source code
/* The Computer Language Benchmarks Game
* https://salsa.debian.org/benchmarksgame-team/benchmarksgame/
*
* contributed by The Go Authors.
* Based on C program by Joern Inge Vestgaarden
* and Jorge Peixoto de Morais Neto.
* flag.Arg hack by Isaac Gouy
*/
package main
import (
"bufio"
"flag"
"os"
"strconv"
)
var out *bufio.Writer
var n = 0
const WIDTH = 60 // Fold lines after WIDTH bytes
func min(a, b int) int {
if a < b {
return a
}
return b
}
type AminoAcid struct {
p float64
c byte
}
func AccumulateProbabilities(genelist []AminoAcid) {
for i := 1; i < len(genelist); i++ {
genelist[i].p += genelist[i-1].p
}
}
// RepeatFasta prints the characters of the byte slice s. When it
// reaches the end of the slice, it goes back to the beginning.
// It stops after generating count characters.
// After each WIDTH characters it prints a newline.
// It assumes that WIDTH <= len(s) + 1.
func RepeatFasta(s []byte, count int) {
pos := 0
s2 := make([]byte, len(s)+WIDTH)
copy(s2, s)
copy(s2[len(s):], s)
for count > 0 {
line := min(WIDTH, count)
out.Write(s2[pos : pos+line])
out.WriteByte('\n')
pos += line
if pos >= len(s) {
pos -= len(s)
}
count -= line
}
}
var lastrandom uint32 = 42
const (
IM = 139968
IA = 3877
IC = 29573
)
// Each element of genelist is a struct with a character and
// a floating point number p between 0 and 1.
// RandomFasta generates a random float r and
// finds the first element such that p >= r.
// This is a weighted random selection.
// RandomFasta then prints the character of the array element.
// This sequence is repeated count times.
// Between each WIDTH consecutive characters, the function prints a newline.
func RandomFasta(genelist []AminoAcid, count int) {
buf := make([]byte, WIDTH+1)
for count > 0 {
line := min(WIDTH, count)
for pos := 0; pos < line; pos++ {
lastrandom = (lastrandom*IA + IC) % IM
// Integer to float conversions are faster if the integer is signed.
r := float64(int(lastrandom)) / IM
for _, v := range genelist {
if v.p >= r {
buf[pos] = v.c
break
}
}
}
buf[line] = '\n'
out.Write(buf[0 : line+1])
count -= line
}
}
func main() {
out = bufio.NewWriter(os.Stdout)
defer out.Flush()
flag.Parse()
if flag.NArg() > 0 { n,_ = strconv.Atoi( flag.Arg(0) ) }
iub := []AminoAcid{
AminoAcid{0.27, 'a'},
AminoAcid{0.12, 'c'},
AminoAcid{0.12, 'g'},
AminoAcid{0.27, 't'},
AminoAcid{0.02, 'B'},
AminoAcid{0.02, 'D'},
AminoAcid{0.02, 'H'},
AminoAcid{0.02, 'K'},
AminoAcid{0.02, 'M'},
AminoAcid{0.02, 'N'},
AminoAcid{0.02, 'R'},
AminoAcid{0.02, 'S'},
AminoAcid{0.02, 'V'},
AminoAcid{0.02, 'W'},
AminoAcid{0.02, 'Y'},
}
homosapiens := []AminoAcid{
AminoAcid{0.3029549426680, 'a'},
AminoAcid{0.1979883004921, 'c'},
AminoAcid{0.1975473066391, 'g'},
AminoAcid{0.3015094502008, 't'},
}
AccumulateProbabilities(iub)
AccumulateProbabilities(homosapiens)
alu := []byte(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
out.WriteString(">ONE Homo sapiens alu\n")
RepeatFasta(alu, 2*n)
out.WriteString(">TWO IUB ambiguity codes\n")
RandomFasta(iub, 3*n)
out.WriteString(">THREE Homo sapiens frequency\n")
RandomFasta(homosapiens, 5*n)
}