGGCAACTACAGTGATG
> TATTCCTGACCAGTCAATGTACCAGGTCATTACACGGCAAAATCTTTTCGAGCGTTTTGT
> TTGACATTAAAATTGGTTACGTGAGTTTGCCTAGAGGGAGTCCGTGTTTCTTAGAGACGC
> CACCATGTCATATCTCCTGGCCACCCACCATTTGTGTTTGTCCCGATGTCATATATTTCT
> CCATTGTGAAAGGGCCGTTAGGTTAGGTATCAAATAATAGGTGCCCTGAGGTTAGACGAA
> AATACTATCGGCAAATGATCGAGCATTGAAAAACTCTGTCTCCTGTGCTATTTATTGGGA
> TCTATAAGTGGCTGTACAATGGTCATCCAAAAGGTTTATAGAGAGCGACTTACTGACTAC
> AAACTTATCTCAGAGTGTTTTGTAGAGTCAGTAGTACGCAGGCTAAAGTAATTGCACGCT
> CGAATCAGTATTCATATAGATGATGGTCCAGAGTTCTCTACTAGCATATATTATAGCTCA
> TACTATCTTTTTGCCGATTTTGATTAAAGAAATCTATATGAAGCTCAAAGGCATTAAGTA
> GCTTCGTTAGCAAATTACGCGGCCAATACTGTCACATATCAGAAACATACATGGACCATC
> GTTATCTTCCCCCTGACTACATAGTTAAAGATACTGGTATCATTCAGCTTATTTCTATCA
> TGAATGGCTATCATTTCTAACCAAGTTTGGCGAAATGGTTACGAAGAACAGGCAATAATT
> TCACCCTGTATATTGTAACAGCGTATCTTCTCTGGGTACGCTTTCTGCGAAGTGGGTTAC
> GGTTCTTCAGTACTGATCCATTTGAGTTCACATTATCGCAATCTTAAGCTTGATGTCGAG
> TGAGCCGTACAATTTAATGAAAGTAATCAAAGGTTGCGCTGTGGTCGGTATTCTCTATCA
> ATGTTCGGTGGCCTGTTTTTTAAGCTATTCGGCTCATGCGACCTTATATCGAGTTACCTG
> CTACCACTCGGAAGTAGCGCTTATAAGACTGTAATGATTGCTTAATTAATGAAAGAGCGA
> TTCTCGGGCCACAATCCATGTTGTCATTATAACCAGAAATGCCGTAGAATCGTCCCGACC
> CTATAGACTAATTGGGATGTATCGCGAGCTCCAAGTTGCGCATTGACAAAATTCAAATAA
> AGCTATAGGGTCTTGTTGTCTTTAATGGTTGTAACCGTTTATAATTCGCACTGTGAAACA
> GATTTAGTACTGGCACCTTTACATGGCAGATACTATGATTAATATACTAAAGTCAGACAT
> CCAATAGGCAAGATAATATCGAATATAAGAATAACTGCTGAATACAGAACTATAGTATAT
> TAACCTGAAGTTCGAGTTTTAGAGTCTTTTGTTCCGACTAGACGTCCGTTGATGCTTGTA
> AGGTAGATAATATTGCTCTCGTCATGTCTACTGATCTTAGCACACGGTATAACTACAGCT
> CCAAATACACTGAGGTATAGCGCAATGGATGGGATACGACGAATCAAGACTGAAGAGAGG
> CTTGATTATAAGTTAACCTTTCTGGCAAACCACATTCCAACTGGATATACAGCGATTATC
> GTCTGGTCATGTTAAATCTGAAATTATCGTTAACTAAACCAGTGTACAAAATGATGATAT
> AACTTTAGTCAGCTCCACCAGTCTGAAACTAAAAGGTAATGGACTTGAATATACGATAGT
> TCTTGAAGTTCCCGCGCCTCGTCGAATACAAACAACGAGATCGCCAAAACTTGTTGACAT
> ACGTTGCCGGTTTTATCTGCAACGTATCTCCTGGCACAATGAATTCGCTTGCATCGCTGA
> TAAGCTCGACTACTCTCCGGTATTAATCATGTTTACCGTGAAACCGCATTGAGTCCGAAA
> AGATCTAGTCTGGATTACCCGCATTATTATTGCTTATACTTCGGAGTGCTGTACATGTCG
> CGTCGTTTATGATACGGACGACAGGTACGCGAGGGAGCTCCTCGTTGACAATCTTTTGGG
> CATCAAGACAAGACGTCGGCAATTGGAGGATCTCAATCATATATAATACCCATCACGTAG
> CAGTTCAACTATTACAAGAATTTCATTTATCGTCTATTATCTCATTACATGTGAGGATTG
> GCCTTCAATCTGGTTAATTCCCCTAATAAGTAGGCGCATTTTGTATTTAAAAATATTCAA
> TCTTTTCATTTGTCAATACTTACAAGAGCTTGTTTCATGATATAAGTCTGAACATTTGTC
> GCCGTCACAATCTGCATAGCATTAGAACTATACTTCGACCGAAGATTCAGTGCATTATAG
> GTACTACTAGTAACCGCTCTTACCTTGTTTTGTCGACTAATTGGCTTACTAAGACCGAAA
> AATCTGCGTCCGGTTAAGAGTTCTAATGTCTACCTTATACTACTCTATCACTGACTAAAA
> GACCCTTATCAATTCAATTATACATTTAATACAAATCATTATGCATCTTTGCTAATATTA
> GTATAAGAATAATCATATTTGTTACACACCTGGTCAATCACCCAATGCTTCCCTGGTGGA
> GGCGCGATGTCTAAGATGTATGACCCCCTCTCTTGCACAGGTTTTACGGGGGCGTGGTTC
> CCCAGAGGTCTAGCTAATAGTAGATAGGACCAAGTCACCAGTATTTAACGAAGGAAGGAG
> CACAACCTTTAAATATGAACGGTTTAGTGCGAAGTATCAACAATATGTACTATCGAATTG
> GGTTGTGCTATCGTTTTGCACACCCACAGTGATTTAAGAGTCATCATGTCAAGAAGCAAT
> AATGATACACAGAGATCTCCTTCGTAGTGCCCGGCAGCAGATCTGCTTTTAGAAAAAAAG
> AATATTCACTTGGTCAGTACTACAACAAACCCAATCACAAATTCACCGAGGATCCCTACA
> TATTCCAGCCTATTAGGTTTTGAGACGTGAACTTGAAACCTCGAAAAGTTAGGTCCGCAG
> TGCTGTGTTAATTCAGCACTATGAGGTAGGCATTCCATATGAGCCATTATCAATTTTTCG
> TTGATCAACGTATCTTTCAAAGGCACTAAGTTCCCTGAATATCCGAGGAAGTGTAAGCTT
> GCTTGAGCTCGATTGATCATTACAAATACTTAATACTCAAAGGACATATGATTTCGTGGC
> CGAACTATCAGGCGTATTCTGCGACGCAAACGGGTGCTGTGGTCGGCTCATCTAGTTACT
> CTCACATTCCGTTGGTTCAATTCTATGCAACATGCGTCGGAATAAGCTAGGCGATCTGGT
> CTATCATTTGTAAACGTACGTCCTTGGGGGCTGTTTCATTATTCTTAGTAAATTCCAGGG
> TACCGAAACGGGGGACTGACCTTATATAAGACGGAAGGATACTAAAGAGACGTAAGAGTC
> TGGTGACTTTTTTCGGGGTAGAGTAAGCATTTGTAGAAAACTAATTGATCATCTGAAGTA
> AATGTATGTCCGAACTAACTACTGAGCTCTGGCGCGTCTCGCGCAGAGCATCCCATTGAT
> AAGCGGCCGAATTAGTGGTGCCTCGCTATGTTTATTTTTGACTAGCATGTCTGTTTCTTA
> ATTGCGTCCCCTTGTAGAGCGACTTTTAATACCTAGAGTGACATAAGTGTGCGGTGGCTG
> TTGATGAAAATATGGAAACTCGTGTACAGATACACCACTTGAGAAACGAGCCGAATTCAC
> CTACACCTTGCAATAAGTGAGTCTTAAAAGAAATTTTGGAGGGTGGCGGTCTTCAGATGA
> AGCATAACATTCGGATCTAATATAGTGACTAAGGTAACTAGCCAACTTATCGCTCGAACC
> AACTAATATTGAGGACTTAAACCAAAGAGGAACTAGCTCAACAAAGCTGTAAATTATATA
> GTTAACCAGTAGAGAACCACAACGACCTTTTGGCGAGTTTTAAAGGAGCGTGTCCTATTA
> CAATGTAAAATACTTAGGGGCTGCATAGCACGTCAGATAAGGCATCTTGAGTTAGAATCA
> GAGAATTGGCTAAATCTCAAAACGATAAACATTAATGTTCCGTTAATCAGCACTAACTAA
> GGTAGGATCACCAGAAGACATAAGCATCACATCGAGCGACCTTATGGTATACAGGTATCG
> ATAATTCCCAATTTGCCTTGAGAATAAATTAGCAAGTTGCAAACCCGATCTTGGGACCTC
> TGAGTTGTGTTCTATCGAGGATAACTTAACTAGCTCGCTGAACAGATACTTTAAGTTATC
> CTTGTATACAACTACACATGGAAGCCGTTAACCTTAAATTGGAGCCGCTCTAATGACGTA
> ACGCTTCATAAACCGGTAAAACAAATCGTGAAAGGGCGACAGACCAGTATATACTTTTAT
> AGTTAAACTACTATTATAAGGGAACTTTGGTTCGAAGCTGCTTTCCGAGGCCCTTATGAT
> ATAACTCATACGGCTTTATCTAAACCTACACTTACAGTGACTGGAAAAATTGGCGATCGA
> TCTCGCAGGATCGCTGGGCACTTACCTTGGTCAACTTTACTGGTCTACAATTACGACATA
> AAGTTTGGACGGCAATCGGAAAACAATCTACACTTACAACATAAACTAGTATACATTTAC
> TATGGGTCAACAAATCTGTTATCGATTCCACGAACAACGATATAATATGGAAGACTTTAA
> GAGGGTTGGATTTACGACCTTATGGCCATTCACCTCCCAAAGATTCCCATTCGGCTAAAA
> AAGTACACTGAGGTTCTATCTCCTATCTCTAAGTCGAATAGTAAAAGGGTAATCAATAGA
> CATTCTACATTTGGTTCATTGGAGATCGTTATTATCCGTCGGTAACGATAGCACATTCTC
> AAGCATGATTCGTAACACATCGGAGTCACCTATGAAGGGTTTGCCTAGAAAATAAACCTA
> TTTTTCCTTGCGTCGTGTAATTAGTATAGGGCAGATGACTGAAGGATACACCGGATCAGC
> TGTATACTTCTTACTCCTTCCAGGGCAGTCTTTTTAGACCACTTGTTCTAAGCGTGTGGT
> CTGACTAAACGGTTTAGGATATTTCTCATACACTGATCACACTGACGATTCGCTGTGAAC
> GACGAGGGTGAATAGAATAAATTCAATGCTTCTCTGACCCATAGATGAACTGAAAAATAG
> AGAAGGGAATGTATCTTTCGCGGTAGTCGAGCTGGTTCAAACTTAACTAGAGAAATCTGG
> TAATAAGTGTCTTAATTATAATTTAGTAGAGCCTTATTTTAAACAGCTGCATTGACAAAT
> ATAAATGAAACGGTTGATAATTTGTGTTTAATTTTGGAGTAGAATCAATTCGCGTAATAA
> CAGAACGGGCGACTTTAAAAGTACGAAATAACCATTTAATTGGGACTTTTAGCTGGAAAG
> TTGGGTTTCATAGAGCCTCTGTAATTATTATACTGGTTTACAAGCTTGAATACTGCTTGC
> GAATGCGATTAGCTAGGCACCTATATATTGATAGCTTGAAGGTATTACCACGTGGGAGTT
> GCATACGTAGCTCCTATTGCTAAATGCTGGGTTTGTGCAGTACTACGTTCCGAGTTTACG
> AACTCCAGCGGTCCATTGTCATTGGGTGTGTTTGTATAAGCAACTTTGGTTCTATTTGGC
> TACATACGGGGGTCTGGTTCCTCCACGTACAGCTGATGTCTTCTAAGTTTCCAGAGGAAT
> GAAGTGCGATGGCGTAACTAGATTACTGTATATATCCAGAGTTTCCTACGTCGTATATAA
> TACCTCATTGATTCTTGTAATCCCATTACATTCATTCAGGTGATGTCTTTAGTGTTTAAG
> ACTGCCATGTGTCCTGCTGTCCAACGAGACATAAAGTAGCGCTAGCGGATTATTGAAGTA
> CCCATAATATCGAAATTCAGGATAAGTATTATTCTAAGACTGCATATCACTTGAACCTCG
> TGGGTGAGATATCTTATACTTACACTAGCTGAATAAATCTACTGGGGGACGCACTGCCCT
> CCCTGGGCTCACTATCGTATTAAACAACTGTGTCCCTAGCTAATACACATCGACTCTAAG
> AAGTGTGTCTTTTCTTCGCCGAGGAGTCATAATGCTGGATGTTAGACAGGTGATACTCAC
> GGATCAAATGGAGTAATGGTTGACTAGTATCCAAACGTAGGAGATCAAAGCCACTTTTAC
> CTCTAAAGAGAAACAAAACGCGACAGCTTAGTTGACTTTCGAGAACCGAAAAAAAATAAA
> TGAATGAATTTCGACCATCTTTTATAAGATATCGAAAAATTAATGGCATGTTAGTTGTGG
> AATTCGTTTCTGTGTAACGGAAATTAAAAATAAGGTAGCCTAAAATCAACCATGGGTTCA
> CACTGTGCTGTTCATGGTTTATCTACTCGTATAGGGCACAAATAACAAAAACGAACACCA
> CGACGTCAGGATACCTTCCTCGTTTACTGCACAGTCCACTTGATTATAATCATGGAGCGT
> TCGGAGCCTACCATCAACCTTCTATTAATTCCTTGGATGAGGCTGCACAGCGTAATTAAA
> ATTTCGTTGTTACGGACCACAAACTTCTTGTATCGAATATTGTGGACGAGCTCAAATCCA
> TAAGTAGGGAATCCGCTAAGAAAACGATTTTAACTTGGTTACACAGAGCTTGTTAGTTAC
> AATGAGACCTGCACCTTGACTGAATTAAACTACTCCCGATTATTCTGTTCTAGTTGAAGG
> TTACTTATTGGGCCGGTCAGCCGAATAAGTAAGAATCAACCATGATCCTGTTAGTGCCAC
> AACGTGTTTTTAGTAGCCTGAGACTTATCTCTAAGGTTGTACAGTTTACGTGGCTTCAAA
> CAAATTCATACGTTGCTATTTGTAGCCAACACATCGGAAATTTGCACGGTCGTGCAGTCT
> CGTAGAAAACTAATTTTGACTCGCTAACTAAGCTATTACTGTGATCTGCAGTACTGCAAA
> GTTGACTCAATCTTTTGGGACTGTACAGGTTTGGTGTGCCTGTCGAATAGTGTAAGTATT
> GAGTACTATGTAGGTTGTGGAGCCCGTTCCCCCTAAGTAGATATTATCATATGTGACGTG
> TATGATAAGATTTTATCATTGCAGAAGCTGCTGAGTAGTAATAATTGTAACTTACACTTT
> GTGCACTGTCGTTAGACAAGTATGGTCACACCAAGTTTGATAGGTATTAAACTACATAAA
> TCCAAATTTTGTCTGCTGTAGCATTCTGCTCTGGGGCCATATATAATGGCCATATGCCTG
> CTAAAGTTCGAAGGTTCGTTGACACTTCCCCCATTAAGCAAATTAAACCTGGTATATGAT
> GTGATGGCGGTTTCGTGTCCGCCCTGATGTTGTGTACTAGGTAGAAAATCTAAAGTTATG
> GCCGGAAATAAGTTCGGTCTCATCCTTATCCTAACCACTTTCTATACTTCGATGAGGTGG
> GCGCTGGTCAACAGTTACCATTATCATACCCGGAGTCACCATCACCAATATCTGCGCATT
> GTTTTAAGGTTTGATTCGTGCCGGTTTCGCTATTTTAAGATGGTGAAGCACTAGGCATAA
> GTGTGAAACAAGCCCTTAGGATTCTGTGTAACTTTGTTCTTTTATAGCAAAACCAATAGA
> TAAGTTAGGCTTGCTGCGTCACATCTGTTGAACATGAACCACTTAGTTTTCTAAGTACAC
> ATACGTTCTTATAACGTTTGGAAATTTGTCACATATTACCGTTTATGCTGCCGAGCTGTT
> ATAAAGTCAAGTGGGTTGTGCCCGAACTGCTCTCTTAAATCTCGTTAAAATTCCTCGGCG
> TTATGCGTAGTGTGCCATCTGTTACATGAATGGAGGATGAACAAAGAATCACTTTGATAA
> TAGTTGATCGTCTAACTATTTAGGGAATTGACGAATAGCCAAACACGAACGTGTCTGAAA
> TCTAACGCATTGTAATCCTATTGTAATAGGCAAGACGTCTGTTGCCCAATTGTGTACTGC
> TTATTAAGTTCCACTTCCGACCCGATAAGTCCTATTTAAACCAAACTGTAATCTTTCTCT
> GAGATTGTACCACCATATTTCTCCCAGACATGCTTACGTGTGCGCTACGTAAATAAGGAC
> CGGTTACTAGCAAATGCCGCCAACAGTACATCGTCATATCCACATTAAAATAAACGCTCC
> GGCGTACTGTGGATGCAATTCGAATCTCTGTTCATACTTGCTAGCAAATTCTATTGTTCT
> TGGAAATCATGATACAAGTGAATGATAAGGGGCTTGTAAGCCCATCCGGTGCCATTTTTT
> TATTAATTGAGAAATCTGCACCCAATTAGTCAAATTATATTTGCGAGTTAATTTACTTTG
> ATTCAAGTGTCAAGGTGATATTGACAGTTTATATCTTATATCAGTTTTGTTATCTTGTAC
> ATTATGTCACAAAGTGTGCGATTTGAAAACAACGGCTCTCCCACCGAATCGGATATAATG
> AGACTGACATCCTCTTAAACCCAATCAACGGCAAAAAAACGCTATCCCGCTATGGTAGTA
> TGTAAGGAACGGTATAGATTATGATTGTAACCAGCTATAGTAAATGCAACGATTGTGGAT
> GCCACCTAGTAGAGCTATACCAACTTATCGTATATCTATATGAAATCAGCGGCCGTTACC
> CCTAAAGGTATTGACGTTGCGCGCTGTTTTTCATTGAAATACTCTGTAACGCTTTTTCAT
> CTGGGAGAGACCGACAAGTATTACATTATGGCAATACCGAGATATTACGCGAGTACGCTG
> GGAACCTACATAAAATTCGGTCCAATGGATATCGGGTCATAATCATAACATCACTATAGG
> CGCGTTTCTCGGCGTTTGATAAGTACCCTATTGTAAAGCATGTACGTCGTTGAAAATAAT
> GTTAGTCTCTTGATAAAAGATGCACCCTCCGAGCACGCAATGCTTCTTAAGTTTTCAATG
> GATTTGTAACATAACTAATCCCTTCTAACCGTATTACACATTCAGTGCACCAGCATTACA
> CGGTCTTGAGACTCTATTGGTTAGTGCACTTTACTTTGTAGATGAGCGTTTTAGACAGTT
> TAACATATCATTTTTATAAGTATTCGATCCGAATTTGTACCATACGTGCCTGGAAAGCTT
> GGACAACCAGATTTGTTAAGCCAAGATGCATGAATGAGAGAGTGATCTTAATGTACATGG
> AATACTTCGGACCTTCAATATGAGAGGCCGGCTTCACACAGGGCACCAAGCGCCATGATA
> AATGCATGGGCCAGATAATTATATCCAGAGCTATATGAACTTATAGGCGAGATTGACTAA
> ACCTTTTACCCAGAAGAACGCCTGCATTTATTCCAGTGTTTTAGTGTCACACTCACTGGC
> TAAATCTTCGGTTAACAGTAAAGGCTATTGCCTCCCTCCAACATAAATATAGCCAAACGT
> ATTTATATTTCAGTCGTGAATCTTCGAAAAAAAATTCGCAGGGATGGGGGCGGCTTCATT
> TTACAGCGACAGATTAAGGATAAACCAATATGTCAGAATAAACATATCGCCTAATTCATG
> GGTCTTGTACGCTGGCCCTTCGTAGTGTATAAATTTCACTCGTTGTCTACAAAGTTTGTG
> ATTTCCGGGTATTGTAAAGCGTACACGGTTGACAATATTTTTTAAGCAGCCTACTATCCT
> GTTGTTTGTATATATTGACAATATAGGCAGTAGCTTGAAAAGGATTGGTTTAGATACGTT
> ATTAGTAACACAATAAGCTAATGGGCGATCGCGTTGGATGATAGAAAAATATAAGAAGTG
> TCAGACTTCTAATTTGATTATAAATTAAAGAGTTACTGTGTATGCCTGCTGAAGTTACCT
> TATTAAAAGTTAAAAATTAGACCATAACCACTGATGTTGAGCGTCAGTATCCTGCTGTCC
> GCTATTTATGGAAGATAGGTTATCGGGAAATAAAGCTACAGCCTTGCGTGGCTTAACGAT
> GGTCGCATGTTGTTTACTTCTAGTCTTCTTCGGGGAATGACTTGTAGCATACGTTCTATA
> CAATAGAATACCCGGGCTATATCAAAAATAACGTGATTCTGCCATCCCAAACGATAAACA
> TTATGAATCACATTCGAAAATAGCCATTTTAGAATGTCATCAGCTTCAGTATAGTCTCAA
> ACCAGTAATGAAGCTACTTACAGTTCAGAAGAGAGAGTTGCGGAGGTGTGGCGGCATAAG
> GTTTGCATAGGGGCATGAGCAATTGTAAAAGGAGTATGAGAGATTGGATCCCTTATTCAT
> TGTCTGCAAGGTTGTATTTAAATGACCTCACCAACATCAATATTAATAATAATTACGACT
> GTCGACAACAATCCCCTCGGAAAAACCGAGTATTAATAATAGCCGATTCGGCCCATTTTC
> GACGGCAATTAAGAATAGAGTCTGTAGTTGAAGAGCTTCCAATATTCATAGCGGCAGCAA
> ATGTTCGTATGCCACGAGCCTATAGAACAGCTCTTGTTCCTATGGATAGCAAAAATGTGT
> AGGTAATTATCATTACATCGAAATCTTGGCTTAACGTATAATTTTCCATCTAGGGTACTC
> GTCCAGTTTACACAATGCGCCGGCATACAACACCTTGTTTTTGTAGTCGAAAATGATATG
> ATGAACTTCTTATAATTTGCCTCTAGATTACTACGCCTTCCGGTCACCTCCCAGCAGCAT
> AAACTAGTAACAGAACTTAAATTGCAGCGCTTTGAAATTATCCAAGGAAGATATACTTTG
> GAGAAAGATAAAATCTCCTTAGTGACTTATGTCGTGAACAAGTCGGTTATTTTATCAAAA
> TATCAGTTTATCCGATAATTCCCGCCCCTTACTAAGACGGCACTATCTAATAGCCTATAC
> CAGGTGAGCGTTTTAATTGAGCAGCTCAAGGGGTCTTTTAAATATTATACGCGCCGGCAA
> CTTGTTATAAGCTTTGTCTGCCGAAATAGTTATTACTAAGTTCCCCAGGCTCCTGCGTAT
> GAAGGTGAGTGGTGCAAGAAGTTTTTTTCTTGTGTTGGCCAAACCGATAAGAGCCTTATT
> CGGGGATTTTAGAACTGAAGATTTCAGTAAATGTATTGAAATACTTCACTCTCAGATGTG
> TCCTAGGCGAGTGTTAGTAAGATGAGACGTTAATACAGAGAAGTCTAGTAATGGCACAGA
> ATTGTGCAGTGATATTGCAGTCAATTCTGAGAATCAAAGAAAGCTACTAAGTAGAGGAAT
> CGGGTTAGGTGCCTACTGCTTAAAAATATTTTTTGACTTTCAAATGAGCGCATAGGTTCG
> GACATTTACTACAAGTACTAATGCTTGGACGCTTTTGTGTAGTTGCTGAGGAAGAACTGA
> TTTCCCAGGCCTACGTGCTTGGTTTCAACGACCAGACCTTAGATCTATAAGCAATTGCAT
> ACTGTGCTCATGCATTTCGGTCATTCGGAGAACGCGAGCGCGCGACCAAAGGTAGCCTCG
> TTCCCAATAGACCTTAAATGTCAGCACGATCCTGTCTCATGCTGTTTACGACATTTGAAT
> AGTAGGGGAAGTAAGGAGTGCTAGTCCAGCCAAAATGACGCACAAACCTAATTTCTTCCT
> TGCAATGTCTGACATCACGTAGGTCCCTTTGAACTAGTCATAAGTAATTAAGCGGTATTT
> CTGCAGCTCAGCTCACTAGTTTATTCAGTTTTTCGATCTGGCGTGAGGCAACTCCAACAG
> CTATCTTAGGAATCTACACTGTTGGAGTCCTGTACAGGAAATGTACCAGGGCAGTACACC
> GCATAAGATGTGAGAGAGGGGGGTTTCACATTAATATTGGTTAAGTGAGTTGCACGAGAC
> GCACGCCGTCTTTCTTTGACAAGACACCTTGTATTATAGAAGCGCCTCCAACAATTGCTC
> GTTGGCCCCTGGTAATATATTTATCCAGTCTCAAAGGGACGTGACGTTACCGATAAATTA
> AGACGTGACCTCAGGTTTGTCGAAATTAAGTTCGGCAAATGTTCGAGAATGGAATAAAGA
> GGTAGCATCTGCTTTTGAGGGGGAGCTATATGTCCATGTTCAATCCTCATCAATAAGCTG
> TAGAGAGACAGACGTAAGGACTAATATCTTTTCTCACACGGTGTTGTTGTGTCACTAGTA
> CGCTGGCTATAGGAATTGATACAGCGAAGCTCTAGGCAGAGACATGATCGTCCACAGTTA
> GCTAAGACATTATATTTTACAGATTAAGAGAGGTTGGCACATGGTCAGTATACAAAGCGA
> TTGCTAGCGCTATGGCATTAAGGTCCTTACTTTGATAATTACCAGCCATATTAGGTAACA
> GTTAAGATACATACAGCCTCCATCCTTATCTGCCCACGGACGTAATAGTTAAACTTACGC
> GGTGCATTCAGAGGAGTGCTAGCATGAATCCCGATCATTTAGAAACAACTGTCCAGTATG
> GCTGTAGAACTACAGGCAAGTAGTTAACAATCTAGATGGTATAAGCCTAGATTCGCGGGG
> TTCCCTTGCTGAGAACGGCCTTACCCTTAGTCAGGAATGAGCCATTTCTGGGCAATTTAT
> CCCAATCGGATCCTGCATCGAGAGTCACCCGGTAAATGGAATGATAGTTAGATAAGGTTC
> CCCTCGCGTCGCTATGAGATAGATATGGTACGTGGACTCTTTTGGAAGATTTTCGGATAA
> TCAGACATTTGATAGACTTACATGCTACCACTAGCAACTACCGCTTTGATCAATCGTATC
> ATTGAGTAATTTTGCAAAGAGCCATTATCGGCCCAAAAGACATGTTGGCATTTTAAACAG
> TAATGAACTAGTTTCGTCACGACCATATAGAATTATTCGGATCTAGAGAGTCAGCCAAGT
> TGCGCAGGCAATAAATTCAAAGAAAGCTATTGGGTATGCTTCTATTGATTCGGTGTAACC
> GTTTATAATGCGCTCGGTCAAAATCTTTTTCTAAGGGATCCGTGAAATGCAAGTTAATAT
> CATTAATTTTATATACTCAGACATAAATTAGCCAAGAGTATATCGAATATAACAAGAACT
> GAGCATTTAACAACTAGACTATAGTTTACGCTACTTCCACTTTTAGTGTCTTGTGTGACC
> AATACACGTACGTTGAGGCGTGGAAGCTTGATAATATTCCTCTACGAATCTATACTCAGA
> TTAGCACAAGCTAGAACGTAAGCTACATATTAACTCACGTAGACCGCATGCGATGGCAGA
> ACAAGAATCAAGACTGAAGACAGGCTTGATTTTAACTTAACCTTGATCGCATACCACATT
> CCAACGGGATTGAAACAGATTAGAGGCTGCTAATCTTAAATCTCATTTTATCCGTATCTT
> AACAACTGTAATTTATCAGGAGATATCTTGAGTCTGATAATCCACTATGAATCGATTTGG
> TATTGCACTTCATTATAACTTAGGTCTTCAACTTACAGCCCAGACTACATTTATAAATTC
> GTGATCGACAATAAGGCTGCACATACCGTGCAGCGTTTATCGGATAAGGATCTCATGGCT
> CTTTCAATGCGCTTGCATACCGGTTATGATCCTATTATCGCCCCGTTGAATAATCTTTAA
> CGTCTAACACCTTTGTGGCCGAATACATCGAGTCTCGATTTACCCAATTATTTTTGCTGA
> GAATTCCCAGTGATGTACAGGGACCGTCGTTTATCATAAGCAAGAAAGGTAAGAGACGGA
> CATCCTCCGGCTCAATCGTTTGCCCTGAAACTCAAGAAGTCGCAATTTGGTCCAGCGCAA
> TCATATTTAATTCCAAGAACGTACCAGTTCAACTTTGACAAGTAGGGAATTGATCGTCTA
> GTAGCGAATTACATGTCAGCATTCCCCTTCAATATGGTGAATTCAACTATGTTCGAGCAC
> CATGTTCTTTTTTATTATATGATATAGTGTCTTGTCTATATTCGTTAATGAGCGTCTTGC
> TTGAGTGAACTATGATAATTGGTACACGTCACTAGCTGAATACCATTTCAACTATACTGA
> GACAGATCTTTCTGTGATTTATAGGTACTACTTGGAAAACCGCTTACATTCGTTTGTAGA
> AGTTTTCGCTTTCGAAGAACGTTAAATATGAGGAACCTGAAGAGTTCGAAGCTCTAACTG
> ATACTAAGATATAAATCACTAAAACTACCGTATATAGGCAATTATTCTGTTTAGACAATG
> CTTTATGCATAGGTCCGATTAGTTGGATAACAATAATAATATGTGTTTAACACCGGCTCT
> TGCAAACTATCATGAACGCCTCGACGAGCGTGGTATATGTGCTATCACACCCTCTCTGGA
> ACAGGGTTGAACGCGCACTCGGTCCACTGAGCTCTACCGTTGACGTGATAGCACAAACTC
> ACCACGTTTGAAAGAAGCAACCAGCACTAACTGTAAATATGATACCTTGTGGCAGAACTT
> GAAACTATAGGTTCTATCCAATTCGGTTGTGATATACGGTTGAAAAACAACACGGAGTTA
> ACAGTCAGCATCTAAAGTAGCAATAATCATAAACACAGATCTACTTCCGAGTCCCACGAA
> GCACATCTCCGTTTAGAATAAATCAATAGGAACTGCGTCTCGACGACTTCATAAAAATTA
> ACTAATTCACAGACCATCCATACAGATTACAGAATTTTACGTTTTGAGACCGGAACTTGA
> TACCGACAAAAGTGTCCTAACCACTGCTCGGGGAATTATCAACTAGGAGGTACGCATGAA
> ATAGGAGACAGGATCAATTTTGCCTTCATAAAAGTTTCTTTCAAACGCACGAAGTTCAAT
> GAATATACGTCGAACTCGATGCGTGATTGACCTCCTTTGATCATGTCATATAATTAATTA
> GCTAACGTCATTTGTTTTCGGCCCCCAAATTGCTGGAGTTTTATGCCTAGAATTACGGTG
> CTCGCGTCGGATCATCTTGTTAATATCACAGGCACTTGGTTCTAGTATATGATTCATGCC
> TCCGTAGTACATTCGCGATAGCCTCTATCTTGTCGATACGTAAGGAAGGGCGCGAGGTTT
> AAGTTTGCGTAGGTAATTCCAGCCTTACGAAACGGGGCACTGACCTTTTATAAGACGCTA
> GGTGTCTTTTCAGACGTAAGTCTAGGGTGAAGTTGTTCCCCGTTGTGGATGAATTTCGTC
> AATAAGAATTGATCTTATCATCTAAAGGTATGTCCCTTCTAACTTCGGAGATATGGACCC
> TCGCCCGCAGTCCAGACAATTCATAAGCCGCACAAGTTGTCGTCCCTACATATCGTGAGT
> GGGCTCGAGAATGGAGGGGTCTTTTTTGCCGACCCTTGGAGACAGACTTGTAAGAACGAG
> AGTGACATTACTCTGCCGTGCATGGTCAGCTTAAGATCGAAACGCCGGGACAGATAAACC
> AATTGACTTACCAGCACTTGTCAACGACTCCTTGATATATGTCAGTCTTTTTTGATATTT
> GCGAGGCTCCCGGTCGTCAGATCTAGCAGTTCATTCGCAGATAATTGTGTCTCTAACGTT
> ACTTGCAAAATGTGCGATAGAAAAAACTAATTTTCTGCAATGAAACATTAGAGGTACGTC
> CGAAAAAATGCTGTAAATGATATACTTATCAAGTTGACAACCTCTTCCAAAGGTGGGAGA
> GTTTGAAACGAGCCGGTACTTTGAATAGCTAAATGTATGAGGGGCTGCAGAGCAAGTCAG
> TTAAGGATGCTTCACTGACAAGAAGAGAATTGGCTTAATCTATTTACCATAATCTTTAAT
> CGTCAGTTATTATCCTATAAAGAACGGTGGATCAACTGAAGACAGAACCATATCTGCGTC
> CGACCTGATGGTAGACACGTATCCATAATGACCAATTTCCCTTCAGAAGTAATTAGCAAC
> GTCCATACCACATAGTGGGACATATCTGTTCGGTTAGAGACAGCATTAATTTTCTACCTC
> GATCTTATGATTAGGGAAGTTATACTTGGATACAACTACTCTGCGAAGCCGGTAACCTTA
> ATTTGGACACCAGCTTATGACGTAACCATTAATAATAAGCGAAAAAATATCGTGAAAGCC
> CCACAGTAAAGGTTATTCGTTGTGTCGTTAACTACTATTAGAACCGAAAGTGGGTTAGAA
> CCTCAGGTAAGTCCAACGTTGCAGAGAACTCTGACGGCTTTATCGTTTCAGAAAAGGAAA
> GTGACTGCAATTATTGGCGATAGTTCTCCAAGGAGAGCTGGGAAATTAAATTGGTAAACT
> TGAATCGTCTACAATGACGTCTGATTCTGGGGACCCCAATCCGAAATCATTAGACACGTA
> ATACAGTAACTAGTATACAGGTACTATCGGTCATCAAAGCTCTTTTAGATTCAAACAAAA
> ACGAGATTTTTTCGATGACTGTTTCTGCGTTGCTTTTTAGACATGATCCACAGTCTCCTA
> ACAATGATTCCCATTCGGCTAATATAGTTCTCTGACGTGCTTTATCCTTTATCTTTGGAC
> TAGACTATAACCCTAAGCATTTCACTGTCTACTTTTGCGTAATTCCACTTCCTGATTATC
> CCTAGGTAACGTTACAAAATGATATACCATGTGGCGTATCACATAGGACTAACCTATGTT
> GGGTTTGCCTAGTATTTAAAAATATTTTTAAGGGAGGACTGTATTGACGATAGGCCAGAT
> GTCTCAACGTTACAACGGATCTCATCGTTACTTCTGTCTCATGCAACCGCTCTATTTTTT
> GACAACTGGTTCTAACCGGGTGCTCTGACTAATAGGTTTAGGTGATTTCTCAGAATCTGT
> TCACACTGAAGTTTCGCTGTGAAACTCCACCGTCTTGACATGAAATGCAATCCTTCTAGG
> AACATTACAGGTAATGATAAATTGAGTTGGGTATCTATAGTTCCACCTAGTCGAGATGGT
> TAAAACTTAACTTGTGATATCTCCGTTTAAGGGTCTTAATTAGTATGTAGGACTGAATTA
> TTTTTAAAAGCGCATTGGAAAAATATAAATCAAAAGCGGCTTAAGTGCGGTGTAATTTGC
> CAGTTGTTTATTTTCGAGTATTAACACTACGGCAGACTTTAATACTTAGATATAACAATG
> TTTTGGGGAAGGTGAGCGGGTTACTTCCCGTTCATAGTCACTATCTTATTATTATACGGC
> TGTACAACCTTGAATACTCATTGCGAAGGCCAGTACAGAGGAACCTATTGATGGATTCAG
> GGTAGGGATGTAATACTCCGACTTGCATACCTAGATCCTTTGCCTAATTCCTCCCTTGGT
> GAACTAATACCGGACCAGTTTTAGTAATACACCCGTACAGGGTATGTGGCTGTCTGGCTA
> GAACCAACTTTGCTTCTAGTTCGCTTCAGAAGCCGCTATGGTTCAGAAAAGGACAGCTCT
> TGGATTATAACTGGCAACAGCATTGAAGGGAGTTGGCCTTACTAGAGTTATCTTTAGATC
> CAGTCTTTCCTTCGTAGTATTTATTAAATCATGGAGTCTTCTAAGCCATTTACATGAAGT
> CAGGTGAGGGCTTTACGGTTTTACACTCAATTCTCTCCTGATCTCCTACCAGACATTAAG
> TACCCCTACAGCTTTTTTCAAGTACCAATATTTTCGAAATTAAGCATAAGGTGTTTGCTT
> ACACGGCATATCTAGTGAAAAGCGTGGGGGAGAGATATTATAATGACACGAGCTGAAGAT
> TGAGTATGCGCCACGCACTCACATCCCGCCGCGATATATCCTTTTTAACAAAGGTCTCCC
> TAGCTAATACACAGCGACTCTTACAAGGCTGGATTTTAGGACCCGAGCAGGCAGAATCAT
> GCTGCTGAGTAACGGCTTAATCACCGTGATTTTGGAGTAAGGCTTGAAGACTTTACTAAA
> GTAGGACAGAAAAGAAACTGTTTCCTATATAGACATACAAAACCCCTAACCTTAGTTCAC
> GTTAGTCAACCGAAAAAATATATATGAAGGTATTGACACAATCTTTTATTTGATATCGAT
> ATTTTATGGGATTCTTAGTTGTGCAAGGCGTTTCGGTGGAACCCATAGTAAAAATTACGT
> TGACTATATTCAAAATTGGCTTAAATCTCGCCTGGTAATGCGTGATAGTCGCCTAGACGG
> CACATAGAAAATATACCAACACCTCGACCTCAGCATTCCTGCCTCGTTGACTGATAACTA
> CTATTGATTATAATAAGGGTGCGTGAGGTCCCTACCTGCTACCGTATATGTATGCAGTGC
> ATGAGCCTGCACAGCGTAATTTAAAGGGAGTTGGTACCGACCTCAAAAGGATTGGAGACA
> TTAGTCGCCACGACCGCAAAGCCATAAGTAGGCAATCAGATAACAAATAGATGTTATATT
> GGTTACACAGACATTCTTAGTGAAATGCACTCATGCTCCGTGACGCATTTAAACTAATAC
> CGAGTTTTCTCTTCTAGTTGATCCTTACGTTGGGGCCCGCTCAGCAGAAGAAGTTACATT
> CAAACAGCTTACTCTTTGTGCCTCAACGTGTGGGTTGGTGCATGAGAATTTGCTCGATGG
> TTCGACTGTTTAACTGGCTTATATCATATTCATACGTGCCTATGTGTAGCCATAACATCG
> CTTATTTGCTCCCTCGTGATGTCTCGTAGATAACTAATTGTGACTAGAGAAATAAGCGTG
> TACGCTCATCGCCACTAAGCAAATCTTGACTCAATATGGTGCGACTGTACACGTTGCGTG
> TGCCTGTCGATTAGTGTAAGTATTGAGTACGAGGGTGGTTGTCGAGAAAGTTCCAAATAT
> CTTCAGATGATCATATGGGTCGTGTTTGATTAGTTTTTATATTTGAAGTACCTGCGGAGT
> ACTTATAATTGTTACTGACTCTTGGTGCACGGGCGTTACTATACTAGCCGCAAACAAAGT
> GTGATACGGATTAAACGTCTTATAGCCAAATTGTGGATCATGTTGCATTCGCATAGGGCG
> ACATATTGAATCCAATTATCAATCATAAAGTGCGATGCTTCGGTCAAAATTAACCATGTA
> ACCAAATTTAAACTCGTATTTCTGGGCATGCACGTGGAGTCGCACAACGCTTGGGCTCTA
> CGTGGGACTAAATCGAAAGTTTGCGACGGATATATCTTAGGGATAAGCCGGTTCAGAAAC
> ACGTGATATACTTCCATGTGCTCGGACCTGCTCAAAAGTTACAAGTTTCTGAACACGTCG
> ATACTGCACCATGATAGCAGCTTTCTGTTAAGGGGGGTTTCGGGCACGTTTACCTATTTT
> AAGTTGGTCTAGCACTTCGAATTACTGTCATTCATGACCGTACCATTCTGTCTAAATTGC
> GTATTTGTTTCAATTTACTATAGTGAAGTTACGCGTCATGACTATCATCTGTTGAACAGC
> AACAACTTACTTTTCTTTGTACACATAAGGGCTGTTAACGTTTCCAATTTTGTCTCATAG
> GTCAGGTTAGGATCCCCAGATCTTATATAGTCAAGTGCGTTGGGCCACTAATCATCTAGT
> AAATCTACTGAAAATTACTCCCAGGTTGGAGGTGGCTGAATTATGTTAAATCTATCCACG
> TTGAAATATGTATAAATTTCAGTTTAGGTGATCCTCTTAAGATTTTCGGATTTGTAGTAT
> ACCCTAACACGAACGTGTCTCTATTCTTAAGATTGCTAATACGATTCTATTTGCCAAGAA
> GTCGGTTGAACAATGGTGTACGGCGTAGTTACGTCCTCTTAAGTCAACATATGGCCTATT
> GTATCCAAACTCTAAGAGTGCTCTCACTGGGTAACAAAATATTTCGCCCACTCTTGCTTA
> CGGCTGACATAACTTAATATCCAACCGTTAATAGCATATGACGCCAACAGTACTTAGTAT
> TTGCCAAATTAAAATATACCCTCCCGCGTTATGTGGAGGCAATTCGAAGAGCTGTTAATA
> ATTGCTAGCAAATGCTATTGTTCTTGCATATCATCTGACAAGGCAATCTTAACGGGATTG
> GAACACAAGAAGGTGCAATGGTGTTATGTATTCAGATTTATGCAAACAAGTAGGCAATTT
> ATATGGGAGACGTTATGGTAGTTGATTCAACGGGATTGGTGTTTGGGTAAGGGGATTTAT
> TATATCAGTTTTCGTATATTGTTAAGTATGTCACAATGTGTGCGAGGTCTATACAACCCC
> TCTACCAACGTAGCCCTGATAATCACACTCACAGACTATTTAACACAATAATCGGCATAA
> AATCGCTTGCCACCTATGCTAGGATCGTACGATCGGTATTGATTATGAGGGTTACATCAT
> ATAGTATAGCATAAGATTGTCGATCAAACCTAGTACAGCTTTAAAAAATGATCCTATATC
> TATATGTAATATGCGCACGGTACCAAGTATGGTAGTGAACGGGAGAGCGCGTTTTAATTC
> AAATTCTATGTAAAGCGGTGTCATATGGGACACACCGAAAAGTATGACATTTTGGCATTT
> CCCTCATAGTAAGCCTCTAAGCGGGCTTCCTAAATAAAATGAGCTAATATCCATAGAGCG
> GCTGAAGCATATCATCAATTGAGGAGCCTGTATAGCACTTTGAGAACTAACCTATTGGAA
> TGAATGTACGTACTGGAAAATTAGGGTTGTAGAGTCAGTAAACATCATACCTCCGTGCAA
> GCAAGCCTTATTAAGTGTTCTTTCGATTTGGTACATAAATTTTACCTTCGAACACTATTT
> CACAGGAACTCAAACACCATTAATACCTAGTGACTCTCGAGGCGTTTGGGCTAGTTACTT
> TGGACTTCAGCGTTTGTGAAAGTTTAACATATAATTTTTATAAGTATGCGATCCCAAGTT
> GTTACTTAACTCCCTCCAATGCGTCCACAACAACTTTTGTTTAGACAACATCAAGGAATG
> AGTGTGTGATCTGAATCTACATGGATGAATTCGGTCATTAAAGATGACACGCAGGATTCT
> CACAGGCCTCCAACCGCCATCTTAAATGCAGCCCAAAGTTAAGGATAGCATCTGATTTTG
> GTAAGGATTGCCCACATGCACTAAAACTTGTACCAAGAACAACCCATCCTTTGTTTCCAC
> GGTTTGAGTCTCACACTCACGGCCTTAATAGTACCTGTTCTGTATAGGCTTGTGCCTCAA
> TAAAACATAAATAGACCCAAAAGGAGTGAGATTGCTCTCGTCAATATTAGAAAATAATTG
> CGCACGCATGGGGCAGGCGTCATTTGAATGCGTAAGATTAACCTGAAAACAAGATGTCAG
> AATAAACAGATAGAATTATTCATCCGTATTCGAAGATGCCCCTTCCTTCTGTATTAAGTT
> ATCTCCGTCGATACAATGTTTCTCTTTGCCGCGTTTGGTAATCCGGAAACCGTGGACTAT
> ATTTTTGATGCTGCATACTAGACGCGTGTGGCGAGAGATTGACTATTTTCGAAGGTGCGT
> CAAATGCATGCCTGTAGAGACGTTAGGAGTAACTAATTAACCTATTCGGCCATACCCTTC
> GATGATACAAAAAGATAAGATGGCTCAGAATTCTAATTGGTGGAGTATGTATTGTCTTAC
> GGGGTATGAAGGCTCATGTTAACTTATTAATAGGTAATAAGTAGTCCTGAAAAACTCATC
> GTGACCCTAAGTTGCATCAGGTCACCTTTTGATGCTTCATTGGTTTGCCGGAATTAAACC
> TTAACACGTGCCTGGCTGATAGATCGGAGCTTGTTCGTGTCGTCTAGTATTATGCCGGGA
> ATGAAGGGTTCCATTCGTGATATAAAATTGAATACAACCCATTGTTCAAAAATAACGTCA
> TTATCCCTTCACTAACCTTTAACTTGAGCAATAAAATTAGAAAATACCAATTTTACTAGG
> TCAGCAGCTTAACTATAGGCTCTAACCTCTAATGAAGATACTTACAGTGATCAAGTGAGT
> CTTGCGGAGGTCTCGCGGCATATGCTGTCCATAGCGCCAGCAGAAATTGTAAAAGCTCGA
> TGAGAGATTGGATAACTGATGATTTCTATGCTACGGGGGATGTTAATGTCCGAAACATCT
> TAAATTTGATTTATTTTGTCCACTGGCCTCTACAATACCCTAGGAAAAAAAGAGTAGTAA
> TAATTGAAGTTTAGGAACAGTTGCGTCGCCATTTAACTTTAGAGGCTCTAGTTCAAGTCC
> GTCAAATATGCATTGAGGCAGAAATTCTGCGGATCAAAACAGACGTTAGAACACCTCTGG
> GTCATAGCGATACCAAAAATCTCTTGGTAATTATCTTTACTTCCTTATATTCCCTGAACC
> TATAATTTTCCAGAGACCGTACTCGTACAGTGGACTCAATCCCCACGCATAAATCACCTT
> CTTTTGCTAGTCCAAATTGTGATCTTCAACGTCTTATTATTGGCCGATACATGAATTCGC
> CTTCAGGTATACTCCAAGCTGAATATTAGAGTAACACATCGTTTAGTGCACCCCGTTCAA
> TTTATACAAGCTTGTTATTCTTGGCTCTAACTGAATATCGAATGACTGAATTAGGTCGGC
> AACAAGTAGCGTATTTTAGCTTAATATCACGTTTTAACATAATTCCAGCCAATTACTTTC
> ACCCCACTATCTAATAGCCGATAACTGCTCAGCGTTTTAATTGTCAACCTCAAGCGGGAT
> TTTAATTTTGATACGCGACCGATTATTCTGATTAGATTTCGCTGACCTAATACGGAGTAA
> GAACTGAACAAGGATACGGCGGATGAACGTGAGTCGGGCTAGTTGTTTGTTGCTTCTCTT
> GCCCTATACGAGAAGAGCATGATTCGCGGTGTTTTCATCTGATGATTGAAGGAAATGTAT
> GCAATTAATTAAAGCTCAGAGCTGTACTAGGACAGGGGGAGTTTGATGTGACCTGTATAC
> AGAGAACTATACTAAGCCCTCACTATTCGGAACGGATATTGCAGTAAATTCTGACATTCA
> TACAAAGATAAGATCTAGAGCAAGCGGGTGAGCTGCCTTCTGATTAAAATTATGTTTTCA
> CGGTCAAATGTCAGCATTGCTGACCAAATGTAATTCTAGGACTTATGCGGGGTACCTTGT
> CGCGAGGTCCTGAGCAAGAAAGCAGTTCCCTGGCATTCGTGCTTGGTGTAATAGTCCACT
> ACTTTCTTAGATAAGCATTTGATGAATCGGCTCTTGCATTTCCCTCATTCCGAGAACGCG
> TCCCACAGACAAAAGCTAGACTAGTGACATATACAACTTAAATGTCTCCAAGATAAGGTA
> GATGGCGGTTTTAGAAATTTGTTTAGTAGCCGTACTTAGCAGTCCTTCTCATCCCAAAAT
> CACCATAAAACATATTTGCTTAATTCCAATCTCTCTCATAACGTAGCGAACTTGGAACTA
> CTCATAAGTAATTAAGCGCGAGTTATGCAGATCTGCGCACTACGTTTTTCACGTTTTACT
> TCGCGCGGCAGCCATCTAATTAACCTATATTAGGAATCGAATCTCTTCGAGTCAGCTAAA
> GGATAGCTAAATGCGCAGTACAACCAATTAGATGTGACTCACGGGGCTTTCAATTGATTA
> TGGCTTAACGGTCGGGCAAGTCTCCCACGCACTCTTTATGTCACAACAAAAATTCTATGT
> TAGAAGCCACTAAAACATGTGCGCGGTGGAAACTGCGAAGTGTGTTATCAAGTCTCTAAC
> CCAAGGGTCCGTACCGTGAAATTATGACCGCAAAGCTGCGGTCTAGAAATGAAGTTAGCA
> AATTCTTACACATTGGAATAAAGAGGTAGCAGCGCCTTGTGTGGGCGTGAGTGATCTCCA
> GCTTATATCCGCATCAATTACCTGGTGTCACACACACGGAAGCAAGAATATAGTTTCTCA
> CTCGGTGTTCGTGTCTATCGAGTTACATGCCTATACGAAGTGATACAGACAAGCTCGTGG
> AAGAGACTGCTTCCGCAACACTTAGAGTAGTCATTATTTTTGTCAGATTAAGTGAGGTTG
> CAACTGGGGCAGTATTCAATGAGTGTGCTTGAGCTTTCCCTGTATCGTCCTTACTTTGAT
> ATTGAACAGCAATTTTAGGGAACAGTGAAGATACTTAATGCCTCCATCCGTTGCTGAACA
> AGCAAGTAAGACGTAAACTGAAGCCGTGATGGATGAGGAGTGAGAGCATCTATCCAGAGA
> AGTTAGAAAATACTGGCCACTATGCCTGTAGAACTACAGCATAGTAGTTAAAAAGCGAGT
> TGGTATAACACTAGATGCGCGCCCTTCCATGGAGGAGTACGCCCGGACCCTGAGGCACGT
> ATGAGAATTTGCTGGGCTATTGTTACAATGAGGTTCATGCATCGACACTCTCAACGTAAA
> GGGATGCTTTCGTAGATAACCTGCACATCGCCTCCCGATGAGAGAGATAGCGTACCGGGA
> AGCGTTTGGTTCATTGGCCGATATTCACTAATGTGTTACACTTTAATGAGTACTCGAGCT
> ACTTCAGAGTTGTTCAAGCGTTTCTTTCAGTTATTTTGCAAACACACAGTAGACCCCAAA
> AAGACTGCTGCGATTGTTTTAAACTTTTCAACGAGTTGAGGCAACACAAGATTCTATTAT
> GCGCTTCGTGACACTCAGAAATCTGCACATGGCAATTTAGGAAAAGATACATTGTCCCTA
> TGCTTCGATTGTTTCCGGCTAAAACTGTTGATTGAGCTCGGGCAATATCTGTTTCTAAGG
> CATAAGTGAAATCCATCTGAATAGCATGAATTTTAGTTTCGCACACATAATTGTCCAAAC
> TGTATATAGATGATATCTTGAAATCAGCATTTAACAACTAGTCTATAGTTTAAGCTTCGG
> CCACTTTGACTGTAGGGTCGGAACTAGTCTCCTACCTTGAGCAGTGGTTCCTTGAGTATA
> GTCAGCTACGAAGCTAGAATCAGATTTCCACTACCGTGTAAGTATGAGAAATTGTATATC
> ACCTAGACCCCATGCGAGGCCAGAACAACATTCTACAATCTTCACTCCATTCAGTTTAAC
> TGATACTGGATCCAATAACAAATGAATTAGCGTTTGTATCAGTTTTGAGGATCCTAATCT
> TTAAGCTCATTGGTGACGTATCGTAAAAACTGTTATTTATCTGGAGAGTTCTTGAGTATG
> ATAATCCACTATGTTTAGTTTTGGTATTCCAAGTCATTATTACTTACGTCTGCTTCGTAA
> AGACAAGACTACATTTATATATTACTCTTCCACAATAAGGCTGCTCAGTACGGCAACCGT
> TGATAGGATAACGATAGAATGCATATTTCTAGGCGAGGCAAGACAGCTGATGATACTAGT
> AGAGCACCGTGGATTAAGCTGGTAACTCTTAAACATGTCTCGAAGTTTACATAGACTATC
> CTGTTAACCAAGGTGTTTTCCGGTGAATTCCCTCTCATCGAAAGCGACACGACTTTATCA
> GTACCTACTATCCGAACACACCCACAGAAGACGGCTCAAGAGGTTCCCATGAAACTATTG
> AACTACCAATGTGCTCCTGCGAAAGCATTTTTTTGTACATGAAACTACAAGGTCAAAGTT
> GTCTACTTGGGAAGTGATACGATTGTAGAGAATGTAATGGCTCCAGTCCAATTAATTATC
> CTGTAGTCAACTATGTTCGACCACCAGGGGCGTTTTTATTAGTTGATATAGTGGCTTGTC
> TATTTTAGTTAATCACAGTCTTGATTCAGTGTTCGATCATAAGTGGTACAAGTCAATTGC
> GCAATTCAATGTCTAATAGAATGACAAACTTCTTTATCTGATTTTGTGCGAAGTAGTCGA
> AAACCGATTAAATGCGTTGCTACAAGTTGTCCCTTTCGTACTAACTTTAATAGCACGAAC
> CTGTTGACGGAGAAGCTCTAAATGATACTAAGATAGAAAGCAATTATACTAACGTAGATA
> GGAAAGTAGTCTGTGTAGAAAATGATGGAGCAAGAGGGCAGATGAGGTCGAGATCTAGAT
> GATGAGGGCTTTATCAACGCCTCTTGCTAAATATCAGGAACGCCGCCACGACAGTGGGAG
> TTCTGCGTTCTCAACATCGATGCAAATCCGGTGTACCCGCACGCGGTCAACTCTCCTAGA
> CAGTTGACGTCAGACCTCATACTATCAACGTGGGATACATCCTACCTGCAATAACTGGAA
> AGATCTTACCTTGTGGCACAACTTGATAATTTTGCTTAGATCCTATGCGCTTCTCATTGA
> CGGGTCAAATAAAAATCGCTGTTTACACTAAGAATCGAATCTTGCTATAATCAGAAAAAC
> ACAGAGAAGTACGACTCACACGAACAACAGAGCCGGGTAGTTTATATCAATAGGAAAGGC
> CTATCGTAGTCTTATTTAAAATGAACTTTGGAAAACACCTTCAAGACTGAGTAATCAATT
> GTTCGTGGTCTCAACGCTAAGTGTTACAGACTAAAGTGTCCGAACATCTCCTCGGGGATT
> GATCAAAGTGGACCGTCCAATGAATTAGCTCACTGGAGATATTGGGACGGCAGATAACGT
> GCTTTCATTCCATAGAACTTCAAGCAATATAACTCCAACGCGATGAGTCATTCTCATCCT
> TGGTTATTGTATTATAAGTATTTAGATATCGTAATTTCTTTGACGCCAACAAAGTGATCG
> AGTTGGAGGACTACAATTACGGTGATCGCGGACCATCAGAGTCTGAAGATCTAAGGCACG
> TGCGTCTAGGATATCATTAATCACTACCTAGTACAGTCCCCTTAGCCTCTAGATGGTCGA
> TTACGTACGAAGGGCGCGAGCGTGATGTTTGAGTAGGTAATTAAACCCTTAACTAAAGCC
> GCACTCAAATTTTATATGTCCCTACCTGTCGTTTCACACCTAACTCTAGCCTCAAGGTGG
> TACCCGTTCTCGTTGAAGGTCGTCTATAAGTATTCAGATTAGCATCTAATGCGATCTAAC
> TTATATATTAGCACATAGGGACACGCGACCGAACTCCTGAAAAGTCTGATCCCGAACAAG
> TTCGCGTCAATACATAGCGTGAGTGGGCTCGAGAAGGGAGGGGGCGTTTTTGACGAAACT
> TGGAGTCACTAGTGTATGTAAGAGACTGACATTACTCGCACGTCCAGCGTCAGCTTAAGA
> TCGAAAAGCCGGGTATGTTAAACATATTCACTTAACTGAACTTGGAAAAGTATCATTCAT
> TTATGTCACGAGTTTTTCATTGTTGCCACGCTCCACCGAGTATCTTCTAGCAGTTCAGGA
> CCTGAGTATTGTCTCTCGAACCTTTCTTCAAAAATGTGAGAGACATAAAACGATTTGTCT
> CCTAGGATAAATTAGACGTACGTCAGAAAAATTGAGCGAATGGATTTTCTGATCATCTTC
> TCTTAATATTCCAAAGGTGCGAGTGGGTGTAACCACACGCGAATTTGAATAGCGAAATGT
> ATGTCGCCATGCAGAGAAAGTAAGTTTACCATGATGCACGGTCTAGAACTGAATGCCATT
> ATGATATTTAACAGATTCTTTAATCGTAACGGATTATCATATAAAGTTCCGTCGTTATAA
> TCTTCTAAGTTCATTATATGCGTCACAAAGGTGCCGTGAAACCGTGCCATATTGAACATT
> TGCAAGTCAGAAGTAATGAGATTCGTCATTAAAACAGAGTCGGAAATATCTCTTCGCTTA
> GAGACAGCATTAATTTTATTCCTACAGCTTATCATTAGGGTAGTTATACTTCGTGACATA
> TACTCTGCCTAGCCGGTTACCTTATTGGCGACACCAGCTTTTCAACGATACATTAATATT
> AACCGTATTAATTTACTCTAACCCACAAACTAATCGTTATTAGGGGTGTCGGTATAGAAG
> ATGTGAACCCAAAGGGCGGGAGAACATCAGGGAACTCCAAAGTTGCAGAGATAGATGACG
> CCTGTATAGTTTAAGTATAGGTATGTCTAGCCTATTAGTCCCCATACTTATCCAACCAGA
> CAGCCGATAGGAAAGTCCGAATAGTGTATCCGCTAAATTGTACTATGATTCTGGCCACCC
> CAAGCCCATTTCATTAGTCTAGTAATAAAGTTAAGACTTGACAGGGTATTTCCGTCATAT
> AAGAGCTTTGAGAGTAAAACAAAATCCAGTGTTTTTCGTTGAAGGTTTCTCCCTTCCTGT
> TTACTAAGGATCCAAAGTATAATAAAAATCAGGCCAAGTACGAGAATTTACTTATATCTC
> GTGAGTTATAATTGATAGTTGGACTAGACGATAACCCGTAGAATTTCACTGGAGAATGTG
> GCGTATTTCCTCTTACTGATTTTCACTAGGTTAACTGTCAAATTGATATTCAAGCTGGAC
> TATATAATACCTCGAAAATAGGTTCCCTGTCAATACTTTTGTTTAAGTGGTGTAAGGCAG
> GACTCGATTGACGATAGGCAACATCTCGCAACCTGAAAAAGCAGATCATCGTGTCTTATG
> TATAATGAATCCCATCTATTGTTTGTAATATGCGGATTACACGCTGCGAGCAATTTTAGC
> TTTAGGTGAGTTCTAAGTATCGGTGATATATCAACTGTACAGGTCAAACTCCACCCTCTT
> GACATGAAATGAAAGCCGTATAGCTAAATGACTGGTAAGCATTATTTCACTTGGCTTTCT
> ATAGTTACACCGACTCCACATCCGGATTTATTATCTTCTGTTATATCCGTTTAACGCGAG
> TATGGTGTATGTACGACTCAAGGATGTTTTTAACCGCATTGGTATTTGTGAAATCTAAAG
> CGGCTTATGTGCGGGGGTTTTTGCCACGTCTTTATTGTCCACTTTGAACACTTACGCACA
> ATTTTATACTTACATAGATAAATGGTTTGGGGTAGGTGTGAGCCTTACTTCCCGTTAAGA
> CTCACGATCGTATGATTAGAAGCCGGTAATACCGTCTAGACGCAGTCCCTAGGCCTGTAC
> AGACCATCATAGTGTGGGATTCAGGCTTCCGATGTAATACTCCCACGTCAATAACTTGAG
> CAGTGGCCTTTTTCATCCCTTGCTGAACGTATTACGGAACAGTTTTAGTAATACTCCCGT
> AATGGGGATGTCCCTCTCGGGCTTGAACAAAATGTGCGTAGTGGGCCATTAAGAAGCCCC
> TATGGTTAAGAAAACGAAACATCTTCGAGTAGTTCGGGCATCTGCTTTCTTCGGACTTCC
> ACTTTATACAGTTATCGTTTGTTAAACTCGTGAATTCCTACGTTTTTTTTAAGAAGGGTG
> TATTCGTAGAAATTTTATGGAAGTAACGTGTGCGATTGACGGTTTTACAAGCAATGCTCG
> ACGCAGCTAATTACACAAAGTAACTACACATTCACCTTGTTTCATCGTCAAAGTTTTTAC
> ATATTAACCATTTGGTGGTGGATTTCAAGGAATAGCTAGTCATAAGACGCCCGCACAGTG
> ATTATTAGGTCAAGTCATCATGTTTGAGTAGGCCCCTCCCAATCACATAAAGCCGAGATA
> TTTACTTTGTATAAAAGGTCTAAATACAGTATACACAGACAAGATTACAAGGCGCGATGG
> TAGGACACCTCCTCGATGATTCATGCTGCGGAGTATCGGCTGTATAACCCTGATTTTCCT
> GTAAGGCTTCTAGACTTTAATATACTACGACAGAAAACAAAAGGTGTAATAGATAGTCTT
> TAATAACCACTAACATTTCGTCAAGTTACTCATCACATATTTTTTATATGATGGTAGGGA
> CTCAATATTTTTTTTCTTTTACATTTTTTTTGCCATTCTTTCTTGTCCAAGGACGTGCGG
> TCGAAACCATAGGAATAATTACCGTCAATATATTAAAAATGGCCGTAAATAGCGCCGGGT
> AAGGCGGGATAGTAGCCGAGACCGATCTTAGTAAATATAACTTAAACTCCTACGATCCAT
> TAATGAATCCGTGTAGCATATCGACTATGGTGGATAATAAGCGTCACGGACGTCCATAAA
> TGATAAAGTATATGTATGCAGGGCAGCTCCAGCAAATCAGTTAGTTTAAGGGAGGGGGTT
> ACCTAATAAAAAGGATGGGTGACTTTAGTCGCCAACTCAGCATAGCCATTTCTTCGCAAT
> AACAGAACAAATACTGGTGATATGGGGTAAAAACTCATTCTTAGTGTATTGCACTCAGCA
> TCAGGGAAGCATGGTAAATTATACCCAGTTGTAGCTTCGACGTCATCCTTACGGTGGCGC
> ACCCTATGCAGAAGATCGTTCTTGCAAAATGCTGACGCTGTGTCAATCAAAGGGGGGGGT
> CGTGAATCACTATGTGAGAGATCCGTCGAATCGTGTACGCCAGTATATAATATTATTAAC
> TGCATTTGGCTTCCATTATAATCCCTTAGGTGCTACCTACGGATGTATCGTTCATTTATT
> ATGGGCTCTAGAGAAATTACAGTGGTAGCTCTGAGCCTCTTAGCAATTCGTCAAGATTTA
> GGGTCCCAATCGACTCCTTGCGGCGCCCGGTACTTTACTCTTAGTTGTCTCGAAGAGGGT
> GCTTCGCCTCAAAGTTACAAAGATCTTCAGTTGATATGATCGGTAGTCTTTGTGTTCTGT
> TTATATTTCAACTACAGGAGCACGTCGTTTAAGTGGTAAGGTATATGGCTCCAAGCGACT
> GACTATTCTAGCCGCAAAAATACGGTCTTTCGGAGTTAACGTATGTTTGAAATTTTGTCG
> ATCAGGTTCCAGTAGCATAGGCCCAAAGATTGAATCCAATTTTCAATCATTTACGGACAT
> CCTTACGGCTAAATTAAAAATGGAACAAAATTTAAAATCCTATTGCTGCGCATGCACCTG
> GACTCGCACAACGCTGCGGCTCTACGTCCGTCTTATGCGATTCTTTGCCAACCTTATTTC
> TTACCGATAAGCAGGTGAAGAAACTAGTGATTTAAGTACTTGTCCGCGCACAGCCGATAA
> TGGGTCAAGGTTATGAAAACCTCGATAATGATCAATGATAGCACATGTCTGGTTACCGGG
> CTTTAGGCAACCGTGACATATGGTTTCTTGCTCTTCAACTTCGAAGTTCGCTCATTATTC
> AAAGTTCCAGGAGCTCTATATGGCGTATGTGTGTCATTTTAATATACTGAAGTTACCAGG
> CATCACTATAATAGCTTCTACAGCATAAAAGTTCTTTTATTTGGAATAAGTAGGGCTGTT
> AACCGGTCCAATGGGGTATCATAGGTAAGGTTAGCATCAACTCAGCTTAGTTTGTATTCT
> GCCGTCGCAAACTTAGCATATAGGATATCGACTGATAAGTAATCCCACGGTGGAGGTGGC
> GCAATGATCTTTATGCTTGCCACCTGGATATATCTTTAAATGTCAGTTTAGGTCATACTA
> TTAAGATTGTCCCATTTCTAGTAGTCCCTTAAAACAAACTCTATCTATTAGTAAGATTGC
> TTTGAAGAGGCTATTTGCCTACAAGGAGGTTCAAATATGCTCGAAGCAGTTGTTTCGGAC
> TATTAACTAAACTTATGGAAGATGGTATCCATTCGCTAAGAGTGCTATCTCTGGCTTACT
> AAAGAGTTAGACAACTATTGATGTCCGCTCACATAACGTAATATCCAAACGTGTAGACAA
> TAGCAACACTAAACGTATTACTATTTGAAAAATGAATATATTCCAGAACCACGTAGCGCC
> TGGAATTGCCAAGAGCTCTGATGAAGTGAGACAATTGGCTATTCTTATTGCATTGATTCT
> GAAAACGCTAGCTTATCCCCAGTGGAACAAATGAAGGGGAAAGGGTGGGAGGTAGTCACA
> TTGATCATAACAAGTTCGATATTTAGATGGCAGACGTTAGGGTAGGGCAGTAATCGGGAT
> TGGGCTTTGGCTAACGGGAGTTATGTTATAACTTTTCGTTGAGTCGTAAGGATCTCACTA
> TCGCTCCGTGGGCTTTACATACCAGATAAAAAAGTAGACCTGATATGCTCTAGCACTGAA
> TATTTTTAAAAATAATCGGATTTTAATCCAGTGCAACAGATCCGAGGTGCGTTCCATCCC
> TTTTCATTAGCTGGCTTTCATCATATTGTATTGCATTACTTTCTCGTGCAAAAATTGTAC
> TCAGTTTAATAATGAGACGTGTGAGTTTTCTTATATCCCCAAGGTAACAAGTTTCCTTGT
> GTACGGGACACCGCGGTGGAATGCATTGTATATCGATAGCGGTGTAAGATGCCTCACAAC
> GAAAAGGATGACTGTTTCCAATTTCACTCAGAGTAAGACTCGAAGAGCCCTTAATAAATT
> ATATGACCGAATATCCTGAGACCCGATGTTGAATTTATTAAATTGACCACCCTGGATACC
> ACTTTCTGAACTAAAAGATGCGTTTCATTCTTAGGACTGCTTTATTAGGGTTGTAGAGGC
> AGTAAACAGCATAAATAACTCCTACAAAGCATTAGGTTCTGTGATTTCCATGTCGTTAAT
> TAATTTTAAATTAGTTAACTATTTCAAAGGAACTCAAAAACCTTGTATACCTAGTCACTA
> TCGAGGCGTTTCGCATAGGGTATTGCGACTGCTCACTTTGTCAATCGGTAAAATTTAAGG
> GTTTTTACTATGACTGAACAAGGTCTTAATTAACTCAATCCAATCCGGCCTATTAAACTT
> TTGGTTAGAATTCTTCATGCAAGGTCTCTCGGTGAGGTAGCGAAATCCATGTATTAGCTC
> ATGATTGAGCTCTCCAACGATTATAAAACCCATACATCCGAAATCTTATATCAAGCCCAA
> ACTTTAGGATAGAATCTCATTTTGCTTAGGATTGCCCACTGGCAATTAAACTGGTACCAT
> CTACATACAATCCTTTGTTTAAACGCGTGGTCGCTAAAAATATAGCCCTTAATAGGACCG
> GTTATCTATTGGATTGTCACTAAATAAAACATAATTAGACCAAATACGTGGGTGAGTGAT
> CGACGCAATATTACATTTTATTTGAGAACCCATGGCCCACGAGTATTGTGTATCACTAAC
> ATTAACCTGTATACTAGAGGTCACATTTTTATGATACAAGTATTCATCCCGATTCGAAGA
> TGCACATTACGTCTGTTTTTTGGGATATACGTCGATAATATCTTTCTCTGTGAACCCTTT
> GCTAATCAGGAATCCGGGCTATATTTTTTGGATCATCAATTAGTGAAGCGTCGGGCGTGA
> GATGGTATAGTTTCCAACGTCAGTCTTTTCCATGCCTGGTCAGTCCTGTGGACGAAATAT
> TGAACAGTTTCCCCCTGACACTTCCAGGAGTCTATTTGATATCATCGCTAACAATTCTAT
> GTGGTGGTGTATGTATTCTCTTTAGCGCTAGCAAGCCTCATCGTAAAGTATGATTTGGGA
> TTTAGTACTAATGTAAAACTCATCGGCTCACTATGGTGAAGCAGGTAACATTGTGAGCCT
> TCATTCCTTTGACCCTTTTAATCAGTAACACGTCCCTCCAGGATACTGCGGACCTGCGTC
> GTGTAGGATACTAGTAGGACCCCTATGAAGGCTTCAATTACTGATATTAAATTCTAGAAA
> ACCCATTGTGAAAAAATTTCGTCAGTATCAATTAAATAACCTGTTAATGGAGCATGATAA
> TGACATAATTCAAATTTTACTTGCTATGATGATTAACTAGTCGCGATAAAATCGTATCAT
> CATAATGAAACTGATCATCTCACTCGTCACCACCTCGCGAGCAAGTTCCTGGCAAGAGCG
> CCAGCACAAATGCTATAAGCTCGAGGAGTCAGGCCATAACGGAGGATTTCGATGATACGG
> GGGTTGTTATTCTAAGATAAATCTTATTGTGGATGTTTTTTGTACACTCGACTATAAATT
> AAAATAGCTATATAACTCGTGGATGAATTCAACTTGACCAACTGTGGACTAGCATTTTAA
> CTTTAGTCGATCTTCGTCTTCTCAGTAAATTTTGAAGTGACCCTCAATTTCGGACGAGCA
> ATACTCAAGTTTCAAAACAGCGGCGGAAGAGCGTGTCATAATATCGCTTCCTTATGAGCT
> TTTCTTACTTAGATGCCAGGAAACTATTATTTGAAAGAGTCCCGAATACGAATCTGGACT
> ATTGCACAACCATTAAATAAAAGTCGGGTGCTTGGCCAATTGCTGATCTGCTAAGTATTA
> TTTGTGGACGAGTCATGTAGTCCACGGCACCTATAATCAATCATGATTATTAGACTAAAA
> CTTAGGTTAGTCAACACAGTGCTTTGGATAAAACCTTCTGAGTATTGCCTCTATCTGAAT
> AGAGAAGGACGCAATGTGCTAGGCAAAATCTACCGTTTTGTAGATTATTAGATCGGTTTA
> ACATATTTAAAGCAAAGTAAGTTCTACCAAAGATATTTTACAAGTGAAATGCTCACACTG
> TGTATTCTCATCATATTCCGCGATTTTAATGTTGTTAACACAACGATTATTCTGTTTACA
> TTTCGCTCAACTTATACGGAGGAAGTACTGAAAAACCATAAGCCCGTTCAACGTCACTCC
> GCCTTCTTCTTGGGGGATTCGCTGCCAATTTAACTGAACTCAATGTTTCCCCCTGGGTTC
> ATATCATGTGTGAACGATATGGTTGCATTTTAGGATAGATCTCAGCTGTACTTCCACTCG
> CGGACGTTCAGCTGAACTGTATACACAGATCTATACTATGCCCTAACTAGTCGCATCGCT
> TATTCATCTATATGATCACATGCATACAAACAGAAGATCGACTCCAAGAGCCTGTCCTCA
> AGTCTGAGTAAATTTATGGGTGCTAGGTATAATGTCAGAATTGCTGACCAAATGTAAGTA
> TTGGTATTATCAGGGCTACATGGGCGCGACGTCCGCACCTTCATAGCAGTGCAATCGCAT
> TAGGCATGCCGGTAATAGTAATCTACTTTCTTAGTTTAGCATGTCATGAATCGCATATGC
> CAGTGACCTATGGACGACAACCACTCACACAGACATTTCCTAGAAGACTGAAATAGACTA
> ATGTAAGCTCTCAAACTTAAGCGAGATGCAGCTTTTACAAATGGCTTGAGTACCCCTTCT
> TTCCACGCAGTCTAATCAAATAATCAACATATATAATTTTTGAGTAATTCAATGCGCTCT
> ATGAAACGACCGAAATTGCAAATACGATGTAGGTATTTTCACCGTGTTAGCCACATATGC
> GAACGACGTTTGTAACGGTGTACTGCGCCACGCAGCATTATAATTATCCTATAGTACCAT
> TAGAATCTCTTCGTGTAAGCTAATCCATAGCGAAATCCCAACTAAAAACAATTTCAGGTC
> ACTCACCCGGCGGTATATGGATTATGCCTTTACGCTCGGGCAACTCTCCATACAACGAGG
> GATGTCTAAACAATAATTCTATGTGAGAACACAATAAATAATGGGAGAGGGCGAAAATCC
> GATGTGTGGTAGAAAGGATATTTCCCAACGCTACGTTCCGTGAATTGTTCTCCGCAAAGA
> TCCGGTCTACTTTTGAACTGACCAATTTCTGACACATTCCTTTTTAGACCGAGAAGAGCA
> TTGGGTCCCCCTCAGTGTTCGCCAGCGTATTGACGATTAATTTTCATCGTCTCTCTAACA
> ACGTACCTAGTATTTAGGTTATATATACCTCTTCGTCTCGATCGTCGTACATCCAGTTTC
> GAAGGCATAAACACATGATCGTGGATCTCAATGCTGACGAAACACTTACAGTACTAATGA
> GTGGTGTAACATGAACTGACCGGGCAAATGGGGATCTTTTCTATCACTGTCATTCAGATT
> TCCATGTTTCCTCATTAATTTCATATTGTACACCAATTGTACCGATATCTGAACTTTATG
> AATCCATAATTAAGTTGATCAAAAAGCAAGTAAGTCGGTTTCTGTAGACCTCATGGATCA
> CGTGGCAGTCATTCTTTACAGTGAAGGGACTTAATTATGGACACTTTCCATGTACATATT
> ATCCATTCTTGGGATAAAGAGTCTGCCGATAACAAGTCATGACACCCCGTACATGCAGCA
> CTAAGCAAGGTAAAGGACGAACCTAGCACAATGTGATCGGATATTGTGAAATTGACCTTA
> ATGAAGCGACTCGATCAACCTATAGGCTTGCTTTCGTACATTACCGGAACAGCCACGACA
> GTTCACAGAGATTGCCTAACGCCAAGCGGGTGCTTCAGTGGACCAGATGCACTAATGTCT
> TACTAGTTAATCAGTAATAGACATTATTCACAGTTCTTCTAGACTTTCTGTCACGTTTTT
> TCATTTCTCAATGTAGACCAAATAAAGAATGCTGCGATGGTTTTAAACTTTGCAACGACT
> TGACGAAACTAAAGTGTCTATTTGGACCTGAGTCACACTAACAATTCTGCACATCCATAT
> TTTGGAAATCATTCATTGTCCCGAGCAGTAGAGGGTTTCCGGCTAAAACGGGTGTTTCAC
> ATACCGCTTTATATGTGTAGTAGCCATAACTCTATGCCATCTGAAGTGAATGATTTTTAG
> TTTAGAACAATTAATTGTCCAAACTGTAGTTACTTGTGTTATTCATATCACAATTTATAT
> TATACTATATTCGTTAACATTAGGAAACGGGGTCTCGAGGCTCGCAAATAGTATACGAAC
> GGCTCCAGTCGTTCATTCAGTTGTGTAAGATACCATGCTAGAAGCACATTTCAAATACCG
> TCTAACTATCAGAATTTGTATAGAACCGTGACACAATGACTGCCATGTAAAACTTTATAC
> TATCTTCAATCCATGCTGGTGAAATGTTAAGGGAGACATTAAATATTGAATTACCCTGTC
> TATAACTGGTCACCAGCAGATGATTTTTGAGCTTTGGTGAAGGTTAGTATAATCGCGTAT
> TTAGATCCTGAGTTAGTCACTATCAGAATAAAAGAGCTTTACTTTTCCTATTCCTAGGCT
> TGTGTACTTTCCGAGGATTAGGAAACACAACAAGACATGTATTTATTACTCTGACAAATT
> AACCAGCCTAAGTAACGCAACAGTTGTTACCATTACGTGAGAATCCATATTGCTTGCACA
> GGCATGAAAGCTGATCAGACTAGTAGACAACAGTGGTTTATGATGGTAACTATTTAACAT
> GGCTCCAACTTTTCTGACTCTAGCCTGGTAAAAAAGGTGTTGGCAGCTGTATGAAATCGC
> AGCGTATGCCACACGACGGTTTATGTACCTACTATCCGTACACAACCTAAGAAGAAGGCT
> AATGACGGTCAAATGAATATATTCTACTACAATTGGCCTACTCACATAGATGTTTTTTGT
> AAATCATACTACATCGGAAAAGTGGTATTCTTCCGATGGGTGACGATTGTACACAAGGTA
> TTCGATCCTGGACAATGATTTAGCCTCTTGTAAAAGATGTTAGTCAACAAGGGGAGTGTG
> TTTTTGTGCATTGACGGGATGGTAGATTTTACGTATTCACACGCGTGATGCACTCTTCGA
> TCTTATGGCCGACAACGATATTGAGCATGTAATGGTATAATTGTAGCACTAACTTCTGTA
> TCTCATGGTGTCCGTAGTAGTCGTAAAAACAGGTAAGGACTGGCTACTAGTTGTACATTT
> ACTACTAACTTTATGAGCACCAACCGCTTCTCGGACAAGCGAGTAAGCTGTAGAAGAGAG
> AAAGCAAGTATACTAAACTTGATACGATTGGTGTATCGGTAGTATATGATGGAGCAAGAC
> GGAACTTGTCGTCCTGTTATAGTTGATGAGGGCGGTATAAAAGCATATTGATAAATTGAA
> GGAAACAAGACTACACACTCCGAGTTCTCAGTTCTAAAAAGAGAGCCAAATCCGGTGTAC
> CACAACGACGGAAAATCTCAGAGAAACTTCTACTCTGACATAATAAGATAATACTGGCAT
> ACATCCTTAATCATATTAAGCGTTAGTTCTTACCGGGTCCAACTACGTCATTATTGTCCG
> TAGATAATTTGCCCTGCGCAGTGAACGGGCATATAAATATACCTGGGTTATCGATGAATA
> GAATCTTCATAGTTGAAGTATATATCAGAGAAGTACGTCGCAAAACAACATAAGAGAACG
> GGTCTTTTTTTATTGTCCAAAGCACGATACTACTATTATTTAAAATGATATTTGGATAAC
> TCCTTAAAGAATCTGTAATCAAGTGTTCCGGGGCTCAACGCTAAGTCTTTAACAATAATC
> GCTCAGAAAATCGCATACCGCATTGATAATAGTGCTCCGTACATTCAATGACCTCAATGG
> TGATTTGGGGACGGCTGATTACGTGAGTTATTTACATACAACGTAAAGCTTGAGAACTAC
> TAAGACTTCACGCAGTCTAATAATTGCTTATGCTATTATAAGGATTTACATTTACTATGT
> GCTGGGACGCCAAAATAGTCATCCACTTGGAGCAATACAATTACCCGCATAGACGACCAG
> ATGAGTCGGTAGAGATATGCAAAGTCCGTATAGGATTTCATTATGCACGAACTTGTTAAG
> TCCACTGACAATATTGATGCGACTTTACGTACGAACCCCCACACCGTGATGGTGCACTTC
> CTATGTAATCCAGTAACTAAACCCCCTAGCTAATGTTTTATCTACATTCCTCTAGTTTAT
> CTACTATCTCGAGCCTCAACGGCGTACCCCGTCTCGTTCAAGGTCCTATTTTACTTTGCT
> GATTAGATTAGTTTGCGTTCTAACTTATATAGTAGCACATAGCCACAAGACAAACAACTA
> ATCAAAAGGCTGTTCACCAACTTCTTCGACGAAAGAAAGTGACTCTCTGGCCTACTCATG
> CGAGCCGGAGTTTGGCACCAAAATGCCTCTCACTAGGCTTTCTAACTCTCGCTAAGTTAG
> AGCACCTCAAGCGGAACCTTATCTGACTAAACAAGCCTATCTGTATAATAGGCAATTTAC
> TCAAATTGGATAACTATAATTCATTTTTCGCTCGAGGTTTTCATTGGTGACACCATACAC
> CGACTATCTGCTACAACTTATGGACATCAGTTTTGTCGATAGATACTTTAGTCAATAATG
> TGACAGACATAAATAGTTTTGGCTCATAGCATTAATTTCTCCTAAGTAAGATTATTTCAG
> CGAATGCATTGTCGGATAATCGTCTATTAATATTACTAACGGCCCACTCGGGCTTACCAC
> AACCGAAGTGGTATACCGATATCTAGCTCCCCAGCATCACATACGAACTTTACCATCATG
> AAAGCTCTTGATCTCAATGCCATTATGAGATTTAAAAGTTTATGGTTGCGTAACGGTTGA
> TAATAGAAACTTCCCTCCTGATAATCTTCTATCTTAATGATATGACTCACTAAGGTGCCG
> TCTATACGTGACAGATTGAAATTGGGAAAGTCTCTTCTTTGGACATTAGTCATTTAAAAT
> GAGGCCCTAAGAGCTCGTAGCGGAGACAATCATTTAATGTTATTAAGACAGATTATCATT
> AGGGTTCGGTGAAGGCCTGTATTAGAATATCCCTACAACGGTTAATGTTTGGCCTAAACA
> CATTTGCAACGTTAAATTAATATTAACCCTTTTATTTGACTCTTTCACACTATCTAATCC
> TGAGTACGGCTCTACGTATAGTAGTTGTCATCCCAAACGCCCGGACTAAAGAAGCGAACT
> ACAAACTTCCTCACATAGATGTACCATGGTGACTTTAACTATACCTATCTCTAGCATTTT
> TGTCCACATACTGATAAATCCTCACAGCCCATAGGTAAGTCCGATTAGGCTAGACGAGAA
> TTTCTACTATGATTCGGCCCTAACATTGAACTTTTAATTAGTATAGTAATTATCTTTAGT
> CGTGAATGCGTAGTGACCGAATATTACAGATGTGACAGGAAAACTTATTACAGTGTTGTG
> CCTTCAAGGGTTATCACTTCCTGGGTACTAAGCAGCAAATCGATAATAAATTTCTGGAAA
> TGGACCAGATTTTTCGTATAGCTACTCAGTTATAAGTGAGAGTTCCAATACTCGTTAAAC
> CGTTCAATTTAAATCGAGTATGGGCCCTATGGCATATGAAGCTGGTGAAAGACCTTTACT
> GTCAAATTGATATTAATGCTCGACTTTATAATACCTAGAAAATAGCTTCCCGGGCAATAC
> TTTTGTTTAAGTGGTGGAAGGCACCAAGCGTTTCACCTTACCAATCATCTAGATAACTGT
> AAAACCAGATAAGCCTGTATTAGCTAGAATCAATCCCATCTAGGGGTTCTAATATCCGGA
> TTTCACGCTCAGAGCTAGTTTACCTGTTCCTCTGGGATAACTATAGCTGATATAGCTACT
> GTACAGCTCATAATACAAACGATTCAATTGAATGCAATGCAGGAGACCTAAATGTATGCT
> TAGCTTTTTTTCACTTCCCTTTAGAGAGTTACACAGTCTACTCATCCGGATTTAGGTTAT
> TCTCTTAGAGCCGTTGTTCCCGAGGTTGGTCTTGCGACCTCTCAAGGTGGGGTTTATCAC
> AATTCCTATTTGTGTTTGCTTAACCCGATTTTCGCACCGCGTTGGTGCATCGTCTTGATT
> GGACACGTTGTTAAATTACCAACTAGTTTTTTAGTACATAGTTAAAGGGTTGCCCCTACG
> TCTCAGCCTTTAGGCAACGGATGTCTAAAGAGAGTTTGTGTTGAACCCGCGAATTCAGGC
> TAGAAGAAGGCACTTGCAATCTTAAGTCCATAAGAGTGTGCCTTTAACGCTTCCGTGGTA
> ATAATACCTAGTCATGTAAGTCAGAAGTGCCATTTTGAATCACTGCCTCATAGTATTACG
> GAACACGTGTACTTATAATCAACGAATCCCGATCTCCCTCGAGCGAGTCTTCAATATGGC
> AGGAGTCGGACATTATCAACAACCGAGCCTGAACAAAACGTAACAGATGCCAGGAGTTCG
> CCAATCTCCTTGCTTCCCACTGCCAAGTTATACACTTATCGTGTCTTAATCTAGTGAAGT
> ACTACGTGTGTTTTAAGATGCCTGGAGTAGTAGAAATGTTATGCATCTATCCGCTGCGAT
> GGTACCGGTTTATAGAAATGATCGAAGCAGAGAATTAAACTATGTTTCTTCAAAGTCACC
> TTGTGGAATCGTAAATGTTGTTACTTTGTATCAAGTTCGTCGTGCAGTTCTAGCATGAGA
> TACTCTTAACACGCCCGCTCTCTGAGTTGTAGCTATAGTCATCATGTTTGACTAGCCCCA
> TACATAGCAAAGAAACACCACATAGTGAAGTGGTATAATAGCTCGAAAGACAGTAGTAAA
> TGACTAGATTTCAACGAGCGAGGGGACCAAAACTCATCGATGTTTCAGCATCAGGTCTAT
> ACCATGTAGAAACCTCATTTGCCTCTATGCAGGCTACTCGTTAATTTACGTCCTATCATA
> TCAATAGGTGTAATAGTTTCTCTTTATTATAAAATAAAATGTCGTAAACGTACTATTAAC
> ATTTTTTTTATTGCATGCTTGGCAATAAAGAGGTGTTTTCTGTGACATTTTGGTTCCCAT
> GAGTTCGGCTCATTCGACGTGAGCGCCTTAAAATTCGTTTTTTTACCGTCAAGTTTTGAA
> TAATGCCAGTATATAGAGCAGCGTATGCCCGCTGACTAGACGTCAACCATATTTCTTATT
> ATTAATTATAATACTACGATCCTTTAAGGAAGACGTCTAGCATATAGAATATGCTGGTGT
> TTAACCCTCACGCACCTAAATTAATGATTAACGAGAGCTTGCAACGCAAGCTCAAGCATA
> TCACGTAGGTTATCCCACGGCCTTACCTAATATTTACGAGGCCTGACTTGTGTAGAATAC
> TAACAATTCAATGTTCGTCCATTGAACAGATAATTTACTGCTGTTATGCCGGAATATCTA
> ATTAGGACGGTATTCATCTAAGCATAAGGCTACATTGGTTTAGTAGAAACTCGTGTAGCG
> GAGTCGGCTTAAGGTACGTCGCCAAACAGATCAACTACTTCGTTATTGATTAATCCTGAA
> GAGGTCTCAATAATACGCGGCCGTCGTCAATCTCTAGGTCAGACTTCCGGAGAATCGGGT
> AAGCCAGGATTTAATTTGATGAACGGAAGTGCGCTTCAATTATAAGACCTTTGGTCATAA
> AGACGCATCGATACTTCTTTTATTTGGGGCTATACACTTAGTACAGTCGTACAGCTGACA
> ATAGTAGAAATTAGGCAAGATTGAGCCGCCCAATCGAATCCGTGCCGCGCAAGCGACTTG
> ACGCGTTCTTGTCTCGAAGTCCCTCCGGCGACTCAAACTGAAAAAGTTAGTCTGTGCTGA
> TGAGCGCTACGCTTTCTGTTCTGTTTAGATTGCATCTAAAGCACCACGTAGTTTATGGCG
> TTAGGTATATGGCTCAAACCCACGGACTATTAGTCACCAAATAATTCGCGCTTTCCCTGG
> TATACTATGTTTCAAATTTTCGCCATAAGCTTCAAGGACAAGAGCCACAATGTGTGTAGA
> AAATTTGCAAGCAGTTTCGCACTTCATGACCGCTATAGTAAAAATCGTAAAAATGGTTTA
> AGCCTTTTGCTGCCCTGCAACCGCGACTCGAAAAAAGATGCCCATCGTACTCCGTATTTT
> GACATTCGGTCACAACCTTTTTTCGGACCGATATGAAGCTGAAGTAAATACTCAGTGTAG
> GACTGCTCAGACCACAGCCGATTATCGGTAAACGTGATCTAAAACTAGATAATCATAAAT
> CTGACAACATGTATCGTTTCCCCGCTTGACGCAAACGGGAAAGTTGGGTTCTGCCTATTC
> ATAGTACAAGTTAGCGCATTATTCAAAGTTCAAGGAGCGAGATATGGAGTATGTCTGTAA
> TTTTAATAGACTCATCTGTACACGAATCACGATATGAGCGGCTAATGCTTAAAAGGTCGT
> GTAGTTCGTATAAGTACGGAGCTTATACGGGAAAATGGGCGATATTACCTAACGTGTGCA
> GCAAATCAGAGTAGTTTCGATTCTCACGGCCCAAAATTAGAAGATACGATAGAGACGCTT
> TTGGAATACCACGGTGCACCTCGAGCAATGAGCTTTATGCTTGCAACCTGCATATATCTT
> TAAAGGGATCTTTTCCGCTGACTAGTTACTTTGTCCCATGGCTACTAGTCAATTTATACT
> AACGCGAGCTATGAGTTACATGCAGTTGAACTGGAGTTGTCCATTCTACGACCGGCAAAT
> TGCCGCGTAGCACGTGTTTACGAATAGGAACTAAAATGTTCGAAGAGGGTTTAATTTAGA
> GTACACTGAGAGATATCGCGTAATAATGTGGTACAAAAATATGCATGTACCCGCAAAGTA
> AGTTTTTTCATAACCTGTAGTCAATAGCAACAATTATCGTATTACGATTTCAATATGGTA
> TTGATTAAAGAAACACGTAGCGCCTGCATTGGACTTGAGAGCGGATGAAGTCAGACAATT
> GCATAGTCGGATTCCTTTGATTATCTAAACGATAGATGTTACCCAGGCCTTAAAATGAAC
> CGCAATGCGGGGGAGGTTGGCTCATTGAGCATAAATTCGTCCATATGTTGATCCCACTAC
> GTTGCGTAGGGCTGTATTAGCCATTCCGCTTTCGCTAACGCGTGTGATGTGTGATCTTGT
> ACGTGAGTCGTAACGATCTAAATTTCGCGCACTGGGATTTTAATAACAGAGAAAAAACTA
> CACATCATTTGATATAGAAATCAAGATTTTTAAAAATATTACCATTTTTTTACAGTCAAA
> CAGTTCAGACCTGCCTTACTTACCGTGTCAGGTGCTGGCGTTAATAAGTTTCTATTCAAT
> TACTGTCGACTGAAATAATTCGTATCAGTGTAATAATCTGACGTGTGAGTGTTCTTTGAT
> CACAAACCGTAAAACTTTCCGTCGCTAACGCACACACCCGGGGAAGGATTTGTAGATCGT
> TACAGGGGTATGAGCCCTATCTAACTATTCGTGCTATGGTTCCATTTTAAATCAGACTAA
> CAATAGAACAGCCATTAAGAATGTTTAGGACCGAATAGCATGACACCCCATCTTGAATTT
> ATGATATTCTCCACAATGGATACAAAGGTCTCTTCTAAAAGTGGCCTTTCATTCGTACGA
> CGCCTTTAGTTCCGGTCGAGACGAAGTTAACTGCATAAATAACTCATACATTCCAGGAGG
> TTCGCGGATTTCCTTGTCCTTATGTAAGTTTAAATTACTTAACGTTGTAAATGGAACGAA
> TAATCATTGTATACAGACGCTATAGAGTGGACGTTCGCATAGGGTATTGCGTATGATCAC
> GTTCTCTATCGGGTAAATTGATGGGGGTGTTCGATGACTGAAATTGGGCGTAATGTAAGA
> AATCATTTCAGGAATATTAATATGGGCGGTACAATTATGCATGCTAGCTCTCTCGCTGAG
> GTTGAGTATGCCTTCTAGGACCTAATGATTGTGCTATACAACCAGTATATAACCAATAAT
> TCACAAATATTTTTGCATCCAAAATCTGTTGCAGTCAATATCATTTTCCTTACCATTCAA
> CTATGCATAGTTAAATGGTTAAATCTTCATACAAGAATGGCTGGAATCCCGGGGTCGAGA
> TATATATACCAAGTTAGAGGAACGCTTATCGATTCCATTGTCAAGAAATAATAATGTTTG
> TCTAAATTTACGTCGCTCTGTGATAGACGATAGATGACTTTTTATTGCACATCCCAGCCC
> CAACCACGATTGTGTATCACTAACTGTTTAATGTTTAATTCAGCGATCTTGTTTATGTGA
> CAAGTATTATGACCGATTACAACAGCCAAAGGACGTCTCTTGTTTGGGATATACCTAGAG
> TATATCTGTAGCTGGCAACCCGTTCCTTTTAACGAATACCGGCTATTTTGTTTGCTTCAT
> CAATTAGTCAACACGCGGGCCTGACTGGCTATAGTTTACATCCTCAGTATTTTCATGCAA
> GCGTCACTACGGTGGTCGTTATATTGATAAGTTGACCAATGAAAATGACAGCTGTCTATT
> TCAGTTCTTCCCGATCAAGGAGTTGTCCTGCTCTTTGGTTTCTCGGTACCCCGTGCAACC
> AGCTTCGTTAAGTTTGTTTTCCGTTTTTCGACTAATCTAAAAATATGACGCTAAAGATCG
> TCAAGAAGCTAAAAGTGGCAGCCTTCTTTCCGGTGAACCTTTGTTTCAGTAAAAACGCAA
> GCCAGGTTACTGCCCACATGCGTAGGCTACGATTCGAGTAGGAACCCTTTCTAGCCGTCA
> TTTACTCAGATTAATGTCTTGAAAAAAAATTCTGAATTTATTTACGAAGTATAAATTAAA
> TAAAATGTTTATGCTCCTTGATAAGGACTTATTTCAATGTTTTATTCCGATCATCATGAT
> CTAGTCCAGATATAATCGTTGCTTCATAAGGTATCTGATATTCTCACTCGGCACCTCCTA
> GACACCAAGTTCAGCGAATGACACAATGATCAATGGCGATTTCATAGTGCACTCTGGCCT
> TAAAGCTGGATTTAGAGCATTACCCCCTGGGTTTTCTAACATAATTATGATTGTGCTTGT
> TGTTGGTACTATCGACTATAAATTAAAATACCTTTATAACTCGTGGTTGAAGTCAACTGG
> ACCAAATGGGCACTACAATTGTTAATTGTCTCCATAGTCGGATTCTAACTAATTGTGCAT
> GTCACCATCAATTGCGGACCTGCAATAATCAACTGTCTTAAAAGAGGCCGAAGTGACTGT
> CATATTATAGAGTCCTTTGGTGATTTTATTAATTAGATGCCAGGTTAATAGTTGGTGAAA
> GACTAACGAATACGAATCGGCTATATTGAAAAACCATTTATTAAAAGGAGGGGGATTCGA
> ATTTTGCTGTTATGCTTAGTATTTGTTGGGCAAGAGTATTGTAGTACAAGGAACCGATAA
> GAAATCATCATTATTACACGTAAAATTACGTTTCGCATAACACTGATTTGGAGAATACAT
> TCTGAGTAGGCCATATTTCTGAATAGACAAGCTCGCTATGTGCTACCATTATTCTACCCG
> TTTGTTCATTATGAGATCCGGTTAAATTATGGAAACAAAAGGTAGTTATAAAAAAGAGAT
> TTGACAACTGAAATCAGATCACTGGGTTGGCTAATCAGATTCACCCAGGGGTTTGTGGTT
> AACACAACCATTAGGAGGTGTTCATTTACATCAAATTTTTACCACGTACTTAGGAAAATC
> CAGAAGCACCTTCAAACTCTCTACCCATTCTTCGTGGGGCATGAGATGCAAATTTAACTG
> AACTCAAGCTTGACACCTCGGGTATTAGCTTCTGGGATCGATTTCGTGGCTTTTTAGGAT
> AGAGATCACCGCTAATTCCACTCGCGCTCGTTCAGCTCTAAGCTTGTATCACATCGATTA
> TTTGACATAAATAGGCGCATAGCTGTTTCATCTATTGGAGCTATTGAATTATATCAGTAC
> ATAGTCTCAATCACCCGCTCATCAAGTATCAGGTTTTTTATGGGTGATAGCGATATGCTA
> ACAAGTCATCAAAAATTGTAAGTATTCCTATTTGCAGCCCTACAGGCGACCGTCCTAAGC
> TCATTCTTACAAGTGAAATCCAAGTACGCATGCCGCTAATACTAATCTAAGGTATTACTG
> TACAATGGCATCTAGACCATATGCATGTGACATATGGACCTCTAACACTAACAAACTAAT
> TTCAGTCAAGACTGAAATTGAATAATGTTTGCTATAAAACTGAAGCGACATCCACCGGTT
> ACTAAGGGCTTGTCTACACCTTAGTTCCTCGCAGTAGAATCAATTTTTAAAAATATTTAA
> GTTTTCAGGAATGAAATGCGAGCTATGAAACGTCCCAAATTCCTTAGAAGATGTACGTTT
> GTTCACACTCGTAGCATCAGATCACAAAGAAGTTTGGATAGGTGGAATGAGCCACGATCC
> ATTATAATTATAAGATAGTTCCATGAGTATAGAGGCCTCGAACCTTATCCTTTGAGTAAT
> CACATCGTATAAAATGTTCAGCGCACTCTCCCCCCGGGATATGGTTTTGCCAGGTTACCT
> ACGCAAACTCTAAATACAAAGAGGGAGCTATATAAAATAATGAGATCTGTCATCAAAAGA
> ATTAATCGCACACCGCCAAAATCACTTCTCTCGGTGAATCGAGATTTACCTACCCTAAGG
> TAACTCTTTTGTTCTAAGCAAACATCACGTATACTTTGCTTCTGACAATTTGAGGAATAA
> TGCCTTTTTACTCCGACAACAGAAGGGGCTCCCACTCACTCTTAGAAAGAGGATTGAACA
> TGAATTTTCAGCCTCTATATATATACCTTCATAGTATTGACGGGAGATATACCGCGGCGT
> CTAGATACTCGTAAAGCCAGTGTACTTCGCAGAATCAATTCATACTCCATCTCTATGATG
> ACGAATATAGGTCAGTTCTAATGTGTGGTCTAACTTGTACTCACCGGCAATATCCCCATC
> GTGTATTTCACTCTCATTCACATTTCCATCGTTACGAAGGTAGGGCTTTTGGTAAACAAA
> GTGGACCGATATCGGATCTTTATGTATCAAGAATGAACGTCAGCAAATACATACGATGTA
> GGTTTAGGTACACCGCATGGATCTCCTCGCAGTCATGATTGAAACTCATCGGACTTTATT
> AGCCAATATTGCCAGCGTCTTATTATCCATTCTTCGGATAATCACTCTGCCGTGTTAAAG
> TCAGCACACCAAGGAAAGCCACCACTTACAAAGGTAAAGCACCATACTAGCTCAATGGGA
> GCCCATTGGCTGAAATTCACCTTAAGCATGACTCTAGATAAACCGATTGCCTTCATTTAG
> GTCAGTTAAGGAAAAGACAAGAAACTGCACTCTCATTCACGAACCCCAAGACGGGCCTTC
> AGTCCAACAGTTGAACTATGGTCTGAATAGGTATGCACTAATACACATTAGTAACACGGC
> TTATAGACGTGATGGAACGTTGGGGCATTTATCAATCGACACCAAATATTCAATGCGCAC
> ATGCTGTTAATAGTTGCATAGTCTTGACCAAACTAAACTGTATAGTTGCACATGACTCAC
> AAGAACAATTAGGCACATCCATATTTTCGATTTCTTTCAGTCTCACGAGCAGGAGAGGCT
> TGAACCAGTTAACGCGTCTTGCACATACCGATTTAGAGCGGTAGTACCAATAACGCTTTG
> CAATCGCTAGTGATGGTTGTGGACTGTAGATATATGATTTGTAAATTATCTTGTGACTTG
> TGTTATTCTTAGCTCATTGTATATTAGTCTAGTGTCGTTAACATTACGAATAGGGCTCTC
> GACGCGACCTAATAGTATAAGAAAGGCTCCACGCCTTAAGGCTGTTGTGGAAGAGAACAT
> CAGTCTAGATCAGGTCATATAAACTCTTACTATCACTATTTCGATAGATAAGTCTAAAAT
> GCACTCCAATCTAATTCTTGATTATAGCTTATATAAAGGCTCGGGTTAGCTTAAGCCTGA
> CATGTAATATGGAATTACACTGTCTATAACTGGTCACCAGCAGTTGAGGTTTGAGATTTC
> GTGAACGTGACTTTAATAGCGTAGTGTGATCCTCTCTTAGGCTCGATCAGAATAATAGAG
> CTTTACTGTTCCGTGGAATACGATTGTGTTATGTACGAGCATTACGTAACAAATCAAGTA
> TTGTAGTTATTACTATGAATATTTTACCAGCATATGTAACGAAAAACGGGTGACCTGTTA
> CTGACATGCAAGAGGGATTGCACACGAATCTAACATCTGCAGAATTCTAGACAAAACGCC
> TTGATCAGCCTAAAGATTTAAAAGCGCTCCAACTTGTATGACTAGAGAATGGTAAAAATG
> CTCGGGGAACCTCTTGGAAATAGCTGACTATCACTAACGAAGGGTGATGTTAATAATATA
> AGTTCAATAAATAACAACAACCATATTCACCGGAAAATCATTAGATTCTTAGACAATTCG
> CAGAATCACATTCATGTGGGTTCTAATTCATAAGTAATCGGATTAGTGCTATTATTCCCA
> TGGCTGACGAGTCGTCACTTGCTATGCCATAATGGAAAAGGATTGAGAAGCTTCGAATAG
> TTCTGACTCAAAATCCGCACGGGGTTTTTCTGCAGTGACGCCATGCGAGATTGTACGGAT
> GCTAACGAGGCATGATCGCTTACAGATGATGGCCGTAAACGATAGTCACCATGTAATGGT
> ATTAGTGTAGCTCTATATGAGGGATAGCATGGTGTCCCTACTACGCCTTATAACAGGTAT
> GCACGGCCGTATTCTGCGAAAGGTACTTATAACGTTTTGTCCTACAAAAGCTTCTCGGAC
> TTCAGAGTTAGCTGTAGTACTGTGATACATAGTTTTATAAACGTGAGTCCATTCGTCTAG
> CGGTTCTATTTCATCCTCAATGACCGAACTTCTCGTACTCTTATTCTTGTTCTCCGAGGG
> ATATAACCAGAGTCATAAAGTGAAGCATACAACACTACACACTCCCTGTTCTCACTGATA
> AAAAGACAGCATTATAACGGCTAACACATACACCGAAAATATCAGACTAACTGCTACTCT
> CTAATAATTAGATAATACTCCCTTAATTCATTAATCATATTTAGCGTTTCTGATGAAAGG
> CGCCATATTAGTCATTAGTGTCCGTAGTGAATTGCACCGGAGCAGTCAACCGGAATATAA
> ATATACATCGGTTATAGATCATGAGATTATTCATTGTTGATCTATATATATGAGAACGAA
> CTAGAAAAACATCATATCACAACGGGTCTTTTTTGATTGTCCATACCACGATACTACTAT
> GATTTAATTGGATATTTGCATATCTAATGAAAGTATCTGGTATAAAGTCGTACGCCGCTC
> TAACATTAGGCTGTAACAATTTTCGCTAACAAAATAGAAGACCCCTTGGAGAATAGTCCT
> ACGTACATGCAATGTCCTCTATCCTCATTGGCGCAAGCATCATTAAGTGAGGGATTTACA
> TACTTAGGAAAGCTTGTGAAATAATTAGACTTCACGCTGGATAAGAAGGCCTGATGCTAT
> TTGTTCGTTGTACAGTTACGATGTGATGGCACCAAAAATTTCTCAGACTCGTGCAGCAAG
> ACTTTTTACCGCAGACACCACCAGATGACGCGGTAGAGATATCCATACGCCGGATTCCAG
> TGAAGTATGAAAGAAATTCTTATCTACACTGACAAGAGTGATCCGACTTTAAGTTCCTTC
> CCACACTCACGCTTCGTGCACGTCCTTTGGAATAAAGTAACTTTACAACATAGATAAGGT
> GTGTTCTAAATTCAGCGACTTTATATACGTTATAGACAAGCTTCGGCCGAAAACGGAGAC
> TTCATCGGACTATTTTACTTGGATGATGACATTAGTTTCACTGAGAAAGTAGTTAGGACA
> TCAGACCCAAAACACAAACATCTAATCTAATGGATGTTAAACAAATTCGGACACGAAAGA
> AAGTCACGCTCGCCCAGACTCATCCCACCCCCACGTTGGCAACAAAAGGCCTCTATCTAC
> GCGTTCTAACTCTAGCTATGGTAGACCAACGCAAGCCGATCATTTTCTGACTTTACAACC
> CTATCTGTTTAATAGGATAGGTAATCAAAGTCGATAACTAGAAGGAATTGTTCGATCCAG
> GTGGGATGTCGGCACTACAGAAAAAGACGATATGAGTCATCTTATCCACATCACTTGTCG
> CGAGAGTTAAGTTAGTCAATTAGCTCACACTATTTATTACTTGTGGAGAATACCTTTATG
> TTCTACTTACTAACATTATTGCAGCCTTTGCTGTGTAGCTTAATAGTATATTAATATTAA
> TTACCGCACTCTCCCGCTTTACTAAACACAAGTGCTAGTCACTTTTCTTGCTACAAAGCA
> TCTCATACGATCGGTTAAAGCAGGATAGCTATTCATATCTTGCCAAGTTTCAGTTTTTAA
> TCTTTATGGTTGACGAAAGCTGGATAATAGTTTCTTAACGACTGATTATATTCTATCTTA
> ATGTTAGCACGAAATAACCTGAAGTCTATAAGTGAATGTTGCAAATTGGGAAACGATCTT
> CGTTGCTCATTACGAATTTAAAATGTCGACCTATGAGATAGGACAGGACTCTATCATGTT
> AGGGTAGTAAGAATCATTATCTGTACCCTTCGGTGTAGGCCTGTATTAGTAGATCAATTC
> AACCGTTAAGGTTGCCACTAAAATCAGTTGCTAACTTAAAGGATGTTGTAAACTTTTTTT
> TGACGATTTCAAAATATCGTTTACTGTGTACGCCTCTACCTTTACTAGTGGTCTTAAATT
> ACCCCCCGACTTAAGAACCCTAAGAATAACGTCATCTCTTACATCTACAAGCGTGACTGT
> AACTATTCCTATCGATACAATTGGTCGAAAATGTAGGAGAAATCCTCACAGCCCTTTGCT
> ATCGACGATTAGGCTAGACCAGTATTGCTAATATCTTTAGCCCCTAAAATTCAACTTTTA
> TGGACTATACGTATTATCGTTACTAGTCTATCCGTAGTGACCGATTATTTCACAGGTGTC
> TGGAATTATTATTACTCTGGTGTGACTTCTAGCGTTAGCAAGGAATCGGTAATAACCTGA
> ATATCGATAAGATATTTATGCAAATCGACCACTTTTGTCGTATAGATACGCACTGTGAAG
> TGAGACTGCCAATTCTAGTTTTAAACTTCATGGGATATCGACTAGCGCCACGTTGGAATA
> TGAAGCTGGTGAAAGACCGTTACTCTAATTTGCAGATTAATGATCCAAGTTATATGTAAT
> AGTTAAGTCCTTACAGGGAAAGTCTTTTCTTTTTGTCGGCGATCCATCCAAGCCTGGCTA
> CTGTCCAATATGCGACATTAATGTATAACATGATAAGACGCTAGGAGCTAGAAGCAATAA
> CATAGTGGCGGTCTATTAGCACCAGTTAAACCGCAGAGCTAGTTTACAGGGTCCTCTCGG
> AGATCTATACCGCATATAGATAATGGAAACCGATTAATAATAACGATTCTATTCTTTGCA
> TTCAACGAGACCTAAAGCTATCCGTTCATGTTTGTCTCGTCCATTGAGTGTCGGAAAAAG
> TAGAATAAGCCCCTTTTAGGTTAGGATCTTTGAGAACTGGTTACCGACGTTCCTCTTGCG
> TACTAGAAACGTGCGGGTTTTAACAATGCCTATTTCTCTTTGATTTACACCATGTTCGCA
> CCCCCTTGGGCAATCCTATTGTTTCGAATCGTTCTTATATTAACAACTAGGGTTTTAGTA
> ATTTCTTATTGCCTTGCCCCTACCGCTCACCCTTTAGGAAACGGATCTCTATACTGAGTT
> GCTGGTCTACAAGCGTATTAACGATTGTACATGGAAATTCCAATCGTATCTCAATAAGTC
> TCTCCCTGTAACCCTTCCCTGCTTTGAAGAAATAGGAATGTAAGTCACAACTGCAAGTTT
> GAAGAAAGGCCGCTTAGTAGTAACCAAATCGGGTACGTAGAATAAACGTATCCCCTGCGC
> AAGAGAGCCAGTCTTAATTAGCGCACGAGTCGCACAGGATCTACAAAAGAGCCGGATCAA
> TAACTATAAGATGCCACGAGTTACCCAATATCATTGATTACCTAGGAAAAGTTAGTCTCG
> TTGAGTGTCTGAATAGACGGAAGGAAGTCGTGTGTTGTAACATGCCTCGAGGACTTCAAT
> TGGTATCCTTCGATACGCTCCCAGGGTACCGGGTTATACAATTCAGACAACATGAGAATT
> AATATATCTTTAGTAAAAGTAAAAGGGTGGATTAGTAATTGTGGTGAATTTGGATAATGT
> TCCTCCTGCAGTTATACCATGTGATACGATTTACACGAAACATCTCTGAGGTGTACCTAT
> ACTAAGCTTCTTTCTCTTGCAAAATACATAGAAAAGAAACAACACATTGTGAAGTGCGTT
> ATTACCGAGAAAGTCACTTGTATATCAATAGAGGTATTCCACACAGCGGACCAAAAATCA
> TACATCTTGATGCAGCACCTCGTTACCATCTAGATAACTCTGTTGCCTCGTTCCAGGATA
> CTAGTGAATTTTAGTCCTATCTTTTCATTACCGCTAAGTGTTTCTATTTATTTTAAAATT
> TAAGGTCGGATACGGTCGATTAACTTTTTTTTGTTTGCTTCCTTGCCTATAATGAGGGGT
> GTGCTGTGAATGTGTGGTGCACATGAGGTAGGCGCATTCCACCGCACCGACTTAAATTTC
> GTTTTTGTTAACGATAGTTTTGATTATTCCAACGTTATAGACAACCCGATCCACCCTGAC
> TACAACTCTACCATATGTCTTATTTTTAATTATAATAATAACATAATGGAAGCAAGAACG
> CTACCAGTTAGTATAGCCTCCTGTTGTTCCCGCAACCAACTAAAGTAAGCATTAACGAGT
> GCTTGCATCCCATGCTAAACCATATCACGTTCGTTTTCCCACGCCCGTAAATAAGATTTA
> CCAGCCCTCAATGGTCGACAATACTAACATTTCAATGTTAGTCCATTGATCACTTATTTT
> ACTCCGCTTAGGCCCGTATATATATGGAGGTCGCTTTTCATAGATCCAGAACCCTACATT
> CCTTTAGTAGTAACTCGTCGACAGGAGTACGCTTAAGGTACCGCCACAAAAAGATCATCT
> TCTTACTTATTCATTTATCATGTAGAGGGCGAAATATTACCCCCCCCGCCTCATGATCTT
> GCGCACACTTAACGACTATCCGCTAACAAACGTGTTATTTGGATGTAAGCAAGTGCCAGT
> CAATGATATGACAGGTCCGCATAAAGAACCATCGAGACGTCTTTTAGTTGGCGATAGACA
> CTTAGTTAACTCGTACAGATGACAATAGTTCATTTGACGCTACATTGACCCGAAATAGCC
> TATAAGGCACGACAAAGCGACTTGTAGAGTTCGTCGATCCTACTCCCTCAGGACAATAAA
> ACGGAATTACTTAGGATCTGCTGATGTGACCTACGCGGGCTCGTCTGGGGTGAGGGCTTC
> TTAAGCACATCGTACTTGTTCGCCGTACCTAGAGCCAGAATACACACGGTAGTTTAGTCA
> ACATATAATTACCGATGTACCTGGTTTACGATGTGTCAATTTGGCGACAGATGCGGAATC
> GACAAGACCAACAATCTGTCTTGAAATTGTGAATGATGTTTAGCACTTAAGGACCCATAT
> TGGATAAAGCCTTAATTTGGTTTTAGAAGTGTCAGCACATGCATACGCCACGACATAAAA
> CATGCCCAGAGTACGACCTAGTTTCACTTTAGGTCACAAAATTTGTTAGGAACCTGTTCA
> ACCTGATCTTAATACGCAGTGTACGAATGCTCAGACATAACCAGATTTTCGGTAATCGGG
> ATCTTAAACGACTTTAGCATAATTCTGTCAACATCGAGCGGTTACCCCATGGACCCAAAC
> GGGTAAGTGCCGTTAGGCAGAGTAATAGTACATGTTACCGATTTATTCAAACGTAATGCA
> CCGAGTTTGGCACGAGCGCTCGAATGTTTATTGTCTCTTCGGTAAACCAAGCTAGTTATG
> ACAGGCTTATCATTAATACGTAGGGGAGGTCCTATATCTACCCAGCTGTTACCCGAATTT
> CCGCGAGATGTCCTATCCGGTCATGAAAATAACAGGTGTGTCGATTAGCACGGCCAAAAA
> TTTGATGAGTCCTTTGACAAGCTTTTCGAAGAAAAACGTCCACCTCCAGATATGAGCGGT
> TTCAGTGAATAATCCTTATTGATTGATAGCGATCGTGTCCGCTGAAGAGGTTCTGGGTAC
> CTTGGAGTCTTCTAAAGTTATACTTACGAGAGATTTGACTTTCATGCAGTTCAACTGCAG
> TTGTCAATTCTTCCACCGGATAATTGCCGCCTACAACGTCGTTACCAATAGGAACTATTA
> TGTTCCAAGTGCCGTTAATTTACAGTTCTCGCAGAGATATCCAGTTATATTGTCGGACAA
> ATATAGGCAGCTAACAGCAAAGTAAGTTTGTTAATTAACGCTTGTAATGTGCAAAAATTA
> TACTATGAAGTTGTCAATTTGGTTTTGTTTAAAGAAAAACCGAGACACTCCATTGCAATT
> CTCAGCGGATGTACGCAGTAATTTCCAGTGGAGGAGGCATTTGATGATCTATTACATTCA
> GGTTACCATCGCCTTAAAATCAACCGCAATCCCGCCCTCCGTGGATATGGCAGCATTTAT
> TCGTCCATTGGGTGTGCCAACTACGTTCCCTACCCCTCGATTACCCTTTCCCCTGTCCCT
> TTACCCTCTGAGGTGTGATAGGGGACGTCAGGCGGTTCCTGCGATATTGACAGAACTCCC
> AGTGTATTAAAACAGAAATAACTTCAAATCTGTTCATATACATATCAAGTGGTTTAAATT
> GATTACCATGTTTTTAAAGTCAAAAAGTGCACTCCTCACTTAATGAACGTGTCTGGTCCT
> CCCGTTAAGAAGTGTCGTTTCAATTTATGGAGACTGAATTAAGTCGTATAACTGTAATTT
> GCTCAACTCTCACTGTGCTTTGATCAAAAACCGTAATTCTTTAAGTCGCTTACCCTCACA
> CACCGCGATGGATTTGGAGTGCGTTACACCGCGATCTGCAATATATAACTATTCCTGCTA
> TGGGGCAATTGGAAAGATCTCGTTCAATACTACACAAAGTAAGTTTGTTTTGCAAACTAT
> TGAATGTCAAAACATCTTCATGTTATGATAGTCTCCACAAGCCAGAAAAAGGGCTCTTAG
> TAAACTGCACTTTATTGAGTACGTAGCCTTTTGTTCCCGTCGACTCGATCTTTTATCATG
> TAAGAAATAATAAATTCAAGGTCCTTAGCGCATGGAATGCGCCTTATGTTAGTTGAAAGG
> ACTTAAAGTGGTATATCCTTAGATTAATAATGGTAGAAAGACGATATAGACTCCACGGTC
> CCAGTCGCTAGGCACTAGCATAACGGGCGCTATACGGTTATGTGTTCCCGGTGTTCGTGC
> AATCAAATTCCGCGTTATGTAAGAAAGAATTGAACCAATATTAATAGGGGCCGGTCTATT
> ATGATTCATTCCTCGAGCCCTCACCTTGAGTATGCCTTCTAGGACAGAAGCATTCTGATA
> TAAAAACAGGAGATATAAAATAATTAACAATGAGGTTTGAATCAAAATTATGTTCCTGTC
> AATAGCAGTGTCATTTCCTGGCAAATATCCATAGTTTAAGCCGTAAATCTTATTAAAAGA
> AGGGCTGGAATACAGGCCTCCAGATATAGATACAAAGTTTGTCCAAACCTTAGCGTGTCC
> AGTCGAAAGAATGAATTATGTTTGTCTAAATTTTCCTCCCTCTCGCAGACAAGATTGAGG
> TCTTTTGTTTGCACATACATGCCCCATACACGATGGGCTATCAAGATATGGTTAAGCTTT
> AATTCTGCGATCTTGTTTATCTGAATAGTTGGATGAACGTGGACTACAGCAAAAGGAACG
> AGCGTGGTTCGCAGAGAACGACAGTATTTCGGGAGATCGCAAAAAGTGCAGTTTAACCTA
> TAACCCATATTGTGGGGCCTGAAGAATGTAGTCTACACGCCCCACTCTCTGCCTATTCTG
> TAATTCCTAACGATTTTCATGCAAGCCTCTCTAAGCTCCTACTTATATTGTTAACTTGAA
> AAATGAAAAGGACTCCTGTATTTTTCTGTTCTTACAGATATTGGAGTTCGCCTCCTCTTG
> CGTTTCTAGGTACCCAGTCCTACCAGATTACGTAACGTGCTTGTCCCTTTTTCGTATAAG
> CTTAATAGATGACCCTAAAGATCGGCAACATCCGATAAGTCGCTCCATTATGTCAGGTCA
> AAATTTGTTTAAGTATAAACGCAAGACAGCTTTATCACCACATCACGACGCTACCAGTAG
> TCGAGCAACCATTGCTACCCGTAATGGAAGCAGTGTTTTGTCTTGTATAAAAAGGCTGAT
> TTTTGTTACGATGGAGAAATGAAATTTAAGCGTTAGCCTCATTGATATGGAATTTTGTAA
> ATGGGGTATTCAGATCATCAGGATAGTCTCCACAGTTAAGAGTTGATTAAGTAGCTATAG
> CTTATTCTATCTAGGAAAATCAGAGACACAATCTTCAGCGAATCTCACAATCATAATTGC
> CGTTTTCATACTGCTCTCTCCAATGAAACCTCCTTGGACTGCAGTACCCCCTGCGGTTGC
> TAACTTAATGAGGATTCTCCTTCTTGTTGCTAATAGCCAATATTATTGAAAAGTCATTTT
> TATATCCTCCTTCTTGTATTATGCACAAAATCGGCACTACAATGGGTTATTGTCTACAGA
> GTACGATTATAACGATTTGTGCATCGCACCATCATTTGACCACCTCAAATAATCAACGGT
> CTTATAAGACCACCAACTCACTCTAATTTTTGAGAGGAAGTTGCTGAGGGTATGAATGTC
> AGCAAACCTTAAGTGTTGGGGAATCACTAACCTAGACCAATCGCCTATATTGAAAAAAAA
> TGTATGATAAGGACCCGCAGTCCAATTTGCCGCTGAGCATTACGAGGTGTTCGCCAACAC
> TATGCTAGTAAAAGGATCCGATAAGAATTCATCATGTTTTCTAGTTATATGACCTTTCGA
> ATAAAACGCATTGCCTGAATTCAGTATGTGTAGGCAATATTTATCTTTTCACTTCCTACA
> TTGGTCAGACCATTATTCGACACGTGGCGTCATTTTGTCATACCGGGTAATGTTGGAAAC
> AAAACGTACTGATAAAATACTGAGTTGTAAACTCTAATCAGATAACGCGCTTGGATATTA
> AGATTCACACAGGGGTTTCGGCTGTAAAAAAACTTGTGGAGCTGTTCTGGGACAGATAAG
> TTGTACCTCGTACTTAGCTAATTAATGAACCAACTGATTACGATAGAACAATTCTGAGGC
> CGCCAGGACAGCCAAATTTTAATCTTATAAAGCTGGAAACAGCCGGTATTAGCTTCTCGC
> ATACTTTGCCTGCATTGGTACCTTACAGATATCAGCGTAGTCATATACACCTCGGTCTCA
> GCTAAGCTTGTATCTCTTAGAGTAGTTCAAAGATAGTGGACAATACCTGTGGAATCGATT
> GCAGATATGGATTTATTTAACTACTGAGTCTCATTCACAAGCTAAGCAAGGAGCACGTTT
> TGGTGCCGGCATACCGATTTGCTATCATGTCAGCAAATTTGCGTTGTATTCCTAGTTGCA
> CCCATTAAGGCCACACTCCGAACCTAATTATTACATCGCAAAGACATGTACGAAGGACCC
> GATGTCGAATAGAAGGGAGGACTGTTCATTGGAAGCTAGACCAGAGGAATCGCAAAGATG
> CAACTCTTACAATAAAAATCTAATTTCAGTCAACACGCAATTTCTATAAGGTTTCCGATA
> ATAATGAACCGTCTTCCACAGGGGAATTTGCCATGCTCGTAAAAGTAGTTAATCCAAGTA
> GAAGAAATTTTGATAATGTTTTAAGTTGGCACGAAGGAATTCAGAGAGATCTTACCTAAC
> AAAGGCATTAGTAGATGTTCCTTGGTTCACACTCGGTCAATCAGAGCACATACTACGGGC
> GATACCGGGAATGACACAACATCAATGAGATTGTTAAGTGAGGTAATTGACTTTAGAGGA
> CTCGATCAGTATACTGTCACTATGAACATCGTATTAATTGTTATCCGATATATACACCAC
> CGATTTGCTTGTGCAAGGTTACAGACCCATTCGATAAATACAAACACGGAGCGATATTAT
> TTAAGGAGTGCTGTCTTCAAAAGAATTATTCCCACACCGACATAAGAACTTCGCTCCGTC
> ATTCCAGATTTAAATAACATAACGTAACGCTTTGCTGATAACATAACATAACCGAGAATT
> TGCTTAGGAAATTTGGAGCAATATTGCATTGTTTCTCAGTCATCACAAGGCCCGCCAAAG
> AACTCTGAGAATCAGGATTCAACATGATTGGTAAGACTCTATATATATAACTTAATTCTT
> GTGTCCGGAGATAGAAAGAGGACGAGAGATACTACGAAAGAAAGTGTACTTCGATGTATC
> AATTCAGACGCCTTCTCTATCATCAACATTATAGGTCTCGTATATGCTCGGCGCGATCTG
> CTTCTCTCCGCCAATAGCCCCATAGTGTATTTCAAGCGCAGTAACAGTGAAATCGTTACG
> AAGGTAGGGATGTTGCTTATAATTGTCGTAACTTATCGCTTATGTATCTTTCAAGAATGA
> ACGGCAGCATATACATACGTTCTACCTTTAGCTACAAAGCATCCATATACTCCCTCTCAT
> GATTGAAACTCTTCCCTATTTTGTAGCCAATAGTGAAAGCGTATTAGTATAAATTCGTCG
> GTTTTTCACTCGCAACTGTTATACTCTGCAAACAAACGAAAGCCTCATAGTACAAACCTA
> AAGCTACATACTTCATCATTGGCAGACCAGTGGCGGTATTTCTACGGAAGCATCACTATA
> GATATAAAGTTTCCCTTCATGTACGTCTGTTAACCATATCACAAGAAACTGCTATCTCTG
> TCACGTAACAATTCACGCGCCTTATCGCCAAATGTTCATATATGCGCGGTATACGTATGA
> ACGAATACTAATTAGTATAACGGAGGATTCACGGGAGGGATACTTGGGGCATTTATAAAT
> CGTCTAAAAATTTTCTATCAGCACTTGCGGGTTATAGTGGATTACTAGGCAACATAATAT
> TCTGTATTGGTCCAAATGACGCTATAGATAAATTAGCAAAATACATTGTTTCCATTTATG
> TAAGTCGAAACTCCAGGACTCCCGGGAACCAGTTAAACCGTCTGGAAAAGACACATTGTG
> AGCGGGACTTCAATGATAGCTTTCAATGAGCTTCTCATGCTTGGGGTCTGTACATATATG
> TTGGCGAAATTATCGTCTGTATTCTGTTATGCTTTGATCATGGGTTATTAGTATAGTGTC
> CGGTTAAGTACCAATACCGCTAGAGACCCGACCTAAGTCGATAACTAACGATCATCGACG
> TAAGGATCGTCTCGATCAGTACTTCAGTCTAGATCTGGGAATAGTAACTCGTTAGTGAAC
> TATGTCGTGTCATAACTCTAAAATGCAATCAAATCTTATTATTGAGTATTGATTATATAA
> AGCATCCGCTTAGCTTTACCCTCAAATGTTATATGCAATTTAAAGCGCTTGATATCGTCT
> ACTCAAGTTCAGGTTTCACATGGCCGCAACGTGACGTTATTAGAGGTGGGTCATCATCTC
> TGAGGCTAGTGATGTTGAATACTCATTGAATGGGAAGTGGAATACCATGCTCGTAGGTAA
> CAGCATGACCTATAAAATATACTATGGGTGTGTGGTAGATCAATATTGTTCAAGCATATC
> GTAACAATAACGGCTGAAATGTTACTGACATGAAAGAGGGAGTCCAAACCATTCTAACAG
> CTGATCAAGTCGTCTAAAAACGCCTGGTTCAGCCTTAAGAGTTATAAGCCAGACAAATTG
> TATCAATAGAGAATCCGTAAATTCCTCGGCCAACCTCTTGCAAAGACATCACTATCAATA
> TACTACCGTGATCTTAATTAGTGAACTTATATAAATATCTACAACCAGATTCAACGGAAA
> AGCTTTAGTGGATTAGAAATTGCCAAGAATCACATTCATGTGGGTTCGAATGCTTTAGTA
> ATACCATTTCGCCGAGTAGTCACTTCGCTGAACTGTCGTAAATTGCTATGACATAATCGA
> AAAGGATTGTCAAGAGTCGATTACTGCGGACTAATAATCCCCACGGGGGTGGTCTCATGT
> CTCCCCAGGCGAGTGGGGACGGTTGATAAACACGCTGCATCGCGGACTGATGTTCCCAGT
> ATTACATAGTCACATTGGATTGCGAGTAGTCTACCTATTTATGAGCGAGAGATGCCTCTA
> ACTACTTCGACTTTTAAAACCTTTCCACGCCAGTATTCGGCGAAAGGGAAGTATTAAGGG
> TTGTCATAATTAAGCTGATACCACTTCAGACTTTGCTCTACTTCTGTCTTTCATTGGTTT
> AGTAAAGTCTGTCCATTCGTCGAGACCGTCTTTTGCAGCCTCATTCTACCAACTGCTCCG
> ACTCTTAGTCTGCTTCTCCCAGCGTTATAACAAGAGGCATTTTGTCATCCTTAAAACAAT
> AATAAAGAACTCGGAGCACTGATATAATGACTGAATTAGAACCGCTTAAAAATACAACGA
> ATAGATAAGACTATCGGATAAGATCTAATATGTAGTGATTAAGCCCTTTATTAATTAATA
> ATAGTTACCCTTTCTGATGTAACGCGACATATTACGATTTAGTGGCACGTCTGAATTGCA
> AAGCAGATCTCTACCCGATTTTTATTATAAATCCCGTATACATCTTGACTTGAGTAATTG
> TTCATCTTTTTATATCTCTTCGTACTACAAATAATTAATATCTCAACCCGTATTGTGTGA
> TTCTAATTACCAACAGAATACGAGGAGGTTTTTGCTTAGGGCCATATATAATGAATCTAT
> CTCGTTTATTCGCGGAACCCGAGATAACATTACGATGTAACTATTTTAGAGAACTTAATA
> CAAGAAACATTGCTGATTACTCATAACTAAATGCTTGGTAATATATCCTCAGTGCCCCTA
> CCATCTTTTACGCAGGGATGTAATTACTTAGGATTCATTGTGTAAGAATTACAATGAACG
> ATGGATATGAAGGCATGTTGCGAGGTGTTCCTTGGTATGTGAAGTTCGCAGGGCAACAAA
> AATTTCGCAGAATAGGCCTCAAAGTATTGGTAAAGAAGACAACTAATCATCACGAGCTTC
> TGATATCAATACGAACGAGTCCTGTGATGGATGAAAGAAAGTCGTATCGAAAATGTCAAG
> AGTCTGCCCAATGTAACTTACTTCAAAAAATAACGCTTCCGCCAAGTACGTTCGAATAAA
> CGTAATTTTAAAAATACATAAGGGGTGTTAGAAAGTAAGCGACGGGATATAAGTTAGACT
> CAAGATTCCGCCGTAAAACGAGACTGATTCCGAAGATTGTTCGTGGATCTGGTCATGACT
> TTCACTGAGTAAGGAGTTTCGACATATGTCAATAAACACAAAAATAGAAGCTATTCGATC
> TGAAAAATATTAGGACAAGAAACTATCTCACGCTAGCCCAGAATATTCACTCACCCACGG
> GCGATACTAAAGCACTATATAGTCGCGTGATTACTATACATATGGTACACATAAGAATCA
> CGATCAGGTTCTCAATTTTCAACAATATATGTTTATTTGCATAGGTAATATTAGGCCTTT
> AAGAGAAGGATGGGTGAGATACTCCGGGGATGGCGGCAATAAAGAAAAACACGATATGAG
> TAATAGGATCCTAATATCTTGGCGAGAGACTTAAGGTACGAATTTTGCGCAATCTATTTT
> TTACTTGGCCAGAATTCATGTATGGTATAAGTACGAACTTTTTTGATCACTTTCATGGCT
> ACCTGATTAGGATAGTTTGAGGAATTTCCCAAATATACCGATTTAATATACACTAGGGCT
> TGTCACTTTGAGTCAGAAAAAGAATATAATTACTTAGGGTAATGCTGCATACATATTCTT
> ATATTGCAAAGGTTCTCTGGGTAATCTTGAGCCTTCACGATACCTGGTGAAGTGTTTAGT
> AACGAATCATTAGATTAGATCTGATTCTGTGCAAGAAATATCCTCAACTATTTAACTCAA
> TGTGGCTAATTGCCATTCGATATTCGTTGCTAAGGACGAATGTTTTATCTCGAAATTTGT
> CAGACGACACGTCTATATAATGGTTGCGGAGGAAGAATCAGGTGATGGTCCCTTACCTCT
> ACCACTCTATTACTAGAGCAATTAAAACGTTAAGCTTGCCAATATAATAAGGTCATAACT
> TTATGGTTGTTGTTAACTTGTTTGGCTAGATTTAAATATATAGTTTAAGGTCGAACCCGC
> GACCGTTACTACTGCTCTTAAATTTCCCAACCTATTATCATCCCTTAGAATTACGGCATC
> TCTTTCTGCTAAAAGCCTCAAGGGATATTGTCCTTGAGATACAAGTGGTCGAAAATGTAG
> CAGAATTAATATAACAAATTTCCTTTCGAACTTTACCATTCAACACTATGGCGAAGTGCT
> GGACCCAATAAAATTCAAATTGGATGGTCTATTCGTTGTTTAGTTTCTACGCTATCCCGT
> GTCAAACATGTTTTCACAGCGCTATCGTTTTATTTTTAATCTCGGCGCAATGATACCCGG
> AGAAAGGAAGCCCGTAGATCATGAATATCGAGTAGTTTTTGATCCAAATCCAAAACTTGG
> GTACGAGACATAAGCTCGGTGATCGCTCACGGACTAGTCTACTGTTAAACTTAATGGGAT
> AGACACTAGCCCAAAGTTCCAATAGCTACATGCGCAAAGTAAGGTTAGCGATTTTGCTGT
> GTAATCAGACAAGTGATATGTAATACTTATGTCAGGAAACCCAATGTAGGGGCTGGTTCG
> CCGCCTTCCATACTACACTGGCTACTGTAAAATATGAGACATTAAGCTATTAAATCAGAT
> GACGCTAGGAGCGACATGCATGAAAAGAGTGCCGGGATATTAGCACCTGGTAAACAGAAC
> ACATAGTTGTAAGGGTAAGCTCCGAGTTCGTGACAGCATATTGATTAGCGAAACAGATTT
> AGAATAAACAGGATATGCTTTCCATTCAACCTGTCATTATGCTATCAGTTCATGTTTGGA
> TAGGAAAGTGACTCTCGGAATAACTAGAATATGAACCTTTTACGTTAGGAGATGTCTCAA
> CGGGTTAAACACCTTCCTCGTCAGTAATAGATTCCTCCGGGTTTTAAAATGGAATTTTTC
> TCTTTCATTTTAACCAGGTGAGCACACCCTGCCGCAATACGAGGGTGGCCAATACTGCTT
> ATAGTAAAATATACGGTTGTACGTATGTCTTTTTCCCGGCAAAAGTCCGCTAACAAGGTA
> GCAAACCCATCTAGATACTCACGTGCTGGTCTACAACAGTAGTAACGAGTCTACATCCAA
> ATTCAAATCGTATCTAATTATCTCGCGCCATGGATACAGTAACTGCGTTGTAGAAATACG
> AATCTAACTATCATCGCCAAGTGGCAAGAAAGCCAGATTACTTGTAACCTAATAGGGGTA
> GTTGTAGAAAACTATACACTGAGAAAGACACCCACTATTATTTTGCCAACCACTCCCAAT
> GGTTCTTAAAAAGTCAAGCATATTTTACTATAAGAGGAATCCTCTTACCCATTAGAATGG
> ATTACATAGCAAAACGTAGTATCGGTGACGCTATGTATAGACGCATGGAAGTACGCGGTG
> GTTTCATCCAGCCTGGACTTCAATGCGTTTCCTTCGATAAGAGCACAGCCTACACGGGTA
> TACATTGCAGACAACATCACAAGTTATATATCGTTAGTAAATCGATAAGGCGCCATTACT
> AATTCTGGGGAATTTGGTTAATCTTACGCCGCCTCGTATACAATGTCAGTCGATTTTCTA
> CAAACATATAGCTCGTCTTCAGATACTAAGATGCTGGCTCGTCAAAAAGAAATACATATC
> TAACAAAAATGTCTCTACGGCGTGTTTTCAGACAATCTAACGTCTATATCTATTCAGGTA
> TTACACACTGCCGTCATATAATAATACTTCTTGATCAAGCACCTAGTTAAAAGCGTCTTA
> AAGCTGGGCAATAGTTCAACCAGTATACGGTTGTGTACTAATATATTTTATTTACCGCGA
> AGTCTGTATATGTTTGTTAATAGTTATGCTACGATAAGGTAGATGAAATTTGGTGTGTGT
> GATTCAGTCCATATATTCAGGGGTGGGATGTGAATGTGGCCTGCAATGGACGTAGCAGAA
> TTCCTACGCACACACTTAAATGTACTTTTTGGTAACGATACTGTGCATTTTGCAAACGTT
> TGTCACAACACGTTCAACCATCTCGTCAACTCTAAATTAGGTAGTTTGTGTAAGTTTAAG
> AAGAACTTAATGGAAGCATGAACGAGACATGTTACTAGTGCATCCTGTTGTTCAAGAAAC
> CTAAGAAAGTAAGCAGTAAACTGTCCGTGCATCCAATCATAAACATTAGAAACTTCCGTT
> TAAATACCAAGTAAATAAGTTTTTCCTCCAATCTATGCTCGACAATAAGAAAATTTAAAT
> GTTAGTAAATTCTTATCTTATTTGTATCCGCTGTGCAACGTATATAGATGGACCTACCTT
> TGCATAGATCAAGATCCATACATGCCTTTACGTCTAAATCGGCGACACCACTACCATGAA
> CGTACCGACAAATAAACATAATATTCTTACGGATGCATTTATAAGCTACACCGAGATAGA
> TTAACACCACCGACGAATGATATTCCGCTCACTGAACCACTAGACCCTTACAATCCTGTG
> ATGTGCAGCTAACCATGTGCCAGGAAAGGTTATGAAAGGTCCGAAGAAACAACATGAGAG
> AAGTATGTGTGTTGCCCAGAGTATCTTTGTTAACGCCGTCAGATCAAAAGACGTCATTTG
> ACCATACTGTGTCCACAAATAGACTATAACGCAACACAAACACTAGGCTACACGTAGTCG
> AGACTTCTAACGAAGCACAAGATTTAGCTATTTCTGAGGATCGGCTCTGCTCACAGTACA
> GGGATCGTAGCGGGTCTGGCATTAGTATCAAAATACTACGTGTTCCACGTACCTTGAGCC
> AGAATAAACAAGCTAGTGGACTCAACATTTTTTTACACATGGAACTCGTTTACGAGCTGT
> AAATTTGGCGAATGATCAGGAATCGACATCTCAAAATTTCTGGCTTCAATTGGGGATTGA
> TCTTTACCTATGAAGGAACCATTTTCGTTAATGACTTAATTTCCGTTTTGAAGTGGCAGC
> AAATCAATAACCCTAGACATATTACAGCAACAGAGTAAGAACTAGTTTCACTGTAGGGCA
> ATAAAGGTGGGACGTAACTGTTCAACAGCATCTTTATTAGCTGTCTACCTATCAGAACAA
> ATAACAACTGTTTACCGATTACGGTGATTATAAGACTGTTGATTAATGATCTAATATGCG
> AGACGGTAACACAGGCTACAATAACCCTAAGTGCCCTGAGCAAGAGTATTAGGAATTCGT
> ACACATGGATGATATCGGAATCCTCACACTTTGCCACGTGCGAGCGATGGGGTAGTGTAG
> CTTAGCTAAAACATGATAGTGATGACAGCATTATCATTTTTACCTACGCGACGGACTATT
> TCGTACCAGAGGTTAACCGAATTGCCCAGAGATGTCAGATACGGTCATCAAAATATCACG
> TCTGGACTTGAGAAACCAAAATTAGGTCATCAGTCCTTTCACTAGCTGTTCGTAGAAATA
> CCGCATACGACACATTGCTGAGGTTGCAGGCAATAAGCATGTGTGAGTGTTTCCCATAGG
> GTACCATCAAGACGTTCTGGCGAAATGGGAGTAGTCTAAAGGTATTATTAACAGAGAGTG
> CACGTTATGCCACTTCTACTCCACTGGGAAATTATTACTAACCATTTGTGAAGACTTCAT
> AGTCGGGAACTAGACGTTAGATTAGGTGACTACTGCCGTGAATTGACAGTTCTCGCACAC
> ATAGACACTTATTTTCTCGGTCTATTAGAGCATGCTAACAGATATGTTACGTTGTGAATT
> TAAGCTTCTATTGTCATAATATTATACTTGGTACTGGGCTATTTCCTTGTCTGGAAACAA
> AAAACGTCACAAGCAATTCCAATTCTCAGACCTTCTTCGAACTAATGTCAAGTGGAGGAG
> GAATGGCTGGAGCTTTTACATTCAGCTGAAAATCGAATTATATTCTTAACAATTCCCCCC
> CTCCGTCCATATGGCTGAATTTATTACTACTTTGGGTCTGCAATATAACGTCCCGTCCCA
> TCGATTACAATGGAACAGGGCCAGTTACCCTCGCTGCGGTGATAGGGGACGTCTCGACGT
> TCCTGAGATAGTGACACAAATCCCAGGGTATGAAAACTGTTATTTAGTCTAAGATGTGCA
> TATACATATCTACTGGGGGATTTTGTTGAAAATGGTTTGAAACGAATTAACTGAACTAAT
> CAAGTAATGAAAGTCGATGCTCATCCAGGGATGATCTGTAGTGTCATGTTATCGACAAGC
> ATTTTAGGAGTATAACGCGTTGTTGATCTACTCTCTCTCGGAGGTCTGAAAATTACCTAA
> TTAGGGAAGGACATTACCATATAAAAACCCCTTGCATTGCGTGTGACTTTAACCCCGATC
> TCAAATATATAAATTTTACTCCTAGCCGGAATTGGGATAGATCTCGTTAAAGACTTATCA
> AAGGAACTTTGGTTTGCTAACTTGTGAATCTCTAAAAAGAGGCTTGTGATGATTGGCTAA
> TAAAGCCTGTAATAGCGATCTTAGTTAACTCCAATTGATGGAGTAACTACCAGGGTGGTA
> ACCGAGTCTCCATCGTTTATCATGTATGAAAGAAGTATTTCATGGTCCGTACCCCAGGGA
> ATGCGAAGTATCTTTGGGGTAAGGACTGATACTGCGATTTCCTTAGATTTATAATGCTTG
> TAACTCCATAGTGACTCCAACGGACAAGTCCCTTGGCACTAGCATATACGGCGATTTACC
> GTTTTGGCTTCCCCGTCTTAGTGCAAGCAAATTCCGAGGTAGCTTACATTGAATTGAACC
> AATATGTTTAGCGCACCGTATATTAGCATGCATTCATAGAGACAGCACCGTCACTATGAA
> TGCTTGCAAAGATGCTTGCTCAGATAAATAATCGTGATATAAAAGAATTAAAAATGAGGT
> GTGAATAAAATTTAGGGTCATCTCATGAGATGGGGCAGTTCCTGGAAAATATCAATACGT
> TTAGCCGTAATTATTATTAAATCAAGGGCGCCAATACACGCCTACACATATTGATAAAAA
> GGTTCTCCTAACAGGAGACTGTAATGGCGATACTTTGTTTTATGTTTGTCTAAATTTTAC
> TACATATCGCTGACTACATTCTGGTATTTGGTTGCCTAATAAATCAAAAATAAACCATGC
> GCGTGAAAGTTATCGTTAAGCTTTTATTATCAGATATGCGTGTTCTGTATTCGTGGATCA
> AACTGGACTTATGAATAACGAACGAGAGTCGTGCCCTGAGAACGACTCTATTGAGGGACA
> GCCAATAAACGGAAGTTGAAACTTGAAACCATTGTGGCGGGCCTGAAGAATGGTCTATAC
> AAGACCCACGCTATGCAGAGTCGGGAATTACGATCGATTTGAATGAAACCCTATAGAACC
> GCCTACTTAGTGGCTTAACTGCAAAAAGCTATAGGAATCATCTATTTGTCTCTGATGACA
> CATATTCCACTTCGCAGCCTAGTGCCTGGAGACCTAAAAACTCATTAAAGATGACGTTTC
> GTGCTGGGACCTGGTTCGTAGTAGAGTTTTAGATCACCATAAACTTACGCATCATCAGTT
> AACGCCATCAAGGATGGAACCGCTAAAGTGCTTGAACGTTATACGAAACAATCCTGTAGC
> AAATAAGCACGACCCGACCAGTACTCGTCCAAAAATTGATTCCACGAATGGTAGATCTGT
> TTTCGATTCTTTTAAATGGAGCTTTTTTGTTAAGATCGTGAAAGGATAGTTAAGCGTTAG
> CATCATTCTTTTGCTATGTTGTATTTGGGGTAGTCAGATCTGAAGGTTAGTCGAAACAGT
> TAAGACGTCATTATGTAGCTATAGCTGATGAGATAGACCAAAATAAGACAATAAATCTGA
> ACACAATCTAAAAATCATATTTCCACTGTTAAGACTCATAGATCCAATGTTACCTCCTGG
> GACTCAAGTAAAAACGCCCGTTGAGAACTTTTTGAGCTTGCGCATGCGTGGGCCGAATAG
> ACAAGAGTATGGTTAAGTAATTTTGTTAGACTCCTTCTTGGATTAGGCTAATTAGCGCCA
> AGAAAAGGCGTTAGGCTATAAAGAGTACGAGTAGAACGATTGGGCAATCGATAAATATTT
> GCACCAAATCATTGTAGATACGCGATTTTATCACCACCTTCTCAATCTAATTTGTGACAC
> GAAGTTCCTCAGGGGAGGAAGGTCTGCAAACCTTTAGTGTTCGGCTATCTATAAACTAGT
> ACTTTACCATAGATTCATATTAAATGTTTGATAACCACCCCCAGTACAATTTGCAGCTGA
> GCATTTCGAGGTGGTCCCATACTCTATGCGTCGAAAACCATAACTGTACATTTAAGATGG
> TGGTCTAGTTATAGGTACGGTCGAATATAACGCAGGGCCTGTATTAAGGAGCTCGTCGCA
> AGAGTGAGCTTGTCACTTCCTACATTGCGCAGAACATTATTAGTAACGGGGCGTAAGGTT
> CTCTTACCGGGTTATGTGGGATTAATTTCCTACGGATTAATTTCTCAGTGCTAAAAGCTT
> AGAACATAAAGCCCTTCCAGATTAACATTAAAACTCGCCTTGCGGCTGTTAAATTAATGG
> TCCAGCTCGTATGGGAAAGATAAGTTGTACCTACTTCTTAGCTTTTTAATGTACAAAATG
> ATTAAGATAGAAAAAGTAGGAGGCCCCAAGCACAGCAATAGTGTAATCTTATAATCAGGG
> AAAAAGCCCCGATGACATGATCGCTTACTGTGACTCCATTGGGTCCTTTCTCAGATAAGA
> GTAGTAATAGACACATACGGATCAGATAACAGTCTATATATGACTGTAGTTCAAAGTTAG
> TCGACATGACATGTGGAAGAGTGTCCAGATATGCATGTATTTATCTTCTGACTATAATTA
> TAAACCTAAGAATCGAGATCGTTTTGGTGCCCGCATACACTTTTCAGATATTCGAAGCTA
> ATTTGCGTTCGAGGACTAGGTGAACAAAGTAACCCCAAACTAAGAACATAAGTATTTCAT
> CGCATAGAAATCGTACATGCAACCGTTGTAGAAGAGTACGGAGGTAGGTTAATGCGATGC
> TTGAAATGTGCAATCGCAAAGATCCTAATATTAAAAGAAATATATATTTTAACTATACTA
> GCTTTGTCTAGTAGCTTTCAGAGATTTATGTTCACTCTGAATCACCGGTATTTCCCAGGC
> TAGTAAAAGGACGTAATACAACGACATGATATGTTGATAATGTGTGATGTGGGCACCTTG
> GAATGCACACAGAGCTTTACTAAATTTGGCATTTGTACAGCGTACTTGCTGATAACGCGG
> TCAATATCAGAAATTACTACGGGCCATACCGCGTAGCACAATACATAAATGTGTTGGTGA
> AGTGTCGTAATGGTCTTGACAGCAATACTTAAGTTTAATGTCACTTTGAAATTACTTTTA
> ATTGGTATCACATAGATAAAAAACCCATTGCCTGGTCCAACCGTAAAGACCAATTAGAGA
> AATAATTACACCCTGAGATATTATTTTTGCACTGCGCTATTAAATTGTTTGTTGCCAAAA
> ACCAATTTTGAACTTAGCGCCCTCTTTACACAGTGAAATTACAGAACCTAAAGCTTTGCT
> GATAACATTTAAGAAACGAGTATTTGATTAGCTAATTTGCAGCTATATGCAATTGTTTAT
> AACTATTAACATCGCCAGAAAAAGATAGCTGACAATCACGTGTCAACTTCTTGGGTAACA
> CGAGAGAGATATTACGTAATTCTTGGGTCCGCTCTTAGAAACACCACGAGACTGAAGACG
> TATGAATCTGTAATTCCATGTATATATTATGACGAATTAGATAGCAGCAACTTTATACCT
> ATCGTAGATGCTCGCCGCGATATGCTTAGATAACCAATTAGCAACAGACGGGATTGATAG
> AGAAGGATATGGGAATGCCTGAAGATCCTACCGATGTGGCTTATAATTGGCGTAACTTTT
> AGCTTATGTTGCTTGAAAGTTTCTAAGGATCATTTTTAATTAGTTCTACCTGGAGCGTAA
> AAGATGCCTGATAATACATCTATTCAGGCAATATATTCCCTATGTTGGACACAATAGTGA
> AACAGTATTAGTTGAATGTAGTACCTGTTTAAATAGCAACTGTTATTCTATCATATAAAA
> CGTATCCATCATAGTAAAAACCGTAACCTAATTAAGTCATATTGCCCAGAAATGTGCCGC
> TATTGCTAAGGATCAATCAATATACAGATTAAGTTTCAATGCAGGGACGTATGGTAACCA
> TATCAAAACTAACTCATATCTATGGAAACTAAAAATTCAACCCAAGGATCGCCTAATCTG
> CATAGTTCCGAGCTATACCGTTCATCGTTGTATAAGGACGATATCCGAGGATTCAAGGCA
> GCCATACGTCCGGAAGTTATATATACTCTAAATTTTTTATTGCACAAATGCAGCGGTTTA
> GGGCATTACTAGGCTACTTTAGTTTATCGAGTCGTCCAAAGCACGATATAGATATTTGAC
> CATATGAAAGTGGGGCCTTTTATGTATCGCGAAACTCAACCACTCCAGGCAAAAACTTTT
> ACCCGCTGCATATGTAACATGGTGAGCCCGACGTAAATGTTACAGTTCAATGAGCTTCTC
> ATCCTTCGCGTCGGGACTTATTGCTTGGCGAATTTAGAGTCTCTATGCTCGGAGGATTTC
> ATAATGCGTGAGTTCTAGACTCGACGGTTAAGGACCTTTACCCCTAGACTACACACATTA
> GTCGAGTACTTACCAGAATACAAGGAACGATCGGCTCCATCTCTAATTCACTCTTCATAT
> CCGATTTGTAAAGAGTTAGTGATATTGGGAGTGTCATAACTATATATTGAAAGCAAATAT
> TATTATGCTGTATTCAGGATAGAATCCAGCCGCTTACCTGTTCCATCAATTGTTTGTTCC
> TTGGTAAAGCGAGTGTTAGCCGATAATCAACTTCACCGTTCTCAGGGCCGCTAACGGTAG
> TTTTTACACGTGGGTCAGAAGATAGGTCCATACTGATCTTGTTTACTCAGGGTAGGGGAA
> CTGCAATTCCAGGCTCGTAGCGAACTCCAGGACCTTTATATTATACTATGCGTGTGTGGT
> AGAGCTATTTTGTTAAACAAGTTCGTAACATTATACCCGCTAATGTTAATCTCTTCAATG
> TGGCAGTCATATCCATTCTATAAGCTGATCTAGTCGTCTATTAAAGCATGCTTCACACGT
> TACAGGGTTATGCCAGAATTAGGGTATCTATAGTCAAGCCGTTTATTCCGCCGCCATAAG
> ATTCCTAAGACATCACTTTAAATATACTACCCGCAGCGTAAGTAGTGAACTTATATAAAG
> ATATTCTAAAAGTTTATAACCAATTGATTTAGTGGAGTACTAATTGCCAAGAAGATATGT
> CTGCGCGCGGCGTTTGATTTACTATGACCTTTTCGCAGTGTAGGAAATTCCATCTACTCG
> ACTATATTCCGTTCACAGAATCCAATTCCTTGCTCAACAGTCCTTTTCTGAGGAAGAATA
> TTCACAACGCCCGTGGTCGCATGGCTACACTGCACACTGGCGTACGTGGATATACACCAT
> GCATAGAGGAATCATGTTCCAACTATTACTGTGGATAATTCGATGCCGAGTTCTCTTCAT
> ATTTAGGAGCCTGACATGCCGCGAACTTAGTCGAATTTTATATCCGTTCCAACCCACTAG
> TAGGCCAATCCGTAGTAGTTAGGGTTCTCATAATTAACAGGAGACCTATTAACTCTTTCA
> TCTTCTTATCTCTTTCATTCGTGTAGTTTACTCTGTAATGTACGCGTGACCGTAGTTTGA
> TGACTCATTCTAACATAGGATACGAATCTGAGTCGGCTGATCACACCGTGTTTTAAACTG
> GATGTTTGGCATCATTTAAACAATAATATAGAAATCGGAGAACGCAGTTTTTCTCTCAAT
> TTGAAACCAGTAAAAATACAAACTTTTGAGATCTCTATAGGATAAGAGATAAGTTGTACT
> GTTTAAGCAATGTATGAAGTAAGATTTGGTTCACGTTCGCAGGTAACCAGAAATATTACG
> ATGGTGGCGAACGTCTCTAGTCAAAACCACATCGCTTAACCATGTGTTTGTGAAAGACCG
> GAGACTTATTCACTTGAGGATGTCTGCATCTTTTGATATCTCTTCCTAAGACATTTAATT
> ATTATCTAATACCCTAGGGTGTGATTCTAATTTAAAACTGAAGTAGTGGTGGGTTTTGCT
> TTGGGCCTTTTAGAAGCTTTCTTGATCCTTGATTCGACGAACAACAGATTAAAGTTCCAG
> GGTTATAGTTGACAGAACTTATGACATCAAAAATGCCTGATTTCGAAGAACGAATGCATT
> GCTAAGATTGAATATGTCCCCATACAATCTGTTACGCTCGCTGGGAATGTATTACCTTTC
> AGGCTCTTAGAAGTACAATGATACATCCAGATCTAGCAAGCTGCAGTGGTCTTCCTGCGT
> ATGTGAAGTGCGCAGCCATAAAATTATTTCGATGAATACGCCTCATAGTATTGGTAAACA
> TCAAAAATAATCTTCTCGACCTTCTCTGTGAATTACCAACCTGTACTCTCATGGTTCATA
> CTAAGTAGGATCGAATAGCTAAACTCTCTGCACAAGGGTACGTAATTAAAAAAATAACCC
> TGACGCATACTAAGTGCCTTTAAACGTTAGTTTAAAAAGTCATTTCCGCTCTGAGTAAGT
> AAGAGTCGGGATATTACTTAGACTAAACATTACCAACTAAAACGAGAAGGATTACCAAGA
> GTGTTAGTCCATCTGCTCATGACGGGAAAGCACTTAGGTCTGTCGTAATATCTCAATATA
> ATATATATTAGATGATTTTCCAGCTGATAATTATTACGACAACATTCTTTCTCAACATAC
> AAAAGTATATTCAATAAAACTCCGGCCATAATTTTCCAATAGATAGTACACTGAGTTATA
> GACATTTCGGACAAATAACAATCAACATAAGGTGAGCAATTTTATAAAAGTGAGCTTTTT
> GTCCATAGGTTAGATTAGGACTTTTAGTGTTCCATGGCTGACATAATCCGGGGATGGCCC
> AAATAAACAATAACTACTGAGCAGTATTAGGTTCCTAAGATCGGCGAGACAGTCTTAACG
> GTCGATTGTTCAGATATCTATGTTTTTCTGCGCCAGAAGTAATGGTTGGTATAAGTTAGA
> TATTTTTGGATCACTTGCATCGCGACCTGTTGACGAGAGGTTGTGGTATTTAACAAATAG
> AACCAGTTAATATAAAATTCGCAGTGTAACTTTGAGTCAGAAAATCATTATATTTACTTA
> GCGTAATGATCCATACAGAGTATTAGATTCCAATCGTGCTCTGGGTTATCGGGTGCCGTC
> AACTTACCTGCTGATGTCTTTAGGAAAGAAGCTGTTGAGGAGTTAGGATGCTGTGATAGA
> TAGTTAAGCAACGATTGAACGCTATCTGCATTTTGCCCATTACAGAGGAGTTCCTATGGA
> ACATGGTTTTAGCTACAAATTTCTCAGACCAAACCTATATAGAATCGTTCCGGTCGATCT
> ATCAGGTGATCGTAAAGTACCTCTTCCAAGCTTTGTCTTGTGAAAGTATTAACGTTTCCT
> GGACAATATTATATCGGCATTAAGGTATCCTTCTGGTTAAAGTGGTTGGCTACAGTGAAA
> TATTTAGTTGAAGCTCGTACAAGAGAACGTGTCTTCGCCGATTAAATTTACAAAACTAGT
> ATCATAACTTAGAATTTACGAATATATGTATGAGTAATCACGCTAGGGTTAGTGTAAGTG
> ACAGTAAAGTGGTACAATATGTAGCTCTATTAATATATCAAATGTCATTTCCAACTGGTC
> CAGTCAACTCTTGGCAGTAGTGATGGACAAAATTAATTGCTAAGGGGTTGCTAGTGTACT
> TGTTGAGGGTCGACGCTTTAACGTCGCAAACTTGTGGTATCACCGCTATCCTTTTATGTG
> GTATAGCGGCGCAAGGATTCACGGAGAAACCAAGCCCGTAGTTAATCAATTGACTGTTCT
> TTTGGAGCCTTTGCCTAATATTGGGGACGTGTCAGAACATAGCTCTTCGCTCTAGGAATA
> GTAGACGGTTAAACGGATTGCGATTGACTATTGACCAAACTGCCAAGAGCTACAGCCGCT
> TACTAACGTTAGCGATTTGCATCTGGATTCAGAATACTGTGTTCTAAGACTTTTCTCAGG
> AAACCCATTCTAGGGGAGGGTTCGCCCACTTAAATAATACACGGCATAATCTAAATTATC
> AGTCATTAAGCGTTTTAATCTGATCAAGAGTCCTCAGTCTTCATTGAAATGACTCCCCCG
> AGTTGTCAACATCGTATAAACAACTCATTCGGGTAACCCGAAGAGACCTCTTAGTGTCAG
> CTGTGTCATTAGCCTATAACATTTAGTATAAACAGGATATGATTTCATTGAATACTCTAA
> GTTTGCTAGAAGGTAATGGTGCGATAGGAAAGGCACTCTACCTATAACGACTAGATCAAA
> ATGGGTCCTGTCGAGAGGTCTCAAAGGCGTAAACTCCTGACGAGTCACTAAGAGATTCCG
> CACCGGGTTATAATGCAAGTGGGCGCTTTCAGTTTAAAATGCTGACAAAACACGGCCCAA
> ATACGAGGCTGGACTATACGGCGTTTAGGTAAATATTCCCGTGTACGTATGTATGTTTCA
> AGGCAAAAGTAACAGATAAAGGTACCAAAACCTTATAGATTATCACGGGCTCCGCTTAAA
> CACTTGTATACAGTCTTAATCCATAGTAATAGACTTTATAATGTTCTCGAGCAATCGATA
> AAGGAAAGCAGTTGTACAAATACCATTCGTACGATATTCGCAATCGGGCATCAAACCAAC
> ATTACGTCGTAAATTATACCCGTAGTTCTTGATAACTTGAAAATGACAAACACACAAACG
> AGGATTTTCCCAAACTCGACAAATCGTTATTAAAAACTCAACCTTATTTTAAGTTATCAG
> CAATCCTCGGACAATTGAGAAGGCAGGAAATAGCAATACGGTCTATACGTCACGCGAGCT
> TGAGAACCTTCGTACTACGCGCGGCGTTATTCAAGACTCCAAGTATTTGCCGTGCATGAC
> TTAACAGAAATCCCGAAACCCGTATTCATTGATCACTTAATCACTTGGTATAGTGCGTTA
> CGATATCGATAAGCCGCCATGACGTTTTCGGCGCTATGTCCTTAATCGGAAGAAGCATCG
> GATTAATTCTCTGTACATGTTATACAAAAAGATAGCTCCGCGTAAGTTTAGATCATGAGG
> GATAGTCAAAAAGTATTTCATTTCTTTAAAATATGTCGCTACGCCGTGTTTTAACACTTT
> CTATCGTCTTTTTATATTCTCGGATTAAAAAATCACCTAATATTAGAAGAATGAGGCATC
> AAGAAAATAGTGAAAAGAGTCTTTAAGATGGGCAAGACTTAAACCAGTATACGCTTGTGT
> ACTAAGAGATTTTATTTTCACAGTTCTCTGGAGAGGGTTGTTTATAGTTATCCGACCATT
> ACCTAGATGTTATGGGGGGGCTGTCATGAAGGCCATAGTTTCTCCCCGCGGAGCGCTATG
> GGGCCGGAAATGCACCGACCACAATTAATACCCTAACAATTTAATGTACGTGTTCGTAAC
> GATTCTGTGCTTTTTGAAAACCTTTGTCAAATAAACTTCAAACATCTAGTATAATATTAA
> TGTGGGAGTTGGTGGTAGGTTTTGTAGTAATGAAGCGTTCATTCTAACAGTAATGTGACT
> TGTCAAGCAGCGGCTTAAAGATACATAAGATTCGTTGATGTTTACTCTCAGTCATTAAAA
> TCAGAATCATTTGATACGTCCGGTGAAATACCAACGTAAGTTGTTGTTAATCCAAGATAG
> GCTACAAAAGTAGATATTGTATTGCGGACGAAATTCTTATCTTATTGGTAGCACATGTCC
> AACCTTGTTAGATCCACCTACAGTGGAATAGTTAATGTTACATTAAGGCCGTTTCGTCTT
> TATACGACTAACCTCGAACAGGAACCTTACGAAAAATTAACTGATTATTAGGAAGGAGGC
> TTTTTGAAGCTTCACCGAGATTGTTGTACAAAAACGAAGATTCATAGTCAGATCTATGAA
> CCAATTGACCAGTACAATACTGTGTTGTCCTGCTTACAATCGCACACGATTGGTGTTCTA
> AGGTCACATGTAACTACATGACTCTACGATGGGTCGTCCACAGTCTATATTTCGTATAGA
> CGTAACAGCTAATGACGTAATTGGTCCATTCTGGCTAAACAAATTCACTTGAACCAAACA
> CATTCACTAGGCTACACGGACGCCAGAATTATAAAGAACCAAAAGATTTACCTTTTTCTG
> ACGATAGCATCTGCTCAAAGTACACGCAGAGGAGCCCCTCTGCCATTAGTTTCATAATAC
> GACGGCTTCCACGTTCAGTGTCCAACATTTAAATACCTAGTGGACTAAAATTTTTTGGAA
> ACAGCGAAAGCCGTTTAGTGCGGGATTTGGCCACAATCATCACGATTACTAATCTAAAAA
> TTTCTCGATTCTATTGCGCATTCATCGGTACATATGAACCTAAAAGTGTCCTTTTTGACT
> TATTTTCCGTGTTCAACTCGCAGAAAATCAATAACAATACAATTATTTAAGCAAAACACT
> TAGAAAGAGGTGCTATGGACCGAAATTAAGGTCGGACCTAAATCTTATTAAGCTTATTTT
> GTACATCGCTTCCTAGCAGAACAAATATCAACTGGTGACCGTTTACGCTGATTTTAAGAA
> TGTTGATGTTTGAGCTAATATGCCACACCGTAAAAAAGCCTAAATTAACCCTATCTCCCC
> GGAGCAACAGGATTTCGAATTCGGACACATGGTGGATTTACGAATCATAACACTGTCCAA
> ACTCCCAGCGATGGGGTTGTCTAGATGACCGAATACATCATACTGTTCTCACCAGTTTAA
> TGTTTTACGACCCCTCGGAAGTGTTCGTAAATCAGCTTTAACCAATTGACCACTGTTCTA
> AGTTAACCTAATCATTAGATCACCTCGGGACTGGACAAACCAAATTTAGGTCATCTCTAC
> TGTCTCTACAGGTGACTTCTAATAACGAATAAGAAACATTGCTCACCGTGAAGGCAATAA
> GCATGTGTGAGGCTTTCACATAGGCTAACATCTAGTCGTTAGCCCGAAATGCCAGTAGTC
> GATTGGTTTTATTTACACTCAGTGCTAGGTATGCAACGGATTATCCACTGCGAATGTATT
> ACTAACCATTTGTCAACAATTAATACGACGGAAATTGTCCTTAGTTTAGCGGAATTCTCC
> AGTGTTTGGTAACTTATACATCTCAGAGAAACGTTGTTGCTACCTATTTTAGTGCATCCG
> TAAACATATCTTACGTTCGGAATTTAACCGTCGATTGTCATTATTGTTTACGTGCTACTG
> CGATTGTGCCGTGTCTGGTATCTTAATAAGTCACAAGAATTGCATATGATATCACCTGCT
> TACATCTATTGGAATCTCCACCTCCAATGGCTGCAGATTTTAAAGTCAGCTGAAAATACA
> ATTATTTGATTAACATTTAAACACCTCAGTCCATATGGATCATGTTTTGACGAATGTGCC
> GCTCAAATATAACGTAAAGTACAATACTGGAAAATGGAAAAGCGAAAGTTAAAATCGCTC
> CGCTCTTACCCCAACGCTCCACGTTACTCACTTTGGGACACATAGAACAGGGGTTGTAAT
> CTCTTTTTTAGTATAAGATCTGCAGAGTAATTGATTCTCCGGGTTTTTCTGGTAATGGGG
> TTGTATCGATTTATCGCAAATAAGCAAGGAATGTAACGCGATCCGCAGAAACGGTTGATC
> TCGACTGGAATGGTAGCCACAAGCATTTTTCGACTAGATCGCGTTGTTCATCTACGAGAT
> CGCGCAGGTCTGATAATTAACTTTTTAGGGAACGACAGTAAAATATATAAACCCCTTCCA
> TGGCGTCTCACTGTATAACACTGCTCAAAGATAGTTAGTGGACTCAGTGCCGCAATTGCG
> TTAGATATACTTATAGACTTATAAAAGGTTCTTTCGGGTCATAAATTGTCAAGCTATAAA
> ATGAGGATTCGGTGCTGTCGATAATATACACTCTAATACCCAGAGTACTTTTCGCCAAGG
> GATGCACGTACTACAAGGGTCGTAAACGACTATACATAGTTTAGAATGTTTCTTAGATGT
> ATGTAATCCTCCGGACACATGGCAATCCCAAGGTGCGTTCGGCTTTCCTAGGTTACGCCG
> TTTTAATTACATGTTGATGCCGTGTAACTACATAGTCTATAAAACCGAAATGTACCGTCC
> CAATAGAAGATACCCAGATTGACCCGTTTCGCTGCCCCCGCGTACTCATAGCTTATTAAC
> ACGTTGCGTACATTCATGTGATAAAAGTGGTTTAGCCCACCGTATTGGAGCATGAATTAA
> GAGAGAAAGATAAGTCACGTGCAATGAGTCCTAAGTTCATGGATCAGAGAATTAATCCTG
> TTTTAAATGTTGGATATTTCAGCGGGCATTAAAATTTAGCGTAATCGATTGAGATCGCGA
> AGGTAATCGAATAGAGCAAGTCGTTTTCAACTTTTGAGTATGTATTCATGCCAGCCTTTA
> AACCAAGACACTTTGTGTGTAAATCGGTCTAATAAAAGGTGACTGGAATCGACATTCTTT
> CTTGTTTCGGGCTAGATTGGGTAAGAAAGATACATGACTACAGTCTCCTAGGGGGTGGCA
> TATGAAATCAAAAATAATACTGCCCAGTGATAGTTATCCTGATGAGGGTTGGATCACTTA
> GGCGGGTGAGCTATTCGTCCTGCAAACTCCAATTATCAATTTCCTACGACACGCGGGACC
> TGTCTAACAATCTTGTGACCCACAGCCATTAAACGCAACTGGATAATTGTAACAAGTGTC
> GCCCCCAGGATGATTCGTCGATTAAACACAAAAGATATCAAGTGTCGCGAATTAAGATAC
> AGGGGAATCAAACAAGATAGTACCGAATACGTTGTGGCTTTTCGGCAAATAGCTATACCA
> ATCATCGAGTGGGATCGGATGAAACTGATTCCTCTGACAAGAAGAGGGACGGGAGACCGT
> AAAACGCATTAATCATGACCGTTCCTCCGGGGAACTGGGTACTAGTTGAGTTTTTGATCT
> AAAGATACTGACGATTCATAACTTATCGCCATAAAGGATCGAACCGATAAAGGGCGGGAT
> CGTTATTACATACAATCATGTAGCAAATATGAACCAACAGTACTCGACTCCTCATAAAAG
> GCAGTAAACGATTCGTACATCTCGTTTCGAGGCTTTTAAATCGAGCTTTTGTCGGTACAT
> CCTCATTGCTTTGTTTAGCGGTTGCATAAGGCTGTTCCTAGGTGCGATTTCCCCGAGGAA
> CTGATGATCCTGACTAGAATCTGTGTTGACGTCATGATCTTCATTTACATGATGAGATAG
> ACCATAATAACACAATAATTAGGAACACATGCTAAATTGAATATTGCAACTGGTAAGAAT
> CATAGATCAAATCTTTCATAATGCCAATCATGGAAAAAAGCACGTGCAGTTATGTTGGTG
> CTGGCGAATGCGGCGGCAGTATTCAATAGTGTTTGCTTTTCTAAGGGTGTTAGAAGACTG
> CTTCGATTAGCATAATTTGACCATAGTAATGGCCTTAGGCTAGAATCACGAACAGGAGAT
> ACTTTGCGCATTCGATAATGATTGGCAAATAATCATTGTAGATTAGCGATTTTATCTCAA
> ACTTATAAAGAGATGTTGTCACACGAACGTCCTCTGCCGTGCTAGGTCTCAAATCAGTTA
> CTCGTCCCCTTTATAGAAACTTCTAATTGACAAGTGTGGCATATTAATGCGTTGTTTTCC
> AACCCAACGACTATTGGCAGATGAGAAGGTACTCCTCGGACAATTATAGAGCAGTCGTAT
> TCCTTAACTGTTCTTTGATGATGCTGGTATACTTTTAGGTACGGGACATGATATACAAGG
> GCATCTTTTAAGGAGCTCGTCCAAAGAGTGAGATTGTATATTAATAAATTCCGAACTAAA
> GGTTGACTAAACGCCACGATGGTGCTCTGAAACGCTTATCTGCCTTTATTTTCCGTCGGA
> GTAATTTCTCTCGGCTATTAGATTTGAACATATACACAGGCCAGATGATCTGGAAAAATC
> CCCTGGCGCAGCTTATATTAATGGTCCACAGCGTATCGCAATCATTAGGTCTAAATACGT
> AGTACATTTTTAATCTTAATAAGCATTAACAGACAAAATGGAGGACCCACAATCCAAACA
> AATTGGGTTAGATTAGATTCAGCCTAAAAGACCCGATGTCAGGAGCCATGAATGTCACGC
> AAGGGCGTCATGTATCTGATAACACTTCGAATAGAAAAAGACGGATCAGATTACAGGCGT
> GATATGACTCTACGGAAATGTTAGTCCAAATGAAAGCTCCATGACTGGCCTCATATGCTT
> GTATTTATATTATGACGAGAATTATAAACAGAACATTCGTCATCCTTGGGCTCAACCAAG
> TAACTGTTCAGATATTCGAACATAATTTCACTTCGTGGAAGTCGTCATAAAAGTATCCAA
> AAAAGAACATCATAAGGATGTAATACCTTTGAATTCGTACATCCAACACTTGTAGTTGAG
> TTCCGAGCTAGCGTATTGCCATGATTCAAATCTGCATTCCCTAACTGCATAAGATTTATA
> GATATATATTTGGGAACTATTATACATTTGTCTAGTTCCGTTAACTGATTTAGCTTAACT
> ATGAATAACCCGTAGTTCCCAGGAGACTAAAAGGACGGAAGAAATCGACTTGATTTGTGC
> ATTATGTGGGTTCGGCCATACTTCCATTGAACTCAGTGCTTTACGAAATTTCCAATTTCT
> ACTGCGTAAGGCCGGATAAAGACCTCATTATCTGATATTTCTAACCGACTTAAACCCTAG
> CTAAATAAATAATGGTCTTGGTGATCTCTCCTAATGCTAGTGTCACCAAGACTTAACTTG
> AATGGAACGTTGAAATTACTTTTTATGCGGATCACATAGATAAAAAAAACTGTGCAGGCG
> CAAACCGTAAAGAAAATTTAGAGTATGTATTACTCCCTCACAGTGTATTGTTCCACTCAG
> CTATTATATTCTTTGTTGACATATAACAATTTTCAAATGAGAGACCTATTGAATCTGGGA
> AATTAAAGTAACGTTAGATGGCAGGAGTAAATTTATGAAAACACTAGGGCATTACCTAAT
> GGGCACCTAGATGCAAGGCGGTATAACTATTATAATCCACAGAAAAAGATAGAGCACTTT
> AACCTGGCTTATGCTTGCGGATCAAGAGAGAGTTAGTAAGTAAGTAGTCGCTACCCTCTG
> TGTAACACCAACACACTGTAGACGTATCAATCGCGAAGGACATCTTTATATGATCTAGAA
> TGAGATTGAAGATAATTTTGACCTATAGTAGTTCATCGCACAGTTATCCGTAGATAACCA
> ATTTGAAAATGACGCGTGGGATAGACATCGATATCGCAATGACGGAACTTCCTTCCCATC
> GGCAGTTTATTTCGACTAAATGTGACATGAGCGTGAGTGATTCTTGCTTACGATCATTTT
> TAAGTACTGAGAACGGGTCAGTATAACATGAATGATAAGAAATAGATGCAGGCTTTAGAT
> TACCTAGGTTGGTCAATTTACGCAATCACTAGGTCGTGAATGGACGACCTGTTTATAGAG
> CAAATCTTATTCGATCATATAAATACTTTCAATAATAGGTAATTAAGTTTCATAATTAAG
> TAAGATTGCCATCAAATGTCCAGCTTTGGATAAGCTTCATGATATAGACTGTTTAACTGT
> AAAGGAAGCGTACGATCGGAACATTTTCTATACTATAGCATATAGATCGAAACTTAAAAT
> TATACACAAGGATCCAATAATCTGCTTAGTTCACAGCTAGTCCGTTCATAGTTGTATATG
> GTCGTTATACCAGCTGTATACGCTGCCATAAGGCCCCATGGGAGATTGACTATAATTTGT
> TGATTGAACAAATGCACCGGTTGACGGCATTTATACCATAATTTAGTTTAGCGAGTCCGA
> ATAAGCTAGATATACTTATTGGACAATATGAATGTCGGGAATTTGATGGATCGACAAACT
> CATCCTATCAAGCCTAAAACGGTTAAACGAGGCATATCTAAATGGGTCTCACCCTCGTAA
> ATCTTACAGTGCATTGACAGTCGATTCATGCCCCTAGCGTATGAGTGCTTGCAGATTGGA
> GACTCGCTAGGAGCGGTGGAGGTCATATGCCCTGTGGTCTAGTCGCGACCCTTATCGTAA
> TTGTCCCAGACACTAAACAAATTTGTAGTGTACTTAACAGAATACAAGGATCCAGAGGAG
> ACTTATCTTATGATCTAGTCTGATCCGATGTGTATAGAGGTACTGATATTGCGACTGTCT
> TTAAGAGTTATGCATAGAAATGAGTTGTAGGCTGTAGTCAGGAGTGAATCCAGAACAGTT
> CAGGTTAAATCTATGCGTTGTGCATTGGTAAAGACAGTGTTAGACGATAATCATCTGCTC
> CGGGATCTGCCAAGATTACGCTAGGGTTGTCACGTCCCGATGAAGAGAGCTCCATACTCA
> TCTTCTTGTATCAGGCTAGCCCAACGCCATGTAATGCAGCGTTCCGAACTCATGGTACTT
> TATTTTATTCTTTCCCTCGGTCCTACAGATATTTGCTTAATCATGTGAGTTAAATTATAC
> CAGCTAATCGTAAGCTATTCAATCTCCCTGGAATATAAATGATTTAACATCATATTCTAC
> TATATTTTACAAGGCTGATCAAGTTACTCGGTTTTCACACAATTAGGCGTGATAGACTCT
> AGACCTTTTTGAAGACCACATAAGAGTCCTTTGACATAAAGTGAAATTTAATACCCGCTG
> AGTATGTAGTGAAAGTATATTAAGTTATTATTAATCTGGATAACCATTTCATGGTCTGGA
> GTACTATTGCAAAACTTGATATGGATGCGCCCGGACTTTGATGTACGTTGAACTGGTACC
> AGTGGACGAAATGACAGCTAATCGACGATATGCAGTGCAATGATGACTTTTCCTGGCTAA
> ACAGGACTTTTATCACCTAGATTTTTAAAATACCCCCGCCGAGCATCGCTACAATCCACT
> CTCGCCTACCTGCATATAATCCATCCAGACAGGTATCAGCTGAAAACTTTTACTGTCGAT
> AATGCGTTGCACTGGTCGAGTAATAGTTTGCTCCCTCACATCCCGAGAAAGTAGTACAAG
> TTTTTATACGTTCATACCAACTAGTACCACTATCCCTAGGAGTTACCGTGCTAATAATTT
> TCAGGAGAAATAGGATCTCGTTCAGCGTCGTATCTATTTATGTCGGGTTCTTTACGATCG
> AATGGACGACTCACACGAGTGGCATCAAGAATTATAAATTAGCAGAACAAGAGGTGGAGG
> ATGAGAAAACACTGTTTTAATCTCCATGTTTCGCTTAATTTATTATAGTATATACAAATA
> GCACATAGCTGTTTTTCTATCAATGTGAAAACAGTTATATTTATAACTTTTCAGATCTAT
> TTACCAGTACAGAGATGTTGGTCTGTTGTACAAAGGTAGGATGGTTGATGTCGTTCAAGG
> TAGCAGCTTTCCACAATTAGTTACATGGTCGCGAAACTAGCTTGGCATAACAACATCGAT
> TAAACATGTGTTTGTGTAAGACAGGTGACTGATGCTATGGACGATGGCGGATTAGTGTGT
> GAGATATTACTTAGAATTTTTATGATGTTATATTAAACGAGGCGGGCTGGCGAATTTAAT
> AATCTAGTAGTCCTGCGTTTGCATGTCGGAATGTTAGTTGCTTTAGTGAGACTTGATTCC
> ACGTACAACAGAGTTAAGTTACAGCGTTATTGTTGACACTTATTTTGTCTTCTAAAAGGC
> ATCTTGTAGAAGAAAGTATGCATTGCGAAGATTGAAGATGGCCAAATTAATGATGGTAAC
> ATCCCTGGGTATGTAGTACCTTTAAGGCTCTTACTAGTTATAGGATACATCCAGTTCTTC
> CAAGCTGCACTGCTCGTAATGCCTATCGGTACTGCCCACCCATAATTTTTTGTACATCAA
> TACCAATAATTCTATGCCTTAACATCTATAATAATATGATACACAGTATCTGTGAATTTA
> CAAACTCGAATCGCATCCTGCATTCTTACGACGTTACTATAGCTATTCTCGATCAAATAG
> CGTAAGTAATTAAATATATAAACATGACCCATACGAAGGGCCTTGATTCCTTAGTGTAAT
> ATGTCAGTTCCCCGCTGAGTATCGAACACTACCCTGAGTACGGACTATAAACAGTAACAA
> CTTTTAACACAAGCATGAACTACTGGCGTAGGCCAGATCCTATGCTCGGGAAAGCACTTT
> CCTCTGTCCTAAGATCTAAATTTTATATTTATGACTTGATTTTACTGAGGATTATTTGGA
> CCAATACTTTCTTTCGATACAGACAAATCTAGATGAAATAAAAATACCCACATTATTTTC
> AAAGAGTTAGTACACGGAGTTAGAGAAAGTTCCGTCTAATTACATTAAACTTATCCTGAG
> ATAGGTTATTAAAGTGAGCGTGTTGTCAATTCCGTTGATTTCCAATGTTAGTCTTCCATC
> GCGCACTGAATACCCCCAGCGACCATATAATCTTTAAATACTGAGCTCGATGACCTGAAT
> ATGATAGGCCACACTCTATGTACCGTACATTGGTCACATATATAGGTTGGTAGGCCAATC
> ATGTAAGGGTTCCGAGAACTTACTTATGGTGGCATAAATGGAAGCGCGTCATCTTGACCA
> GTGGTTCTCCTTGTTAACAAATAGAAACAGGGTAGATTAAATTCCCAGTCTATAGGGCAC
> TCAGAAAATCATGAGATGTAATGACCGTAATCATCATGTAAGTGGATGAGAGTCAAATCC
> GGATATCCGGTTGAGGCTCCAGGCTACTTAAAGCCTCTTCTCGTTAGGTAACAAGCTGTT
> CAGGAGTGAGGTTGCTCTCATACTTAGTTAAGAAAAGAGTGTAAGATTTCTGCATTTGGC
> AATTTACTGAGGACGGCATATGGTACTTGCGTTTTGATACAAAGTTCTCTCACCTAACCT
> AGATTGATGCGTTCCCCTCGTTCTATATCCTCAGCCTAAAGGACCGATTCCAAGAGTGGT
> ATTCTCATAGGATTAACGGTTCCGGCAAAAGTTTTTATCCGCATTAAGGTTTCCTTCTGC
> TTATAGGGGTGCGCTACAGGGATTTTGTGACTTGAACCGACTAAAACACTAACGGTAGTA
> GCAGAGGTTATGTAAAAAAATAGGTTCTTAAATTACTTTTTACCATGAGAGGTATCAGTA
> ATCAAGCTACCCTTAGTGTAAGTGACAGTAATGGCCGACAATATCTACCTCTTTGAAGAT
> ATAAAATGTAAGTTACAAATGGTACAGTATAATAGTGGCAGTACTCATCCTCAAAAGTTT
> TGGATTAGGGCTGCCTAGTGTACGTCGTGACGGTAGACGATTGAAAGTCGATAAATTCTG
> GGATATCCCATATACTTTTTGGTGGTATAGACCACCTAGCATTAAACCTCATACCATCAA
> ACTAGTTAAGCTTTTGACTCTTCTTTGGCAGAATTTGACTAATAGGCGCGACCTCTCAGT
> ACATACCTCTTCCATATACCAATTCGAGTAGCTTTTTAGGATTCCCTGTCAATAGTCACA
> ATACTGCCTTGTCATTAAGCCGCTTTCTAACGGTACAGTTGTGCATCTCGTTGAACAATA
> CGCTGTGCTAAGTATTTTCGAACCAAAAAAATTCGACGCCAGGGTTAGAACAATTAAATA
> ATTCAAGCCATTAGCGAATTGAGCACTATGGTACAGTTTTAAGATCTTCTACAGTCCTCA
> CTCTTCATTGTTATCTCTCAACCCAGTTGTCAAAATCGGTTAAACATATAAGTCGGCTAA
> CCCGAACAGACCTCTTAGTCTAACATGTGTCAGTACACTATAACATGTTCTTGTTAATCC
> AGTGCAGTGCATTGATTAATCTAAGTTTCAGTGAACGTAAGCGGGCCAGACGAAACGCTA
> TATACCTTTTTAGACTAGATCAAAATGGGTCCGGTCCACAGCGATCTTACCCGGAAAATA
> AGGAAGACGAACTAAGTCATTAAGAACCCGGTGATATTCCAAGTGGGAGAGGGATGGTTA
> TAATCCGGACATAAAAAGGCACATTGAACACCCTGCACTATACGCAGGTGTCGTAATTAG
> TACCGGCGTCCTAGCTAGGTTGAAACCCAAAAGTAACAGATAAACCGTCATTTACATGAG
> ACTTTATCTACGCAGCCGAGTAATAACTTGGTTACAGTAGTATTACATAGGAATTGACGT
> TAGAATGTTAGACAGAAAGCCTTAAACGAAAGCACTTCTTCTTAGTACATGAGTTAGATA
> TTACAATTCGGCCTTCTTTCCAACATGTAGTCGTTAATTTGACCCCTACGTCTTGTTTAA
> TTGAAAATCACAATCACTAAATAGAGGTTTGTCACATACTAGAAATATCCTGATTATTAT
> CTCAACATTATTTTAAGTGATCTCCAATACTAGGTAAATTGTGATGCCAGGAAATACCAA
> TTCCGTCGAGACCTCTACAGAGCTTGACTACATTCCTACTAAGACCGCCGTTATGAAAGA
> CTCCTAGGATTTCCCGTGAATGACTGAACAGAAATCAAGTAAACCCGTGTATTTCATCTA
> TTAATATCTTCGTTTAGTGACGGACGTTTTAGTTATCCACCATGGAAGTTTGAGCCCCTA
> GGGCCTGATGCGGAACAACAATACGTGTAATGCGATCTACTGGTTATAAAAAAAGAGAGA
> TCCGAGTAAGTGTAGATCATGAGCCATACTAATATTGTATGTCTTTTATTTATTATATCT
> AGCTTCCCACGGTGGTAACTCTTTCTATAGGAGTGTGATAGTATCCGTGGAATAAATCAA
> CTAATTTTAGATGAATGAGGCTTCATCATAAGACTGTAATCAGTCTGTTACATCCCCAAG
> ACGGAATACAGTAGTCCCTTCGGTACGAAGTGATGTGATTGTAACACTTCTAGCGAGTGC
> GTGGGGTTTTCTTTTCCGAACTGTACCTACTGGTTATGGGGGCGCTCGCATGAACGAAAT
> TGTTGATCCCCGCCCAGCGCTATCGCCCCGCAAATCCTCCGACCACATGGAATAACATAA
> CAAGGTTTTCGAAGGGGGCCTTAACATTAGCGCCTGGTTCAAATACTGTCTATATTAAAC
> TGAATAAAGCTACTATTAGAGTAATGTGCGAGGTGCGCGTTGGTGTTCTAGTTATGATGC
> CTTCATTCTAACAGTAATCTGTATTCTCAAGAAGCGGCTTAAACATAAATAACTTTCGTT
> CATCGTTACTCTCACGCATTAAATTAAGATTAATGTGATACGTACCGGGAAATAAAAACG
> TTAGTTCTGGGTAATAAAAGATTGCCGACTATTGTAGTTATGGGATTGCGGACGAATGGC
> TTATAGGTGGGCTAGAACAGCTCAAAACGTGTGAGTTCCTCCTAAAGTGCATGTCTTAAT
> CTTAAAGTATGCAAGGGTAGTCTTTAGACCACTATCATAGAAAAGCTTACGTAACAAAAT
> TTATATGATTAGTAGGAACGTGCATGGTTGATCATTATAACACATTCTGGTAAAAAAAAC
> AACATTCAGAGTAACATATAGCAAAATAGTCAACAGTTAAATACTCGCTTCGCATGCTTA
> CATTCGCAAACGATTGCTGTGCTATCCGAACATCTTTCTAAATCACTCTACGAGCGGTCG
> GCAAAAGTCTATAGGTCGTATACAAGTATCTGATATTGTAGTATTGGCTACATTATGGCT
> AAACATATTCAAGTGTACCATAAAAATTAAATAGCCTACACGGACGACAGAATTAGAAAC
> AACCAATAGATTTACATTTTTAGCTCCTGAGCAGATGAGAAAACTACACCCAGACGACAC
> CCTCTCCAATGACTTTAATAATAAGTACGCGGAAAACGTAAGTCTCAAACATTTAAATAC
> ATTCTCGTCGATTATGTGTTGGAAAAAGCGTAAGACGGGTACTCAGCGATTGGGCCACAA
> TCTTAACCATTACTATTATAAATATTGAGCCAGGATTTTCCGCTTTCTTAGGGAAATAGC
> ATCCTAAATGTGTCCTTTTTCAAGGTTTTGCCCGGTTCTACGCCATCAAATGAATTTACA
> ATACTATTTTTTATCAAAATCTCGTACAAAGTCGGGATAGGGACCCATATTAAGCGCGCT
> CCTAAATCTGATTAACATTAGTTTGTACATCGCGTAATTGAACATATAATTTAATATGGT
> GAAAGTTTAACCTCAGTTTTACTATCTTCATGTTGCAGCTATTATCACTCAACGGAAAAA
> ACCATAAATTTAACATTTCGCAAAGGACAAACTCGATGTCCTATGACGTAAATGCCTGCA
> TTTACGTTTAATAACTCGGTCAATACTCACACACTTGCCCTTCGCGACATGACCGTATAA
> TTCATTCTCTGCTAACCAGGTGATGGTTGTACGTACCCTCCCAAGTGTTAGTAAATCACC
> TGTAAACTTGGCAAAACTCTGCGAACTTAACCGAATCTTTTGATATACGAGCGACTGGAC
> ATAACAAATTTTCGTATTATCTAAGGGCTATTCAGGGGACTTCTTTTAAACAATAACAAT
> AATTCATCACCGTGATCGATTTTACAAGGTCGCACGCTGTAACTGACCCGAACAGCTTCT
> ACGTAGCCACTAAGCCCACTACGAGTTTCGGTGTAGGTACACTCTCTCCTACGTATCCAT
> CGGATTAGAATAGCCCATTGGAGTAATAACCATTTGGCAACAAGTAATACGACCGTAATT
> CTACTTACTTTTGCGCAATTAGCAACGCTTGGGTATCGGATACATATCTGTCAAAAGTTG
> TTGAGACCTATTTTTCTCAATCAGTAATCATTTCGTTACGGCGCTTGTTTACAGTAGATG
> CTAATTATTGGTGAAGTCCTACTCCCATTGTGCAGTGGAGCGTTTATTTATAACTAAAAA
> GAATGGAATAGGATATCAAATGATTACATATATGGGAATCTCCACCTCCATGCGATGCTC
> AGTTTAATGTATCAGGTAAATACAAGGTTTTGATTAAAATTGAAAAAAAGAACGAATGAG
> CCATCATGTTTGGACGAATGTCCCGATCAAATAGTACCGAAACTAAAAGACTGGTAAATC
> CAAAACCCAAACTGAAAAGACATCAGCGCTGACCCCTACGATACAACTTAATCACTTTGG
> CAAACATAGAAATCGCGTTGTTTTATCTTTGTTACGATTTCATCGGATGTGTATTTGATT
> CTCCCGGTTTTGCTGCTAATGCGGGGCTATACATTTTTAGCATAGAAGATACGTAGCTAA
> CGCCAGCAGAAGAAACCGTTCTTAGCGACGCGATTCGTAGCCACTAGATTTGTTCGACGT
> GATACCGTTGTTCAGATTAGAGATAGAGCACGGATCATATTTAAAGTTTTACGCAACGAA
> AGTTAAATATATATAAAAATGCATGGGACTCTCAAGGTATAAAACTGATAAAAGTGTGTT
> AGTGGAAGAAGTGACCCAATGCCCTTTCTTAGACTTATTCTAGTATAAATCCTTCTTGCG
> GGTCATATATTCGCTTGAGATATAATCAGGATTCGCTGCTGTCCAGAATATTCAATCTAT
> TTCCCAGAGGTCTTTTAGCAAAGGCATGCACGTAATTCAAGGGGCCGAAAACACTATAAT
> TACGGTTGATTCTTTCTTACATGTATGGATTCCTAAGGAAACATCCCTAGCACAACGTGC
> GGTCCCCTTTCCTAGGTTTCGCCCTGTGAATGTCTTGTTGTTGCAGTCTTTCTACAGTCT
> CTAGAATACCCAAATCTAAAGTCCAAAGTCATGATACCCACAGTGAAACGTTGCGATGAA
> ACCGCGGACTCATAGATTTGGAACACCTTCCGTTATTTCTTGGCATAATTGTGGTTGTCC
> CCAAACGATTGGTGCTTGAAGGAAGACACAAAGATAAGGATAGTGCAAGCAGTCCTATCT
> TCATGGAGAAGTGTATTAATCCTCTGTGAATTCTTGGTTATTGCTCCGGGCATGATTTTT
> GACCGGAATCGATTCTCATCCCCAACGTAATCCATTTGTGAATGTAGGTTTCAACGTTTG
> AGGTGGTTTTCTTCCCACAATTGTAAACAAGAATCTGTGTCTGTAATTCCGGCTAATTTA
> ACCTCAATCGAATCCACATTCTTTCTTGGTGCGGGCGAGTTTGGGTAAGAAAGAGACATC
> TATAATGTATCCTAGGGGCTGCAATATGTATTCAAAATTAATACTGCACAGTCATACTTA
> GCCGGTTCAGGGTTGGAGAACTGAGGAGGGTGAGCTATTACGCCTGCTTAATCCTATTAT
> CATTTTCCTTACTCACGCCGGAAATCTCTTACTATCGTGGCACCCTCTCAAATTATACCC
> AACGGCTTAATTGTTAAAAGTCGCGCCCCAAGCATCATTCGTAGATTATACAAAATAGAT
> AGCAAGTCTACCCTATGAACATACTGGGCATGCATTAAAGATAGTAAAGAAGAAGGTCTG
> CAGGTTAGCATAATTGATTTTCCTAGAAGAGTGGGGGAGAGGAGCAATATGTGTACTCGG
> ACAACAAGACGCAAGCCACTCCGTAAAACGAATTAATCTGCAACGTTACGCAGGCGAAAG
> GCGGACTACTTCAGGTTTTCTGATAAAGTTTATGAACATTATTAACTTTTACAAAGAATC
> CTGCCAAACCATTAAGGCCGGGTTACTGTTTACATTCTATAAGGTAGATAATATCAAACT
> ACACTAATCGACTACTAATTAAAGGCAGTAAAACTTGCCTACATATCGTGGACAGGAGTT
> TTTTTCCACATTGGGTCGGTACTGACTCTTTCCTTTCGTTTCACGGTCAAGATGGATGTG
> CATAGGTGCGTTTGCCCCGTCGAACTGATGATCCTGTCGAGAATATCGGTTCTAGGCAGG
> ATCTTCAGTGACATCTGGACATACTAAATAAGAACTATATAATGAGCATCAATTGAGATA
> TTGATGATGGCAACTGGGATCTAGAATAGAGAAAAGCTTTAAGAATCCCTATCATCGTAA
> AAAGAAACGGCACTTATGTTGCTCCTGGACAAGCACGCCCAACTTGTCAATTCTCGTGGC
> TTTTCTAAGGGTGTTAGAAGAAGGATTCCATTACCATAATTTGACAATACTATTGCACGG
> TCCAGAGAATCTCGAACTGGACTTACTTGGCGAATGACATAATGATGGCATAATAAGATT
> TGTTGATTACAGAGGTGTTATAAAAATTAGATAGAGTTGGGGTCTATACAACGGCAGATC
> CCGTCCTTCCGATCATTTAAGGTTCGCGGACCATTTATAGTTAATTCTAATTGAAAAGTC
> TGGATTTTTTATGCGTGCTGTTAATAAACATCGAATTGGGCAACAGCTCATGGTACTCCG
> CCGACAATTATAGTGCAGTACTATTAATTAACTCTTCTTTGATCATGCTCCTATACGTTT
> TGCTAACCGACATGTTTTACATGGCAAGCTTGGATCCACATACTACAATCTCGGTCAGTC
> TATATTAAGTAAGTCAGAACTAATGGTGGACTATACGCCACGATCCTGAGATGTAACCCT
> TTGCGGCCTTTATTTTACGTACCTGTTTTTTATCTCGGAGATTAGAGTTCATCTGATACA
> CAGGCAACTTGTTCTGGATAAATACCAGGCACCAGCGTATATTTATCCTCCTCAGCCGAT
> CCCTATCATTTCGGCGTAAGAAGTAGGTCATTTTGAATCTTAATAAGCAGGTACAGACTA
> AATCGACCACCAAAAATCCTATCAATTTCGCTTAGAGGAGATTCAGCCTATAACAAAACT
> GCTCAGCAGACATGAAGGGCAAGCATGGCCGTAATGTATCTGAGATCACTTCGAATTGAA
> TAAGAACCAGAACAGTTCACGCGTGATAGGTATCGTCGGATTTCTGTCGACTAATGTAAG
> CGCCATGACTGGCATCAGTGCATTCGTGGGATAGTAGCTAGAGATTGATAAACAGATCAT
> TACTCATACGGGGCCGCAAACATGTAACTGGGCACTTATGCCATCATTTGTGCACTTACT
> CGAAGTCCGCATAAAACTTTAAAATATAGAACTTAAGATGGAGGTATTACATTTCAATTC
> CTAAATCAAAAACTTCTACTTGTCTTACCTCCTAGCGTATTGACATCAGTCTAATCTCAA
> TGACATTTCTGAATTAGAGGTATACTTTTTTAGTTGGGATAGATTATACATTTCGAGTGT
> TCAGGGAACTCTTTTAGCTTAAATATCAATAACCCCTAGTTAAAACCAGACTATTACGTC
> CGATGAATTACTATTCTTTGGGGCTTTTTCTGGGTTCGCCCATACTTCCTTTGATATCTC
> TGATGTAAGATATTTCCAAGGTCTTATGAGGAAGGCCGGATATAGACCTAATGATCTCAT
> ATGTAGTACCCACTGTAACACTTCATATATAATGATTGCTCTTCCTGTTCTCTACGAATG
> CTAGTCTATCATAGACTTATCGTGAAGCGATAGTTCATATGAAGTGTTTTGCCGATAAAA
> TTCTGTAAAATAAATGTCAAGCCGCAATCCGGTAACTAAATGTACTCTTTGTATTTATAA
> ATCACTGTGTTTTGTTCATCGCACAGATGATTTTCTTGGTGCAAATATAAATATTTTCAT
> AGGACACAACGATTGAATATCGGTTTGTAAACTTAAGTTACAGGGCAGCAGTTATTTTAT
> CATAACTCTAGGGCAGGACATTTTGGCATCATTGTTCAAAGGCGGGAGAAATATGATATT
> CCAAACAAATACATACAGCTATTGATACTCGATTATGCTTGCCGTTCAACACTGTGTGTG
> TAAGGATGTAGGCGCTAACCTCTGTCTAACACCTACACTATCTAGAACTTTCATTAGCGT
> AGGAAAGCGTGATTGGATCTACAATGAGAGTCATCATTATTGTGTACGATACGACTTCAG
> ACAACACTGAGCAGGACAGAAAAATTGTCAAAATGAAGCCTGGCATACACATCCATATCC
> CTTTCAAGCTACTTCAGTACCAGCGCCAGTTGATTGCCACGAAAGGTGACAGGAGCGTCA
> GTCATTCTTGCTTACCATCATTTGTATGTACGGAGTAAGGGTCAGTATTACATCAATCAG
> AAGAAATAGATGATCGCTTTAGATGAAAGAGGGTCGTAAATTGTCGCATTAACGAGGTCG
> TGATTCGACGAAATGTGGATAGACAAAAGCGGTTTAGATAATATATTTACTTTAAATAAT
> ACGTATTTAAGTTTAAGAATGTACTAAGATTCAAATCAAATCGCCACATTTGCATAACCT
> TAATGATAGTGTATCTTTTACTGGAAAGCATCCCTACGAGCGGTTAATTTTATATTATTT
> AGAATAGAGAGCGATACGTTAAATTATAAACAACCTGACAATTAGAGCATGTCTGAACAC
> CGTGTACCTGAATACTTCTAGATCGTCCTTATAACACCTGGATACCCTCACTTAACGAAC
> CATGGGTGTTTGACTATTTTTTGTGGATTCATCATATCAACCCCTTGTCCCATGGTAGAC
> CATAATGTTGTTGAGACTCGCCGAATATCATACATTGTCTTATTGCTAATTTTCAATGTC
> CCGAATGGGAGCGTTACACTTTATAATAATAGAAACCATTAATCGGTTTAAACAGCAATA
> TCTAAATGGCTCTCAAACTAGGAATGCTTAAAGGGATTGCTCAGTAGATGCAGGACCCGA
> CCCTATGTGTGCTGCCACTTTGGTCACGAGATAGCAGAGCTCCAGGTATGATGCCCTGTG
> GTAGAGTCGCGAACCGTATCCTAATTGTAAAAGTCAATAAACTAAGTTCTACTCTTAGTT
> AAAGATTAAAACCTTCCAGACGAGAATTATCTTAGGATCGAGTATGAGACCTTGTCGTTA
> CACGTACTCATAGTGCCACGCTATGTTAGAGTTTTGCATAGAATTGAGGTGGTGCCTCGT
> GTCTCCTGTCTTTCATGAACAGGTCAGCTTAAAGATTTGCGTTGTGCATTCCTATACACA
> CGCTGACAACAGAATATTAGGATCACGGATATGCCAACATTAAGCTACGGTGGTAAACGC
> CCGATCAAGAGACCTAAAGAATCATATGCTTGTATAACCCTACCCCAAAGCATTGTAATG
> CAGACGTCCGTAATAATCCTAAGTGATTTGATTAGTGCACTCGCGCCTTCTCATTGTGGC
> GGAATAATCTGACTTAATTTTTAAAAGCTAAGCGGTAGATATGAATTCTCCATCGAATAT
> AATTGAGTTATCAGCAGATTCGACGATATTTTACAAGCCGGATAAACGTTCTCCGTGTTC
> AATCTATTACCCGTGATAGTCTATTCAACGTTTGGAAGAACAATTAACAGGAATTTCTAT
> GATAGTGATAGTTTATTAAAGCTGACGTTCTTCGCTTAGGTTTGTTTGTTATTATTAATC
> TGGATAAACTTTTCAGGGTCTCCAGGTATTTGGCAAATCTTCATATGGATGACCCCCCAC
> TTGCAGGTTAGTTGAAATGGTACAACTCGTCCAAAGGAAAGATTATACAAGATAGGAACT
> GCAATCTTGAATTTTCATGCCTATTCACGAATTGTAGCACCTAGTTGTTGAAAATACACA
> CGCCGACAATCGATAAAATCAAATAGCCCCTAACGGCTGTTAATACATCATGACACCTAG
> ATGCTGAAAAAGTGTAATGTCCATATGGACTTGAACTCGTAGAGTAAGTGTGTCCTCACT
> CTCAGCAACACATAGTACTACTAGGTGTTATAAGTGAATACAATCGTGGACCACTTTACC
> TACGTCTTTCCCGGAGATGTAGGTTAACCAGTAATAGGATATAGGTAAGAGTAGGAGAGA
> GGGATGTACGCGTCGTTAAGAGCGAATGGAAGACTCAAACGAGTGGCATCAAGATTGAGA
> AATTAGCAGAACTAGAGCTCGAGCAGCAGAAATAACTCTGTTATTCTCCATCGTTCGATG
> AATGTATTATTGTAGTTACAAAGACCTCATACCTCTTTTTATATAATGGTCTTAACACTT
> TTATGTATAAATTGTCTCTTATAGTTACCAGTACTGAGTTCTTCGTATCTTGTACAAAGC
> TTGCTTCGTTCATGTCGGTAAAGGGAGCTCCTTTAAACAATGTGGTACAGCGTCCACATA
> CTAGATTCGAATATCATATTACAGTAAAATTGGCGTTGTCTATCAAACGTGTATGATGCT
> AGGCTCCATCGAGGATGAGGGTGTGTGATATTAATTAGTATTTTTATGTTGTGATATTAA
> AAGACCCGCGCTGGAGAAGGTAATTATCTACTACTCCTCCCGGGGCAGGTCCCAATGTGT
> GTTCATTGAGTCAGACGTCTGTACACCTAAAAATCTGTTATCGTACACCGTTATTCGGGA
> AACTTAGTTTCTATTATAAAAGCCATCTGGTACAAGTTACTTTGCATGCAGATCTGTCAA
> GATCGCAAAATTAATGAGCGGTACATACCTGCCTTTCTAGGTACTGGATGGAGAGTTCTT
> GGTATAGCATAATGACTCTTCTTCCAACCTCAACTCCGAGGAAGCACGATCGCTACTGAC
> ATCAAATTATTTTTGGGACATCTAGACCAATAATTCGTGGCCGTAAAATCTATAATTTGA
> TGATACTAAGGAGATCTGAATGTACATACTCGAAGCGCTTCCTGATTTATTTCGACGTGA
> CTTTTCATATTATAGATCAAATAGCCTTACGTAGGAAATATAGATACAGCAACAATACGA
> ACGGAATTGTTTACGTTCGGTATTATGTATGTTCACCGCGCACTTTCGTTCACTACCCTG
> TGTTCGGTCTAGATTCTGGAAAAACTTTTAACTCTACCAGGAACTACTCGCGGACGCATG
> ATCCGATGCTAGGCATAGCTCTTTCCTCGCTACTATGTTAGAAAGTTTATATTTATGTCT
> TCAGTTGAATCAGCTTTATGTGGAACTATAATTTAGTTAGATACAGACAAATCTAGATGA
> AAGAAAAATAACCAATTTAGTTTCAAAGACTGTCTAAACGCACGTAGAGTAAGTGACGTA
> TATTTACTTTATAATGATCCGGAGATAGGGTATTAAACTCACAGGGTTCGAATGTCCGTT
> CATGTCCAATGTTACTCTTCATGCCCGCAATGTATAACCCCTGCCAAAATTGTATATTTT
> TATACTCTCATCGATGACCTGAATTTCATACGACACTATCTAGGTTACCTACTTTGGGAA
> CATATAGTGCGGGGTAGCCCAATCTTCTAAGCGTGCCGAGTACGTACTTAGGGGGCCATA
> TAGGCAAGCCACTAAGCTGCTACTCTCCTTCTCCTTGGGAAAATAGACAAAAACGGTTGT
> TTATATTACAAGGCGATAGGGCACGAACTATTTAATGAGATGGAATGACACGTTTCATAA
> TGTAACTCGAGGTCTGGAATTTCCGCATAGCCCGTTGAGCCTCAAGGATACTGTAAGCAG
> CTTCGAGGGACCTTACTACATCGTCTGCTCTGACCTTCAGCTCATACTTTGTTAACATTA
> CAGTGTTACATTGAGCCAGTTGCAAATTTAATGAGGACGGAAGATCCTACTTCCGTTGTG
> AGAATAAGTGATATCTACTATAAGAGAGTGATGCCGTCACCTCCTTATTGATCCGCTGCC
> GAAACGAAAGAGTAATACAGTGCTAGTCTCATTCGATTAAACGTTAAGCCAATAGTTTTG
> ATCCCATGTTAGCTTGCAGGCGCCGGTTACGCCGGCCATTCTCGGTTTTTGTGTCGGCTA
> CAGACTAAAACACTAACGCTAGTAGAACAGGTTTGGTAAATAAAGAGGTTATGAAAGTTC
> TTGGTACCATGAGAGCTATCAGTATTCAAGATACCCTTACGCGAACGCAATCTATTCGCC
> GACTTTTGCGTCATCTTTGTTGAGTTATTAGCGAAGGGACTTAGGCTAAACTATTATAGT
> GCCACTTCTCAGCCTAAATTGTTTTGGATTTGCCCTGCCGACTCTACGGCGTGACCGTAG
> TACAGTGAAACTACATTAATGCTCGGATATAACAGAGAATGGGTGGGGCTTGACACCACA
> TACCAGTAAACCTCTTTCCTTCAAACGTCTGAAGATTGTGAATCTTCGGTGGCTGAATTT
> GAATTATAGGCCCGTACTCTATCTACATACAGATTACAGATACCAAGTCGAGTAGCGGTT
> TACGATGCCCTGTCAATAGTCAAAATACGCAATTCTCATTAAGAACATTTAGAACCGTTC
> ACTTGGCCAGCGCCTTGATCAATTCGCTCTGCGTTCTAGGTTAGAACCTTTAAATTTCGT
> CCCCACCCGGACAAAAAGGAATGAAGTATAGCCAGTAGAGAATTGTGCTCTATGGTTCAG
> TGGTATGATCTGATACACTCCTAACTATGAATGCTTTTCTAGAAAACCACTGCTCATAAT
> CCGTTTATAATATATGTACCCTATCACGAACAGAAATATGACGCTAACATCTCTATGGTC
> AATTTAAATGGGTCTTGTTTATCCAGTGCAGGGAATGGATTAATAGATCGTTCAGTCAAC
> GGATGCCGCCCTGTCCAATCCATAGAGAACTTGTTAGTATTGTGATTAAGCCCTAAGCTA
> CTCACCGATATTACCAGGTATATAAGCAACACGAAAGTAGTCTTGAAGAAAACCCGGTTA
> TGCCAACGCCCACAGGGATCGGGATAATCAGCAAATAAAAACCAACATTGTACTCCAGCC
> AATTGTACCAGGTGTCCTTATTTGTAAACGCGTACGTGCGAGCTGGAAACCAAAAACGAA
> AACATATTCCGTAATTTAAATGAGTCTGTAGATACGCAGAAGAGTATTAAAGTCGTTAAT
> CGAGTATGAATTTCGAATTCACGTGAGTTGCTTAGACACAAAGCCTTAATCCTTAGAACG
> GCTTATTTGTAATTGAGTTACAGATTACAATTCCCCATTCTTTCAATCAGGTACTCCTTA
> ATTTGAACACTTCGGCTTCTTTAAGTCAAAAGCACTTTCTATAAATACAGGTTGGTAAAA
> TAATACAAATTTCCTGAGGATTTTAGAAACATGATGGTTAGTGTTATCATAGAATACCTA
> AATGCTCATCCATCCTAAGTCATTTTACCTAGTGACCGCTACACACCTTGTCTAAATTAC
> TTCGTACACACCCCGGATGAAACAATACTACGATTGCAACTCAAGGACTGTAAACATATC
> AAGTAAAACCGTGTATGGCATCTATTATGATATTCCTTGTGTGACGGTAGTTTTACTGTT
> CAACAATGCTACTTGGACCACCTTGCGAAGGTTGACCAACAACAATACCTGTAATGAGAT
> CGACTGCGGATTATTTATGTGACAGACGACTAACTGTACTTATGCACCCAGACGAATTTT
> CTTTGTATTTTATTTATTATAGCGACATTACAACGCTGGGAACTATTTAGTTACGAGTGT
> GATTGTATACGTGGAATATAGAAAATAAGTTTTCTTCTATCAGCCTGAATCATAAGACGC
> TAATCACGATGTTTCAGCCCATTCAAGGAATAATCGAGTACCTTCGCGTAGTAGTGAGGG
> GTTGGTAACACTTAGAGCGACTCCCTGCGGTTTTCGGTTAACTACTGTAAAGTCTGCTTT
> GCGCCCCCCGCGAAGCAACGAAAGTCTTGATAAAACCCCTCACATTGCCCCAACCATTGC
> ATACCTAAACTTGGAATTACATAAATAGGTTTGCGAAGGCGGCCGTTACTGTAGCGCATG
> GTGCAATTACGGGCTATATTAAACGGAATAAAGAGACTATTAGAGTTATCTCCGACGTGC
> GCGTTCCTGTTCTTCTTATCTTGCCTTAATTATTACACTATGCGCTAGTCGAAACAAGAG
> GCGGATACTTTAAGTACTTTAGTTCATCGTTAAGAGAACGAATGAAATGATCTTTATTGT
> CTTAACGAACCGGAAAGAAAAAACTTTCTTCTGGGTAATAAAACAGTCCAGAATATTGTT
> CTTATGCGATTGACCTACTATGGATGTGAGGTGGGCGTCAACAGCTAAAAAAGTGTGTCT
> GCATAAGAAACGCCATGTCTGATTCTTAAAGTATGCAACGGTACTAGTTTGAACACTATA
> ATAGTAATGCTTAAGTAACAATATTTTTATCATGAGGAGCTACCTCCATGGGTCATCAGT
> ATAACACTTTCTGGTAAAAAAAACTACATGCTGTCGAACATATAGCTTAATAGTCTAAAC
> TTATTTAAGCGCTGCGCATCAGTTAATTACAAATCCTTTCCGCTGATTTCCGAACATCTT
> TATTAAGCAATATACCTGCCCTCCGAAAATCTATAGAGGGACGTTACAACTATATCATAT
> TCTACGATGGCCTAATGTATCCATAAAATTTGTCTAGTCTTACATAATATTTAAATTCCA
> GTATACGAACACTCTAGTAGAAACATAATATTCTGGGACATTGGGAGCTACTGACAAGAT
> CAGATAACTAATACAACACCTCACCCGATCCATGGTCGTTAATATGTACTACCCGGAAAA
> CGTAACTCTAAATCTTGTATATTAAGTCGCCTAGATTATGGGTTCGTAAATCACTAAGAA
> CGGTACTCACCCATTGCCAAAATAGCTGAACCTTGAATATGATAATTTTTGAGACAGGAT
> TGGCCCATTGATGACCGTAATTGCTTAATTAATCGGGACGGTTGCAAGGTTGGGAACGGG
> TATTAGACATCATATGAATGTTAAATTCTATGTGGTATCATAATATAGTACTTACTCCGC
> ATAGCCTAACATTGTTTCCGCCCTAAGTTAGCGGATTAACATGAGGGTCTAAAGACAGTA
> ATTCATCTTATATGTTATTATCGGCAAACTTGAACATCAGGTGTTCTAGCGTCATCTTGC
> AGAGATTTTCAATCAACCGTTAAATCAATAATTTTTAAAGTTAGCAAACCTCATTATCCT
> TGTACTATGACCTATATGCCTCCTGTTACCTTGAATATATAGCGCAATACTCACACACTG
> CCCCGTCGAGTCAGGACAGTTTAATTCTGTAGCTGATATAATCGTGATGCTTGTAACTAC
> ACTACCAAGTCTGACGAAATAACCGGTTAAATTGGCAAAAATCTGCGAACTGAAAAGATG
> ATTTTCTTATACGACCCAATCCTCATTAATATTTTTCCGATGATCGAAGCGATAGTAAGC
> GGAAGTCTTTTTAACAATAACAATATGGCAGATACCGCATCCATTGTTCAAGCGCGCTCC
> CGGTAAATGACCAGAAATGATTCTACGGAGCCACTTTGCAATCGACGACTTTCCGTGTTG
> GTTATATATCGCATACGGAGCAATACCAGTAGAATAGCACATTCGTGGAATAAAATGGTC
> GAATATAGTATTAACAACCTAATTCTAATTTCTGGTCAGCAATTAGAAACGCTTGCCTAT
> AGGAGACATATATCTCAATACGTCTGGAGAACTATTTGTCTCAATCACTTATATGTTAGG
> TACGGCGCTTGGTTAAACGAGTTGCGATTTTTTCGTGTACTCCGTAGCCCATTGGGAAGG
> CGAGCCTTTATTTTTTACTATATTCAATGCAATTGGAGATATAAGCAGGACATAGTTGCC
> AATCGACTAATCAATGCCATCATCAGTGGTATCGATCAGCTTTTGAAAAGGTTTGCAGTA
> AAATGGAAAAAAAGAACGAATGTGCCATATTCGGTGGAACTATCGCACGAGCAATGAGTA
> ACGAAACTAAATGACTGCTAAAGCCAAATCACAATCGGTAAAGACAGCACAGATGTCAAC
> TAACAGAATACGGAAGATCTGTCGCTATATTTCAAATCCCGTGCTTTTATAGTTGGTACG
> ATTTCAGAGCATCTCTATGTCATTAGACCCCTTTGGCGGCTAATCCCCGGCTTTACATTG
> TTAGATTAGAACATACCTTGCTTTACACTGAAGATCAATACCTGCTTAGCCACGCCATGC
> CGTCAATATACATGGGTTCCAAGTCTTACACGGCGGAAGATTACACATACACATCCGAGC
> TTTTGTAAAGTTGGACCCTTACAAACGTAAAGTTTTATAAAAAGGAATGCCACTAGATAG
> CTATAAAACTGAGAATTCTGTGTTAGGGGAAGAAGTCAACCTTTGCACTTTCTGAGACGG
> ATTCTAGTATATTTCCTTAGGGACGCGAATTTAGGCGATTCAGATTTTATCACCATGACC
> TCATGGCCAGTTTTTTAAAGATTTGTAACTCAGGTAGGTTAGAATACCCTGCCTACTAAG
> TAATCCCGACGAAAACAATAGAATGACGGGTGATGCGTTATTTCTTCGTTGGATTAAGAA
> CCTAAAATCCCTTGAACTACCTGACGTACCCGTTCCTACCTTTAGCACTGTGAAGGTATG
> GGTGTTCCACTCGTTATAATGTCTATAGAATAACCTATTCGAAACTCCATAGTCATCTTT
> AACACTGGCTAAAGGTGACAGGAAAAACACGTAGAATTCATTTGGAAATACGTCAGTTAT
> TTCTTGGCTTAATTCTCCTGGTCAAAAAACGAGTCCTCATGCATGGAACTCTCTAACATA
> ACGATAGTGATTGCACGAATATCTTCATCCAGATCTCTTTGTATAATCTGTGTTTTCTTG
> CTTATTGCTCAGCGATTGATTTGGGTCACGAAGAGATGCTCTGCCCCATCCGAAGACATT
> TGTCAATGTACGGTTAAAAGTTTCTCGTGCTTTGATTCAAACAATTGTATAAAACTATAT
> GTGTCTCTATTTACGGAGAATTTAACCTCTAGCCAATACAATTTATGGAGGGGTGAGGCA
> GAGTTTGGCGTACAAACAGAAATCTATTATGGATAAGTGCCCCGCCAATATGTTTGAAAT
> TTGTATAATCCACACGCTTTCGGTGAAGGTTCACGCGTCGAGAAATGTGCACCCTCAGAT
> TGTACGCCTGATTTAGCATAGGAGAATTTTAATTACTAACCACCCAAATCTCTTACTATA
> GTCGCTCACTATCAAATTTTTACCATAGGCTTAAGTCTTAAATCTCGCCAAAAAAGCTTC
> TTGCCTACAGTATAATAAATACAGAGAAACTCGACCCTTGGTACTTAATCCCCTTGAATT
> AAACTGACTTAACAAGTAGGTCGCCAGGTTACCATTTTTCATTTTCATTGAAGAGTCGCC
> CAGAGCTGCTATATGTGGAATAGCACAACAACACGCAAGCCTCTAACTATATAGATGTAT
> TATGCTACGGTACGAAGCCCAAAGCCCGAAGTCTTCACGGGGTCTGATAATCTTTAGCAA
> CATTATGAACTGTTACAAAGATTCCTGCCTTAACATTTTCCCAGGCTTACTGTTTAATTT
> ATTTAAGCGTCATAAGTTCATAATAAACTAATAGTAGACGAATTTTTCGCAGTAATACTT
> GACTTCAGAGACGGGACTCGAGTGGTTTGACACATGGGGGCCCTAATGAAGATTTCATTT
> CGGTTCACCGTCAAGATGCATCGGAAGTGCGGACTTGGACACGTCCATATCATCATAAGG
> TCGACTATATCGGTTCTACGATGCTTCGTAAGTGTCAGCTGCTCTGTCTAATTTTGTTAT
> ATATATTGACCTTAAATTGAGATATTGATGTTGGAATAGCGGATCTAGAAGACTGAATTG
> CGTTAAGAAGCACTAGAATCGTAAAAACAAACGCATCTTAGCGTGCTCAGCCACAAGCAC
> CACCAACTTGTATATTCTCGTGCAGTTTAGATCGCGCTGTCTACAAGCAGGACTGGTCAA
> TTTGGTCAAAATTCTATTCCACGGTCCAGACTATCTACTAATCCTCTTAATGGCACAATG
> ACAGTTTCTGGCCATAATTAGATGTCGTCTGTACACTGGTGTTATAATAATGAGATACAC
> TTCGGCGCTATACTTCCGAAGATCCCCTCATTCCGAGCATTTAAGGTTCGACGAACATTG
> AGACTTTAGTATTAGTCTAAAGTCTCCATTTTGTTTCAGTGCTGTTAATAAAAATACAAT
> TGGCCATCAGCTCATCGTACTACGACCAAAATTAGACTGAACGACTTTTAATGTTATCGT
> ATTGCTTCATCCGCCGAGTAGGTGTCCTAACCGAATTGTTTTAAATCCCAAGAGTGGTTC
> CTCAGACTAAATTCTCGCTCAGGCGATAGGAAGTATGGCACATCTAATGGTGCTCTTTAA
> CCAAAGATCCGCAGATCTAAACCGTTGCGCAATTTATTTTAAGTACCTCTTTTGTAGATC
> CCAGTTTACAGGTCATATGTTTAAAACGAATCTGCTTATCCTTATAGAAAAGGCACAACA
> GTTTTGTTAGCCGAATAACACGTGCCATATATGTTCGGCGTAAGAAGTACGTAAGGTGGT
> TGAGTATTTACATGGTACTGTATTATTCCTCCTAAAAAAATAATATCATTTTCCCGTTCA
> GGTCTTGAACAATTTTTCAAAACTGCTATGCACAAAGGTAGCGCAACAATGCCCCGAAGC
> GATATCTGATAACGTACTTGTCTATAAGTACCTGATCAGTTAACGAGTGTGAGCTAGAGT
> CGCATTTCTGTCGAATATTCTATCAGACTTCTCGCGAATATGTGCATGCGTGGGTGAGGA
> GCTAGTCTTGGATATTAACTTCTTTACTAAGAAGGGCCCGAAAACATCTAAATCGGAACT
> GATGACATAATTTGGGAAAGGACTCCAACTACGATTAAATCGTTAAAATATAGTAATTAT
> GTTCCTGCTATGACATTTCTATGACTAATTCATTAAATGCGACTTCTCGTAACTCATACA
> CGATGCAATTCAGGATATTATCATTGAAATTTATCAATTAGTGGTTTTCTTTGTGAGTGC
> CCTTAGAGTATTCATTGCGAGTCGTAACGGATCTCTTGGTCAGTATAGAGCATTATAACC
> TTGGGAAATCCAGAAGTTTTCCTACCTTGTATTACTATGCTTTGCGGATGTTGCGCGCTG
> ACCCCATAAGTCATTGCATATATCTCAGGTTAGTTAGGTACATGGTAGTATCACGAACGA
> ACCTTTTACAAAGATTGTGATCATATGTAGTAAACAATGTAACAATTCATATTTTATGAT
> TCCTCGGCCGCTTAGCTACGTTGCATAGGCTATAATACAATGATCGTCTTGCGATAGGGC
> TTTTGTAGTGGTTGGACGTGAAATGTCTGTTTAATAAATCGCAAGCAGAATTAACGTATC
> TAAATGGTCTCTTTCTTTGTATAAATAACTCTGGTGGCTGCATAGCACAGAGGTTTTTAT
> GGCTGCAAATATAAATAGGTTCTTAGCACACAAAGATGGAATATCCCTTTGTTATCTTAA
> CTTACAGGCAACCTCTTATGGTATCTTAACTCGTCCCAAGGTCAGTTGGCCATAAGTGTG
> CATTCCACCGAGTTAGATGATATTAAAAACTTTTTCTTACACATATTGATAAGCCATTAT
> CATGCCCCTTATACTCTCTCTGTGTTACGTTCGACGCCAGAAAATATCTCTTTATAATAA
> TCTAGCTACTACTTGATTTACACTAGGAATGAGTGTGTGCATCTACAAGCTCTGTCATCA
> TTATGGTGTAAGTGACGTCTGAAGACAAAACTGTGAAGGTCAGTTAAATGGTCAAAATCT
> ACACTCGCTGTCACTTACTGATACATTTCAACCTTATTAAGTAAATGAGCAACGTGTTGG
> ACAAGTTAGCTCTAAGGTCCCTCAGGCTTTATTCATTAACATATGGTGGATGTAAGGACT
> AACCCTAACGATTTATTCAAGCTGTACAATGACTTCATCCATTTACAGGAAAGTCCGGCC
> TAAATTGTCCATTTAAAGTGCTACTCTTTCCTCCAAAGCGGGATACTCATTAGAGGTGTA
> CTGAATTTTTTTAATTGAATGATGTCGTATTTAACTTTAAGTATGTTCGATGTTGCAAAT
> ATAATCGAAACAGTGCCAGTTCATGAATGATAGTCTATCTGTTTAGCGAATCCATCACTA
> AGTGACGTTAATGTGATTTTATTTACATGTGAGAGCCATTAGTTATTGGATAAAAATCCT
> GACAATTTGAGCATGTCGGAACTCAGTCTAACGGATGACGTCTAGTTCCTACTGTTAAAT
> CATCGATTACATCAATGTACCAAAATTCCCTCTGTCAAGAGTTTTGCGGGAGTCATAATA
> GCAACACCGTGTACCATGGTAGTCAATTATGGTCTGGACACTCGAACAATTTCATACTGT
> GTATGTGGCCTAATGTGCTTTCGACCCAAGGGCTGCCTTACAATTTAGATTAATAGAAAC
> CATTAATAGGGTTAAACACCATGTTATTTATCCCGATAAAACTACGATTGAGGTATCGCA
> TTGCTAAGGACATGAAGCAAAAGACACTATGTGTCAGGCAACTTGGGTCAAGACAGTCCA
> CACCTCCTGCGATGTTGCACGCTCCTAGTCTAGACTAACGGTTCCTAATTGTAAAACTCT
> AGAATATATGGTCGACTCTTAGTTAATCTTGAATACCTTAATGACCACAATGATAGTTGC
> ATAGAGGATGTGAACTTGTCGTTACTCGGTCGCTGAGGCACAAGCGATGTTACAGTTTTG
> AATTCATTTCACGTGGTCCATCGTCGATCCTGTCTTGAATCAAAAGGTAACCGTAAAGAT
> TTCAGGTCGCAAGGCCGTTTCACTCGCTGTCAACTGTTGATTAGCATAACCCATATCCAA
> ACAGTAACATACGCGGCTATACGAAAGATCTTCAGACCTAATGTAGCTGAGGCTTGTAGA
> TCCCGTCACCTTAGAATTCGAATCCACACGTCACTTATAATCCTAAGGGTGTGGTGTAGT
> GAAAGACCGCCGTCTCATTGTGCCGGTTTATTCTGACGTTATTGTTAAAACAGTTGACGT
> ACAGATGATTGAGAAATCCATTTGAATGCAGTTATAAGATGATTCGACGAGTTTTTAAAA
> CCAGCATAAACGGTATCCCGGTGAAATCTTTTTCCACTCAGTCTAGATTCAAAGGTTGGA
> ACAAAAATTATCACGAATTTCTATGATACGCATTGTGTAGTAAACATCACGTTCGTCGCT
> TACGTGTGTTTCTGAGGAGTAATCTGCATTAAATTTGAAGGCTAGCCTCGTATTTGCCAA
> TTATTCTTTTCGATCACAAACCACGTGCTGCGTAGTTCTAATGGGACAACTCCTACTTAG
> CAAACAGTAGACAAGTTTGGAACGCATATCTTCAATTTGAAGCCAGATTATCCAATGGTA
> GCACATACTTGTTGAAAATAAAAACCCCCACATGACAGTAAATAAAATAGCCAAGTAAGC
> ATGTTTATAAAGCATGTATCCTAGATCAGCAATTAGTGGTATCTACATATGCACTGCAAC
> TCGTACACGATGTCGGTCATAAATCTATGAAACACTTACTACGAATACGGGTTTGAACGG
> AATTAAATAGTCGAAAAATTTAAATTCGTCGGTAACGCAGATGTTGGTTATCCTCTAATT
> GGATATACGGATCACTAGGAGAGAGGGATGGACGCGTCGGTTACAGAGTAGCCAACACTA
> TAAAGACGCGCAGCAAGATGGAGTAATTTCCACTACTTCACCTCGACCAGCAGAAATAAA
> GCTGTTATTATACATCGGGACATGAAGGTTTTATTCTTGTGTATTAGACATCTTACATCT
> GTTGATAGATTGGGCTTAAAACGTTTTTGTATTAATTGTATCTTAGAGTGTCATCTTCTC
> AGTTCTGCGTAGCTGCTTCAATGCGTGCTTCCTTCTTCTCCGTATACCGACATCAGTTAA
> AATTTGTCGTACTGCCGACACTTACGAGATTCCAATTTAATATGACAGTTAAATGCGCGT
> GCGCTTTCAAACCTCTATCAGGATAGGCTCCTTCGACCATGACGCGCTCTGAGAGGAAGT
> ACTATTTGTTGGTGCTGAGATTTAAACTCCCCCCATCCACTTGGGATTTAGATTCTTCTA
> ATCACGGGGAAGCTCCCAAGCGGTCTTCATGGAGTCTCAAGGCTGGACAACTTAAAATCT
> GTTATCGGAATCACTTTGTCGGCTATATTAGGTGCTATTATTTATGCAAGATGCGACATC
> TTACTTTCATGGCAGTTCTGTCAACAGCCAAAAAGTAATCAGCCGTAAATAAATCCCTTG
> CGTGGTAATGGATCCAGAGTTATTCGTATTCCTTTATGAATCTGATTAAATCAGCATAGC
> AGAGGAAGCACGTGACCTTAGCACATAAAAGTATTGTTGCGAATGATTGTACAAGATGTA
> GTGGCAGTTTATGATATTAGTTGATCAGAATAACGAGATCGCATTGTAATTAATCGAAGA
> CATGACTCATGTAGTTACACCTGACTTTTCAGTTTATACAGAATATTCCCTTACGTAGGT
> TTTTTTGTTAAAGCAAAATTTACTTCGCAAGTCTTTAAGGTCGGGTTTTTCTATCGGAAC
> ACAGCTCTTTACTTATATAACCTCTCTTAGGTCTAGATTATGGTAATAAGTTTTAATATA
> CCTGGAAATTATCCCCGTCCAATCAGAAGATCATACCCATACATAGGTACTAGCGAATAT
> GTGAGATTGTTTATTGTTTTGTCTTCTGGGGAATCACCTTTTGGTCCTAATATTATGTAG
> TGACATTATCTAAATTATTCTGCATAGATTAATAACCAATGTTGGGTAATTCTCTGTCGA
> ATACCTCGTTCTCTATCTGAACTATATGTTATTGATAATGTTACGCTCATTCGGGTTTAT
> TCGCTCACGCTGCGAATGTAACTTCTGGTACAAGCGTTCGATGAATGCCACATATCTAGA
> ACAAATGACAAAATTGTTTATTTTTAGTAGCTCATAGTTGTCCTCAAGTTCTGACCACAA
> TATATAGCTTACCTAATGGCGGAACTTTGAGTGCGGGCTACCACAATATTCGATGCCTGA
> ACTCTTCGTACTGAGCCGCCATGATAGGCATGACACTAAGATGCTACTCTCCGGCGCATT
> CGGTAATTTGTCTAAATCCGTTGTGTTTAGGAAAACGAGTTAGCGCTCGATCTTTTTATT
> CTGTGCGTAGGTAACGTTGATGAATGTATCTCCAGCTCTGGAATTGACGCAGAGAACGGT
> GACCCTCAACCATAAGGTAACAAGATGCGAGGGTCCTTTATTCAGCGGCTCCTCGCTCCT
> GCAGCGAATTATTTCGGAACATTACTGGCTTACATTGAGCAAGTTCCAAATGGAATCTCC
> TACCAAGTGCCTAATGCACGGGTCAGAATTTCGGAGATCTAATATAAGAGTGTCTTCACG
> GAAACTACTTATTGATCCGATGACGAAACCTAACAGTAATTCACTCCGAGTATATTTCGT
> TTTAACCTTAACCAAATTCTGTTGTTACCATGTTACCGTGAAGGAGCAGGTTTCCCCGCC
> CAGTATCCCTTTGTCTCTAGGCTTCAGACTTAATCTATTACGCGACTACAACTGCTTTGG
> GTATTTAAGTCGTGATGATAGGTATTGGGTAATTCTGTGCGAGCACTTTTAAACATTCAC
> GGTCGCGTTCGCTATCGATTCCAACAATTTTGAGTAAGATTGCTTCTGTGATTTGCGAAC
> GGAATTAGCCTAATCGATTATAGTCCATCTTAGAAGCCTAATTTCTTTTCCATTTCCCCT
> GAAGACTCGAAGGCCGCTACCGACTACAGTCATACGACATTTATGAGCCGTGATAAAAGT
> GAAGGGGTCCGCCTTGACAACACATTCATGGAAAACTATTTAATTAAAAAGTCTGATGAT
> TGTCTATAGTAGGGCCCTCAATTGCAATTTGAGCACACTAAGCGATCTTATGACAGATGA
> CAGAGAAATTGTCGTCTACCGGTTTACCTGGAAATGTCTAGACTAAAATTTAGCAATTCT
> AAGTATCAACATTTAGTTACCGTAACTGGGCAAGAGACTGCATCTATTACCGCTGAGTTC
> TAGGTGAGATACTTTAAATGGAGTCCCCACCCGGACAAAAAGGAATGTTGTATACAATGT
> TCAGTTTGCTGATATATCGTTCACGGGGTTGATCTGATTAACTAAGATATAGGATTGCTT
> TTCTAGAAAAAATCGGCTATTAAGACCTGTATATTATATCGACCCGTTAAACTTCTCAAA
> TAGGTCGATATAAGCTCGATCGTCAAGTTATATGCGTATTGTTTATCCTGTCCAGGCATG
> GCATTAAGAGTTCGTGAACTCATACGATCACCCACTGTACTTTACATAGAGAAATTGTTA
> CTATTCTGATTAAGCCCTAACCTAATCTCCGAGATTACAACCTTTATAACCAACTACATA
> GTTCTATGGAACAAAAACCGCTTTTGAATTCGCCCACACCCATCCGGTTTATCACCTATT
> TTATACCAAAATTCTACTACAGCCAATTGTACCACCTGTACTTTTGTCTAAACGCGTAAG
> TGCGAGCGGGAAAACATTTTCGTAATCTGATTCACTAATTTTAATCACTCTGTAGATACC
> AACAACAGTTTTATAGGCCTTAATCGAGTATGAATTTCCATTTCTACTGACTTGCTGAGA
> CACATTCACTGTATCCTTACAAAGGAGTATTTCTAATGCACTTACTGATGACATTTACCC
> ATGATTTAATTATGCTACGACGTAAGTTGTAAAAGTACGAGTCTTTTAGTCTTTAGATAT
> TTATATATATACTCCTGGCGAAATTAATACTAATTGAAGCTGGTTTTTAGATTAAGGTGG
> GGTACTGTTATAATTGAAGACCTATTTGCTCTTCCATCCTTTGTAATTGTACCGAGTGTA
> CGATACACTCAGTCTATAAAGGAATTAGTACAAACCACGGAGCATTCAAGAATACGATTG
> CAACGCATGCTAGCTTATCATATAAACTTTAAACCTCGATGGCATATATTATGATATGAC
> GTGTCTCACCCTACTTTGACTGTTAAAAAATGCTACTGGCACAACAGTCCCAAGCTTGAC
> CTAATACATGAACTCGATGCAGATCGTATCCGGTGTATTTATCTCTCAGAACACGATCTC
> TACTGATGCACCCAGTAGATTTTTCTTTCTATGTGAGGTTTTTTTGCGACAGTACAAAGC
> GGCGATATAGTGAGTTACGACTGTCAGTCGAGAACTGGTTTATAGAAAAGTTGTGTTCTT
> CTAGCACCATGATTATTAACTAGCTTTTCACGAGGTTTATGACAATTCTAGCATTAATCG
> TCTAAAGGCCCGTACTTCTCTGCGCTGGCTAAAACTGAGACCCTCTCACGCCGCTTGTAG
> GTGAACTAATGGTAAGTATCCTGTGCCCCCACAGCCATGCATCCAATGTCTGGATAAAAC
> ACATCACATTGACACAACATTTGCATAACTAATATTCCTAGTAAATATATTCCTTTGACT
> ACCCCCACGTTAATGTACACCATGCGGCATTTAAGCGCGATATTATAAGCATTTATCAGT
> CGATTACTGTTTGCTCACTCCGCAGACTTCCGCGTCTTCGTAGCTTCAATTAATGATTAA
> TCTATGAGCTAGTCGAATCAACACCAGGTTTATGTATGTTATTTACGTAATACTGTAGAG
> ATCCATTGTATTGATCTTTATGCTCTTTACGAACCGCTTTGTAATTACGTTCGTAGCCCG
> TAGAATTCAGTCAACAATATTCTTCTGTTGCCTTTCACCTACTTTCCAGGTGAGCTGCCA
> GTCATAACCGAATTAAGTCTCTCTGAATAAGTAACGCATTCTATGATGATGAATCGTTCC
> AACCCGACGAGTTTCTACAATATAATACTAATCCTTAACTTAATATTTGTTTAGCTTGTC
> GTCCTAACTCAATCCGTCTTCAGTATAAATATGGATGCGTATAATTAATACTGGATCTCG
> AAATGAGTCCTTAATAGTCTAAACGTATTGAAGACAGGCCAAGCAGGTAATGACATATAC
> TTTCAGCGGATTTAACAAATTCGTTAGTATGCTAGATTACTCCCCGACCAAAATCTAGTG
> TCCGACGTTACTACGTTATCAGTTTCTACGATGGCATAATGTAGCCAGATTATTTGTATA
> GTCTTAAATTATATTTATAGTCAAGTATACCTACAATCTAGGACTTTCTTAATATTCTGG
> GTAAGTGGGACATAATCACATCAGCAGATATAGTATAAATCAACTCAAAAGAGAAATGCT
> CGTGATGTTGTACTACCAGCAATAACGAACGATAAATATTGGTTTTTAAGTAGACTACTT
> TTTGGCGGCCTATATCACTTTCAACGCTTATAACACTTGGCCAATATTGATGATAATTGA
> ATTTGAGATTTTGGCACACACGATTGGCACATGGATGACCCTATGTCATTAATTTATCGC
> GAAGGGGGATACGTTGGCAAACCGGATTACAAATAATTTCATTGTTATAGTATATGTGGT
> ATCATTTTATACTTATTACTACCCATTGCCTAAATTTGGTTCCCACCTAAGTTAGAGCAT
> GATCATGACGGTCGTATGACACGAAGTCATCTTATTTGTTATTAGCCGCTAACTGGTAAA
> GCTCGGGTTATAGCGGATGCTTGATCAGTTGTGCAATATAACCTTTTATAAAGTATGGTT
> AAAGTTACAAAACCTAATTATACTGCTAATTGGAACTATATGAAGCCTGTGAACTTGAAG
> ATATAGCGAAATAAGAAATCAATGCACCGGCGAGTATGCTAACTTGTATGATGTAGCTCA
> GATAATCGTCATCCGGGGAACTAAAATAAATACGCGGACGTAATATCAGCTTAAATTGGA
> AAATAGATCAGTTCGGTAAACATGATGTTCTGATAAGACACTAGCCTATTTAATTTTGGT
> CCGATGATAGTAGCGATAGTATCCCCAAGGATTTGTAACATGTTATATATGGCAGATAAC
> GCATACATTGTTCATGCGCGATCCAGGGAAATCTAAACTTATCAGTATAACGTCAAACTT
> TGCAATAGTAGACTTTACCTCGTCGGTATATATCGAAGAACGTGCATTACCAGGTCAATA
> CCACTTTCCTCGTAGTTAATGGGCCATTATACGATGTACAACCTTAGTAGAAGGTCGGGT
> CACCTAGGAGAAAACATTCCCTATACGTGTAATATATCTATATACGTCGGCACAAAGTGT
> GGTCTAATGAACTTTTATGTGACGTACCCACCTTCGGTTAACGACTGGAGATGGTGTCCG
> GTACGAAGTAGAACTGGCGCAACGCCAGACTTTAGGTTGTAAGATATTCATGCCAATTCC
> AGATATAAGCAGGAATGAGTGGCCATTAGAATAATAATTCACAGCATATCGGGTATCGAT
> AACCTTTTGAATTCCTGGGCAGGTTATGGCATAAAAAGAAACAATCTGAAAGATGCGGTC
> CTACTTGCGAAACAGATTTGTCTTAAGATACGTAATCAAGCCTATTGACTTATCAATATC
> GGTATACACAGAACACATCTAAAATTACAGAATAAGGTAGATATGTCCATATATTTCAAA
> TACACTGCGTTGAGAGGGGGGTCGTGTTCTGACCATCTCTATGTCTGTAGAACCCTGGGG
> AGCATTTTCACCCCCTTTACTTGGTGACATTAGTTCATTCCTTCATTTACAATGAACATC
> AATACCTGATGACACTAGCCTTGACGTCAATATTCATGGCGGACTACTCTGACACGGCGG
> ATCAGTACACAGACACATCCCAGCTTTTGGTTACTTGGTACATTACTATCGTTATGTGTT
> TTTAAAAGGAATCCCAAGAGATACCGTTAAAAAGCAGATTTCTCTCTTTCGCCTACATCT
> CAAAATTGCAAATGTATGAGTAGGTTTCTAGGTGATTTACGGAGGCACCCGAAGTTAGGA
> GATTCAGTGTTTTGATCCTGGACCTCAGCGACTCTTGTTTAAAGAGTTGTAAATCTCCTA
> GGTTACAATTCCCTGCATACGTAGTATTCCCGACCTTAACTAGAGTATGAACGGTCATGA
> GTGAGGTATTCGTGCCTTGAAGAACCTATAAGAAATTCAAATTACGCACGGAACAGTTAA
> GTCCTGTACAAATGGCAAGGTATGCGTCTTCAACGAGTTAGTATCTAGATACAATTAACT
> ATGAGAAACGAAATACTAATCTGTAAATATCGCTAAACGGGACAGCAAAAACACCTAGAA
> GTCATGTCCAAATAAGTAACGTATGGATTCCATTAATTCGCCGGCTAAAATAAAGTGTCC
> TCATGCATCGATCTATATATCAGAACCATACGCATTCATCGAAGTTATGAAGCCTCATCT
> CTTTGTTGAAGAGCTGTTTTATTCCTTTTGGATAACCCATGCTTTTGGCTAACCATGACT
> GGATATGACACTTACGTTGAATTTTCTCATTCGACCGGTAAAACTTGCTCCTGCGTGGAT
> TAAATCAATGCTTTAAAACTATATCGCGAGCGTTTTACCGAGAAGTTATCCGATAGACTT
> GAAAATGTAGGGAGGCGTCACCCACTCTTGCCCGTACTATCTCAAAGATAGTATCGAGAA
> GTCCCCAGCCATGTGCTTTGATTTTTGTTGTATCAAAACGATGTAGGTCAACCTTAACCC
> GTCCTGATATCTCCACCCGCACAGTGGAAGAATCATTTAGAATTGGTGATTGTGAAGTAA
> TATACAACCAAAGATATTTATAGACTCGATAAATATCAATGGTTTAAATTACCATTTAGG
> CTTTAATCGACACAAAAATCATGATTGACGACTGGTTTATAAATTCAGTCAATCGAGAAA
> CTTGCTTCTGAATCCCCTTCATTTATACTGTCTTAACAACTACCGCGCAAGCTGACAATT
> TTTCAGTGTAATTGATCACTCGCCCTGACCTCATTTATCTGGAATACCAATTAATCTACA
> AACCCTCTAACGTTTTACATGGTTTATCCTAACGGAACAACCACTTACCCCCTAGTCGGA
> TCGGGGTATCATTATCTGTAGCTAATGGATGATAGGTTAAAATGATTCATCACTTAACAG
> TTTCCCACCCTTACGGTGTTATTTATTGAACCGTCATTTGTTAATAATAATATTAGACTA
> GAAGAAGTTTTCCATCGATTAATTCAAGTATGAGACGGCACTCCAGGGGTTTGAATCAGG
> CCCGACCTTATGAAGATGTCAGGGCGGTTAAACCTAATCTTCCAGCGGAAGTCCGCACTG
> GCAAAACTCCTTAGCTGCTGAAGCTAGACTTTATAGCGTATACCATCCTGAGGAACGCTA
> AGATCCTATGTATAATGTTCTTATATTGTTTGACCTTATATGCAGTTTTTCATCTGGCAA
> TAGCCCTTATACATGTCTCAATTCAGGTATCAAGCAATAGATTACTTTTTTCAAAACCAT
> ATTTGCGGCATAAGCCACATCCACCACCAACTTCTATAGTCGCGTGCAGGGGAGTTCCCG
> CGGTCTACAAGCAGGAATGGTCAAGTTGGTCAAATGTCGTTGCAAACGTAAACTCTTGAT
> ACTAATCCTATGTAGGCCACATGCAATGTTTCTGGCCATAAGTTCATGGCGTCTGGTAAC
> TCCGGTGATAATTAGGAGATTCACTGCGCCGATATAATTACGAACATAAACTCAGTAAGA
> GAATTGAACCGTAGACCAAAAGGGAGTCTTTAGGAGTAGGCTAATCTATCCATGTGGTTT
> CACGCAGGGGAATAAAAATACTATTCCCAATAACATAATCCGAATAACAACAAATGTAGA
> CTCAACGAATTTTAATGTTAGCGTATGGCTGCTGCAGCAGTGTACGTGTCAGTACACTAT
> TCTGTGTAATCCAAAGAGGCGTTACTAAGACGAATTTCTACCTCAGGCGAGTGGATCTAT
> CGAACATATTTTCCGCCTAGTTTACAAAACTTCAGCAGAGCTTAAAAGGTCAGCAAGGGT
> TGGGAACGACATCGTTGGGAGATACCAGTGTTCAGGGATTATCTGTAAAACCAATCTGCT
> TAGCCTTTTTGAAAACCCAAAACAGGTGTGGTTGCAGAATAACACCTGAAATTTATGTTA
> CCACTTTGTACGTCCTAAGGGGCTTGAGTATTTTCATGGTTATCTATTTTTACTCATAAA
> AAATGAATATAATTGGCCAGGTCAGGTCTGGATCAATTTTTATAAAATCATATCATCAAA
> GCTAGCCATACAATCCAACGAAGCGAGATCTGTTATAGTACTTGTCTATATCTAACTGAT
> ATCTTATCCACTCTGTGCTAGACTACCATTTAGGTAGAATATGCTATCACAATGCTAGCC
> AAGATCTCAATGACTCGCTGACGTGATACTCTTGCTGTTTATCTTATTGAATATGAACCC
> CAAGAAAAAATCTATAGCGCATATGTGGACTTATGTTGGCAAAGGACTCCTTCGACCATT
> ATTTAGTGAATATTTACTTATTATCTTCCTCCGTTGAAATGTATTTGACGTATGAATTAT
> AGGAGTAGGCTAGTAAATAAGTCACGTTGCAATGATCGATTTGAGAATTCAAAGTTATCA
> AGTTCTCGTTGTCTGTGTGTCTGCCCTTACTGGAGTAAGGGCCAGTCGGAACCCATATCT
> GGGTCAGGATAGTGATTGTTAAAAGTCGGAAATCAACTAGTTTTACTACCTTCTATTACT
> ATGATGGCCCCATGGTGAGCCCGGACCAATGAAGGAATGGCATATATAGCAGGGTACTTT
> GGGAATTCCGAGTAGCACGTACCAACCTGTTTCTAAGATTCTGAGATTTGGTAGTAAAAA
> AGCTAAAAAGTCATATTGTATCTTGCAGAGGAAGCTTAGAGAACTTGCAGACGCTATAAT
> TCTAGGTTACGCTTCACATACGGATTTGCTACGCGGTGCAACTGATATGTATCTTTTTTA
> AATCGCAACCACATTTAACCTTTATTATTGGTATATTGCGTGGTATAAAGATATCGCGTG
> GCGGAATAGATCACTGCTGTGGAGGCCGGCTATGTTTTATTGGGGATTTCCTATCTAACA
> GGCTATATCCCTTTCGTTTCGTAACTTTATCCCAACATCTTATGGGTTATTTAATAGTCC
> CATCCTAAGTTGCCAATAAGTCTGAATTCCACCGTCTTAGTGGTGATGAAAATATTTTTA
> TGTATCATATTGTTAAGCCAGTTGCAGGCAACTGATTCTCTCTCGCTCGTTCCTTCGACG
> ACAGTAAAGAGCGATTTATAATAATATAGCTTCTAAGTGATTGACACTTCCTATGAGGCT
> GTCCTGATTATTGCTCTCGAATCATTAGGCTCTAACTGAACTCTGAACAAAAATAGGTCA
> ACGTATGTTAATTGCGATTTTTCTACACTCCCTGTATATGACTGTGAAATTGATACATTA
> TGAACGAAATCACAAACGTGTTGGAAAAGTTAGCGCTAAGCTCACGCACGCTTTAGGCAG
> TTAATGATGGGCGTTCGTAGCTCTAACCCTAACGTGTTATGCAAGATCTTCTATGACTGC
> ATCCAGTGTCTGCTAAGTCCCGACTATTGTCTACATTTATACTCCTACGCTTGCCTACTA
> AGCGGCTTTCTAATTACACCTGGACTGATGTGTTTTAAGTGATTGTTGTACTTTTTAACG
> TGATGTTGCTTAGATCTGGAAAATATTTGACAATAAGTGCCTGTTAATGATGCATTCTCT
> AGCTGGTTAGCCATTCCTTCACTAACTGACCTTAATGTGATTTTAGTGTCATGTCTCTGA
> CTTTAGGTTTTGGATTAAATTACTGAATTGTTGACCATGTCGCAAATAAGTCGAACGCAT
> GTAGGCGTGTTCCGACTGTGTAATAATCGATTAAATAAATGTAACAAAATGCCCTCTGGC
> TAGTGTTTGGCGCCTGGCATATTTGCATAAACGGCTACAATGCTACTAAAGTTGGGTCGG
> GTCAATAGAACATGTTAAGTATGTGTATGTGGCCTAATGTGATTGCGACCCTAGCCCTCA
> CTGACTATTTAGATGAATAGAATAAATTTTTACCGGTATACTCAATGTGAGTTATCCAGA
> GATAAAGACGTTTGAGGTATCCCATTGATATCGACATCAACCAAAAGTCACGAGCTCGCA
> GCAAAATTGCCTATACACAGTCCACACCGCATCCGATCTTCAAAGCTCCGACTCGACACT
> AAAGGTGACGTAGGCTAAATCTATAGTATATTTCGTAGAAGCGTAGGTAATCTTGTATTA
> CTGAATCAACACAATGAGAGTTGCTTACTCGATCTGAAATGCGAGTTTCTACGTAGATGT
> CGCAATAGAGAGCTTACTCTGTGCATTTCTTTTCTCGGCCTCCAGACTCGATAATCGCTT
> GAATCTAAACCGATCAGGATTGAGTGCACGGCGCAAGGACGTTTAAATAGAGGTAAAATG
> TTGATTACCATAAACCAGATCAATAAAGTTACAGTACCGGCTATAAGAAACATCTTCTCT
> AAGAATCTAGATGAGGAGGCGAGATCCAGTCAAATTACAATTCGTATCAACAACTAACTT
> AGATTCATTAGGGTGTGCTGTACTCAAAGACAGAAGTATAAGTCGCCACGTTGATTCGCA
> AGGTATGGTGTAAACAGTTCACCTTCAGTGCATTGAGAAATACATGTGTATGCTCGGTTA
> TCATGAGTACTAGAGTGGTTTATTCAAGCTGATTCGGTAGACCGGTGATATATTGGTACA
> CTCAGTCTAGATTAAAAGGGGGCATCTAAAATGTTCTCCAAGTGATATCATTCGCTTTCT
> GTAGTAAACATCAACTTCGTAGATTACCTGTCTTTCGGTGGTGTTTTAGCCTGTTAATTG
> GATGCCGAGAATCCTAGTTGCATATTATTCTGTGCCTGCAAAAAAATAGGCATGCGTACT
> GCTAAGCCGAAATAGACTACTTTGCAATCAGTAGAATACTGTCCATCGCATTGATTCAAG
> TGGAAGCAAGATTATACTAGGCGACATAATTCTGGTGCTTATTTAAAAACAACTCATGAC
> AGTATTGAATAGAGAAAAGTAAGCATCTGTATAATGAATCTATAATTGATCAGCAATTAC
> TGGTAGCGACTGTTGCAATGCAAAGACGACACGATCTCGCTCATAAAGATATGAAAAAAT
> TTCGTCGTATTCCGCGGTGAACGCATGTAATTACTCCTAATAGTGAAAGTACTCGGTAAA
> CCAGTTCTTGGTTATCATCTAAGTCCTTAGACCGATCACGACGTCACAGCGTTCGAACCC
> TAGGGTACAGACTTGCCTACTAGATAAACTCGCCATGATTCTTGCAGTTAGGTCATCTAA
> TTCTCAGACTCAACATCTTATAAAGCGCGGTTGAGAATGCGGGACATGTTGCGTGGTTTC
> TTGTGTATTTCAAATATGTCATAGGGGGAGTGATTCCGATTTAATCGTTTTGCTTGTTAG
> GGGATCTGAGTCTGTAATCGTATCTCTGCGGACTAGAGGCGTATTTCCGTCATTACTTCT
> GCGACCGATACCCTCATCAGTTAATATTGCTCCTAATGCCGACAATTAAGACAGTCCATT
> TTAATATGACTGGTTAATGCGCGGGCGCGTTCTAAACGCTAGCTGCAGAGCATACTGCCA
> CCATCTCGCGCTCTCAGAGGTAGTTCTATGGGGTGCTGCGCTGTGGTAAACTCCACACAG
> CCACTTGCGTTGTAGAGTCGTAGAAGAAAGGCCAAGCGAAAATGCGCTCTTAAGGGACGC
> TCAACGCTGGAATAATTATTATATCGTTTCCGAATAACGGTGGACCCTATATGTGGGGAT
> ATGAGTTTTCAAAGAGGCGAATTCTTAATTGCATGGAACTTCTCGATTCTGACAATATGT
> ATTCTGACGTAAAGAAAGCACGTGCGTCCTAAGGGATCCACAGGTATTCCGATTCATGTA
> TCAATATGAGGAATTCAGAATAGAACACCTACAAAGTGACAGTAGCAAATAAATGTTTTG
> GTCCCTATGATTCTAAATGATGGAGTCCAACTTTATGAGTTTTGTTGAGCAGTATAACGA
> GAGCGCTTGCGTATTAAGACTTGACATGAAGCATGTAGGTACTACTCTATTGTCAGTTTA
> GACAGATTAGTCACGTACCTTCCTTTTTTTCTTTATCCTAAATGTACTTACCAAGGCTTG
> AAGGTCCCGTTTTTCGATCGGAAAACACCTAGTGACTTATAGTAAAGCTCGTACCTATAG
> TTTATCCTAATTAGTTTTAATATTAATGCTAATTAGACACGTACAATCAGAAGTGCAGAC
> CCTTTCATAGGTAAGACAGAAGTTCTGAGTTTGTGGTGTGTGTGCTAGGATCGGCAATAA
> CATGTTGGTCCTAATTGTATGGAGGGACTGTATCTATTTTAGTCTGCTTTGTTTTTGTAA
> AAATGTTGGGGAATTCTCTCTAGTATACATAGGTCTCTATCGCAACGAGTTGTTATTGAT
> TAGCTTAACCTCAGTCCCGTGGTTTCGCTCACCCGGCGAATCGAACGTATGGGAATAGCG
> GTAGAGGAATGAAACATATCTTGAAAAAATCAATAATGTCTTGAGTGTTAGTAGCTCATA
> CTGCTAAGCTTGTGATGTCCAATATAGAGACCTTAACGAATGGCCGATATGTGTCTCCCG
> CCGTCCAAAATATTCGTTCACGCAACTCTTACGTATGTGCCGCCATGATTCCCATCAAAA
> TATCAGGCTAATCTACGGAGAAGTCCGTTATTTCTCTTTATCCCTTCTGGTTTGGAAATC
> GACTTTCCCATACATATTTTGATGCTCTGCGTAGCTAAACTTGATGAAGCGATCTCCTGC
> TATCCATTTGAACATGAGAAACGTCTCCAGAAACCATTAGGTATCAAGAGGAGACCGTAA
> TTTATTCAGACGATCATAGCTCAGGAACAGATGTATGTCGGTTAATTAATCGCGTAAAGT
> CACAATGGGCCAAATGGTATCTCCTACCATCTGAAGTATGCACGGGGCACTATTTCGCAG
> ATATAATTTAAGTCTCGCTGCAACGAAAAGAAGGAGTCTGAAGATCAAGTTTACTAACAC
> GAATTAACGCAGACGAGATTTCCTGGTTACCGGAACAATTTTCTGGTCTGAAAATCGTTC
> CGGGAAGCACCACGTTTACACCCAAAGTATACCTGTGTCGCTACCCTTAACAAGTATTAT
> ATTTACCGTCGACAAATCCTTTCCGTTTTTTAGTCCTGAGGTTTCGTATTCGGTAATTCT
> CTCCGTGATCGTTGATACAGTAAAGGTCGACTTAGATATAGTTGACAACTATTGTCACTA
> AGAGGGCTTCTGTGATTTGCCATCGCTATTAGCAGAATAGAGTTGACGCAATAGTAGATC
> AATATTTTCGGTGCCTGTTCCAAGCAAGTAGCGTACGACGCTACCGTCTAATCGCTTAAG
> AAATTTAGCAGCCCTGTTAAAACTCAAGGCCTCCGCAGTCTAAAAAAATTCATCGATAAA
> GATGTAATTATAAAGTAGGTTCATGCGCTAGAGGAGCGCCATCATGGGCTAGTTGTCCAA
> ACTAAGAGATCGTATGTAACAGGAAAGAGTAATTGGACTCTACACCTTTTACTGCAAATC
> GATAGTCGATATTTTACCAATTCGAAGTATCAAAAGGTAGTTAACGTATATGCCCATGAG
> ACTGCATATTGTACAGAGCACTTATACCGGACTTAATTTAAATGGACTAAAATAAACCAA
> TTATAGCTTTCTTGGATTCAATCTTCACTTGGCTCATAGTGCCGTATCGCGGTTCAGATG
> ATTATAGAAGATAGAGGATGGATTTGATACAATAAATCGCAGATTTTGAACTGTTTATGA
> GATCGACAAGTTAAACTTATCTAAGAGCTAGAGTTATGCGCGATCGTAAAGTGTTATCCG
> GAGTCGGTAGAATCTCATCCCATGCCTTGTAGAGTTCGGGATCGCTTACCTTCACCCAAT
> CTAATTTACAGACACTAAGTGTGACTAGTCTGATTTTCACCGAACCGAATATCACAGATT
> TAAACCTTTAGTACCTTATACATACTTCTATGGTACATAAACCCCTGTGGAATTCGACAT
> ATCCCATACCGTTTTGAACATATGTTTTTAAAAATTGCTTATAAACAATAGTCTACATCC
> GCGACGTTTGTCGAAAACACTAAGTCACTCAGCCATTAAATTTTAGTTATCTGTTTAACG
> AATGGTAAGCTCTAGCGTCAGAACATCAACTCGTTTATACGACTGTATACACGTGCAATG
> TACTTGGATACGCTCTTGAGGACTATATTTCAAGGTTTACTTTCATAGCAGTAGTTCTAA
> TGCACGTACTGTGGTAATTGAAAAAGGATTTAATTATCCGAAGACGTTTGGTCTAAAAGT
> ACGAGGATGGTACGATTTTCATATTTATATATTGACTCCTGCCGATATGTAGAATATTTG
> AAGCTCGTGTTTAGATTAAGCTGGCGTTCGCTGAGAATTGTAGAAATTTTGGCTATTCAA
> TCCTTTGTAATTGGAAAGACTCTAACATAAACTAAGGCTAGTAAGGAAGTACTAAAAAAA
> ACGGTGCATTATAGAAGTCCTGGCAAACGCTTCCTAGCTTATATTTGAAACGTTAAAACG
> CGTGGCATGATTGGTTCATAGGAAGTCTCGCTACCTACTGTGAATGTTAATAAAGCCTAC
> GGCCAAAAAAGTCCCAAGCTGCACCTTATTAATGAAATCGTTGCACAGAGTATCCCGTGT
> ATTTTTCTCTAAGAACAAGTTAGCGTCTGATCATAAATCTACATTTTGAGTGCGATGGGA
> GGGTGTTGTGACACAGGAAATACAGCCGTTATAGGGACTGTACACGCGCTGTCGAGAACT
> CCTTTTTTGATAAGTTGGGGTCTTATTGCTCAATCATGATTTTCTACCTTTTATAGAGCG
> TTATCAAAATTCTACCTTGAATAGTCTAAAGGACACTACTTCGCTCCCCTGCCGTTATAG
> GACACACTCTCACGCACCGTGGACCTGAAATAAGCGTAACTATCAGGTCACAAAAAACAC
> ATCCTTACATTCTAGGCAGAAAACAAATAACAGTCACAAAAAATTTGAATAAATAATATT
> CCTTGTTATGTTATTCCGTGCACTACCACCAACTTTATCGACACAAGCCGCATTTGTACC
> GAGAGTTGTTTAGCTTTTTTCAGTAGTGTTCTCGTTGCGAACTACGCACACGGACGCGGA
> GTAGTTGCTTCAAGGATGGAGTTATAGTTGACCTACGAGATTCTTCACCACCTTTATGTT
> TGTTAGGGACGGATGACGGTAGACATACATGCTTTTCATCTTGTTGCGATGTAACTAACC
> CTTTGTATTTACGTTCGGAGCCCGTTGATTTATGTAAACTATTTGCGTAGGTGCACTGGC
> AACTAATTTCCAGCTGTCCGCCCAGTATTATCAGAATTTACGCGCTATCAAGAACTATAC
> CATGCTAGCTTGAGGTTTCGTTCATTCCCGAAGACGGTCTAATAGTTAAGACTTATCAGG
> AACGTTATTTTTGGTGAGATGCTCCTCCTTAAGAATGCCCGATTAACGAGAAATATGGAG
> CCGTTTTTTTTATTATGCATCTCCATATGTGTCATTTATTCGATTATAGGTTTGTACACA
> GCACAAGAACGTATTGAAATTTAATGGAAGCGCAGTTAACTTATGAGTTAGTTTGATAGA
> GTACTCACAGACCAATATAGAGTGTCCGAACTGTATAAGTGATAAGTTGATAACTGCCCA
> GTATCGTGACAGTTTATTTCGATTCGCTTAATTTATTTGGATAGTAAACTATAACTAATA
> TATTCGTCTTTATTAATTGTATGGGTAAGGCCGTCAGAATCTAATCAGAACATTTAGTAT
> AAATCTACTATAAACAGAAATCCTACGGATGTTCTAATTAAACCTATTACGTTCGAGATT
> TATGCGTTTGTAACTACAAGACTTTTGCGCGGCCTTTATAAATTTCAAACCGTAGAACAC
> TGGCCAAATATTGAGCATAATGCTAGTTGAGTTTGTGGCTCAATCCAGTGCAAAATGCAT
> CACACTATGTCATTAAGTTTTCGCCAAGCGGGATTCCGGCCCAAACCCGATTACAATTAT
> TTTCATGCTTATTGTATTGCTGGGTTAATTTGATACGTATTTCTACCCTGTCACTAAATT
> TGGTTAACAAATAAGTTTCACCTGGTTAAGCTCCGGAGTATGACACGTAGTAATATTAGT
> TCTGTTTAGACCCTAAAGGCTAAAGATCCGGGTAGTCACGATGAGGCATCACTGGTGATA
> GATAAACTTTTTTAAAGTTTGGTTAAACGGACATTACATAATTAGACTGCGAAGTGCTAC
> GTTATCAAGCATGGGTAATGCATGTTAGACCGAATTTAGATATATATGAAAACGACACTA
> TCCTAACGTGTTTGATCTACAGCAGTTAATCCGCTTCCGGCGTAATAAAAGAAATTCGAG
> CTAGTTTGATAACCGTTTATGCCATTATAGAGCACTTAGCTTAACTTCATGGTATGTGAA
> CAAAATAGCATATGTAATTTGGGGAACAGCAGACTTCACAGTGTATCACCTAGGAGTTGT
> TAATTGTTATTTATCGAAGATAAACATTAAATTCTTATTCAGACATACAGCGATAGCTAA
> ACTTATCAGTAGAACCTCAAAATTTCAAATACTACTCTGGAACGCGTCCGTATAGATACA
> AGTACCTGAATGAACTGGTCATGACAAATTGACTCCTTGTTAATCGGACATTATTCGTTG
> TACTAAAGTTGGAGAAGGTAGCCTAACATTGGACATTACAGGCCAGTTACCTCTATGAGA
> GCGATTTACCGCGCCACTAAGTGGGCGAGAATGATCGTTTATGGGACGGAACCACATTCC
> GTTATCCTCTGCACATGGTGGACGCTTCGAAGTACAAATGGCCCAACCACACAAGGGAGG
> GTGTTAGATTTTATTGCAATGTCCTCTGATAAGAACGTATGACTGCACTTGACAATAAGA
> ATTCAAAGAAGATCGCCTTTCCTTAACATTTTCTATTCCGGGGCTGGTTATGGCTTTATT
> TCTTACAATCTCAATGATGCCCGCCTACTTGACAAACACATTTGTCGTAACTTTAGTTTT
> CTAGCCTTTTCAATTTTAAATTTACCTTTTCTAAGAAAACAGCTAAAATTAATGAATAAC
> CTTCATAGCGACATTTATGTCTTTTAAACGCAGGTGTGAGGGCGGTACTGTTATCACATT
> AGCGTGCGATGGACAAAAAGGGCCAGCAGTTGCAACCCAGTGAATGGGTGACATGTCTTA
> TTTAAGTCAGTTACAATCAACTTCTTTAAAGGAGGACAATACACTGGACCTCAATATTAA
> GGCCGGAATACGCTGTAAAGGACCATCTGTTCTATGTCAAATAACAGATGTTGGTTACGG
> CCTAAATTAATATCCGTTTCTGTGTTTTATAGCAATCAAAAGACATACAGTGTTATAGCT
> CATTTATCTCGGTCGCCTTCATCGAAAAATTGCAAAGGTATCTCTACCTGGATTCGTGTT
> TGAAGGACCCAACCCATGTTTCGACATGCACTGTTTTGATAATGCACAGCAGCGAATCTT
> GTGGATTGAGTGGTAAATCTCCTACGGGTCATTTCCATCAATACGTACTATTAAACAACT
> TTAATAGTCTATCTACCCTCTTCACGGAGGTATGAGTGCCTTGAACTTACTATATGAAAT
> TCATATTACGCAACGAAAAGGGAAGTAAGGTACAAAGCGCTTCCTAGCCGGCTGCAACGA
> GTGAGTATCTAGAGTCTTGTAAATTTGACTATAGAATTTCTATGATGTAAATATCGATTA
> ACCGCAAACCTTTAAAACCTACATGTATGGTCCTTATAACGAACGTAGGGATGCCATGTT
> GGAGAAGGCGAAAATTAACTCGCCGAATCATTCCTTCTATATTTATGTTACAGACGCATT
> CATCGAAGTTAGGATGAATCATATCTTGGTTGAAGAGCGCTTTGAGGCATGTGGCAGAAC
> ACATGCTTGTGCCTAAACTTCACTGGATATGAAAATTAACTTCAATGGTCTCTTTCGAAC
> CGGATTACGGGCTACTCCGTGGAGGAAATAAAGGCTTTAATTCTTTAGCGCGAGCGTTGG
> AACCACTTGGTTTAAGATACACTTGAATATGGAGGCAGGCCGCACCCACTCGGGCCACTT
> ATTTCTCTATGAGTGTAGCCAGAACTCCCAACAAATGTGCTTTCATTTTTCTTGTAGCAA
> ATAGATGTAGCTCAACCGGATCCCGGCCTCATAGCTCAAACAGCTCAGTCGAACAAGCAG
> TTACAAGTCGTGATTGGGAAGTTATATAAAACATATGAGAGTTATTGACGACATAAAGAT
> ATATGGTTTAAATTACCAGGTTCGAGTTTTTCGACAAAAAATTCATGATGGAAGACTCGT
> GTATTTTTTATCTCATTAGACTAAAGTGCTTATGTAGCCCATGCATTGATTCTCTAGTAT
> ATTCTTCCGAGAAACCGGTAAAGTTGTAAGGGTAAGTCTTCACTACCAATCACATCATTT
> AGCTCCAAGACCTATTATTCTACATACAATATAACGTTTTACTTCGTTGATCATTACGGT
> ACATCAAATTTCAAACTACTAGGATACGGCGATCAGTTTAGGTAGATAATGGTTCTTAGC
> GGAATATCTTTAATCAATTAAATGGTTAAAACCATGAAGCGGGTATGTATTGATCACTAT
> TTTGTGATTTAGTATAGTTGACTACTAGATGGTTTACATCGTTTAATGCAAGTATGACAA
> CCCAATCCACGCGGTTGAATAAGCCCCCACCGTATCAAGAGGGAAGGGACCGTATAACGA
> TTCTTCCAGCGCAAGTCACCACTGGCAAAACGAATTAGCTGATGAAGCTACTATTGTGAC
> CGGATAACATCATGACGATCGCTATCATCATATCTATAATGTTCTTAGAGTGTTGCTAAT
> TATATGCTCTTTGGCTGCTGCCATTACACCTGATTCATCTATCTTTTCAGGGTTCTTCAA
> AGTCATGACTTTTTTAATAACCATAGGTGCGGCAGAAGCATATTCATAAAAAATAGTCGA
> TTGTAGACGCAAGGGGACTTACCCAGCTATTATTCCTCCAATCCTAATGTTGGGATAATG
> TAGTTGAAAACCTAAACTATTGAGACTTAGAATATGTAGCCAAAATGCTATGTTGATGCA
> AATTTGTTCTTGGAGGATGGTAAATCCGCGGAGTTTTTGGTCTGTATCTGACCACAGAGA
> ATTAACATCAGAAAAGAAGTAACTGATTTGTTCCGGACACCAAAAGGCTGTCTTTTCGAG
> TTGGATATTCGAGCAAGGGGGTTGAACGCAGCGGAAGTTTATGACTTGGCCAATTATCAG
> ATTCCGTAGAACAACTATTGGTGTATCATAGAAGTGGTAGCTTAGAGGAGGCATGATGAA
> CAACTCTACCGCGAAGTTAACTATGCGGTGTATTAAATTCAGGCCTGAATAACAAGAATT
> TAGACATATCCACTGTGCTTCTTTCCAAATTAGTTGCCGCCTAGTTTAAAATACTGAACA
> ACTGCTTTAAACGTCACAAAGGGTGGGGTACGTAAGAGGGGCGTCAGACAACTGGTATCG
> GATTATCTGTATATACAATATCCTGAGACTGTTTGAAAACCATAATAACGTGTGGTTCAA
> CAATATCAACTCAAAGTGATGGGACCACTTTCTACGTCCGATCGGCCTTCAGGTTGTTCA
> TCCTTATCTATTTTGACTAATAATTATTGAATTGATTTGGAAACGTATCCTATGGATAAA
> GTTTTATTAAAGCAGATCATATATGCTTCACATTCATTCAAAAGTTCAGTGAGATCTTAT
> ACGACTTCTATTTTTCTAAATCTTATCGGATACACGCTCTCATAGACGACATGTGAGCTA
> CAATTTGATTTCACAATGATAGACATGATCGCAAGCACTCCCTGTCGTCAGACTCTTCCT
> GTTTATATGATGGAAGATGTACCCAAACATTAATGCGTTAGACCATAGCTGCAATGATGT
> TCCCATACCAAGAATTCGAACATGTTTTACTGAATTGTTTCTTAGGTTCTTAATCCGTGC
> TATGGGATTGCAAGTATGATTTTTAGCACTAGGATAGGAAAGAAGTAACCTGCAAATGAT
> CGAGTTGAGAATGCTATGTTAGAATGTTCTCCGTGTATGTGGCTCGGACCTGACTGGTGT
> ATGGCACTCGAGGAACCCTTAGAGGCGTAAGGTTACTCATTGTTAAAAGTCCCATTTAAT
> CTACTTTTAAGAAATTCTTTGAATAGGATGGCACCATCGGCAGACAGGAAAAATGTAGGA
> ATGCATTAGATAGATCCGTTCTTTGGGAATTCCGACTAGAAACTTCCAACATGTTTATAA
> CTTGCTGAGATGTGCGTCGTAAATAGCTTTAAAGGAAGTTTGTTTCTTGCAGAGGAACAG
> GACAGAACTTCAAGTCCAGAGAATTATAGCTTACGATTCACTTTCGCATGTGCTACGCCG
> GCCAACTCTTATCTATCTTTTTTTTAGACAATCAACATTTAAACTTTAGTTTGCCTATAG
> TGAGTGGGTGTAAGATATAGCCTCCAGGAAGACATAACTCCTGGGGAGGCAGCATTTGTG
> TTATTGCGGATGTCCTATATTACTGCCTTGAGAAAGTTCGTTTAGGTACGGTATCCAATA
> ATCGTTTCGGTGATGTTAGAGTAAAATCCTAAGTTCCCAAGATGTCTCAATTAAACCCTC
> TTACTGCTGTGGAATTTATTTGTATGTATCAGAGGCTGAAGAATGGTGCAGCAAACTGAT
> TATATAGAGCGCGTTACTGCCTCCAAACTTAAGAGAGAGTTATAATTATAGAGAGTATTA
> GGGATTGAAAAGTCCTATCACGCTGTCCTGAGTATTCCTATCGATGATGTTGGCGCGAAC
> TCTACTAGCATCTAATATAGCTCATCCTATCTTATTGGCGATTTTGATAAAAGACATGTA
> TATGAATGTGAAATTGATAAAGTAGGAACGAAATCACAATACGCTGCCAATACTTTCCGC
> TATCCTAAAGATCCATGGAGGCAGGTAATGATGCGCGTGCGTACCTCGTTAAAGATAGTG
> TTATGATTGATCTTCTTTCTCTGAAGAAAGGGTATGCTTTCTCACCAAGATTGGCGAAAT
> TGATACTCCGAAGATTGAATACTAACACCCTGTCTATTTTCACCGCGTCTCATGTGTTTG
> TAGGGATTCTTCTACGTTGGTTAGGGATCTTGCGTACTTCTGCAAATGATTTGACAATAA
> GGCCATCTTAAGGATGCTGTCTCGAGAGCGTTACCCTTTAATGAAAGTACTCAACGGTTG
> CGCTGTGTAGGGTCATCTCTCTCAATGTACGTTTTCCTGTATATTAATCTATTGTTCACA
> TGCTAGCATATAACTCGTAAGCATGTAGGAGTCTGAAGAAGCTGTAATAAGCCTGTAAAG
> AAATCTTACAAAATGAACTATGGATACTCTTGGGCCCCTCGATTATTTCAATAAAACGCG
> AAAATCCGTCTAATGTTGCGTAGCCTCAAGACAAATTGTGAAGTATCTCTAGCTGGAAGA
> TTGTGATTGACAAAATTGCCCTCACTGAATATTTTCTTGTAGTCTTTAAAGGTTTACCGG
> TTTAATCAATGTGAGTTTGAAACAGATAAAGTACTTTCAGCTATACATTGCATATCCTAT
> GCATCAAAAACTAAAGTGCTCGAACCAATATGGCCGATACTCACTCATCTAAGAATCCCA
> TCTGCAAACAGACGACTAGACAATTAACCTGAAGTTGGCGTTATCTATAGTTTAGTTCGG
> ACTAGAGGTCGGTATATTCTATTAAGGAATCTAATCTAGCTGACGTCCTGACTCGAGCTC
> AAATGCGACGGTATACCTACATGTCGAAATACACTGCGGTATCGGGGCATGTATTGGATA
> CGCCTAAAGACGACATAAGCGATTGATT