source code
-- The Computer Language Benchmarks Game
-- https://salsa.debian.org/benchmarksgame-team/benchmarksgame/
--
-- contributed by Pascal Obry on 2005/04/07
-- modified by Gautier de Montmollin
-- modified by Georg Bauhaus, Jonathan Parker (July 2011)
with Ada.Command_Line;
with GNAT.Float_Control;
with Sequence.Data, Sequence.Creation;
procedure Fasta is
N : constant Positive := Positive'Value (Ada.Command_Line.Argument (1));
use Sequence.Data, Sequence.Creation;
Runner : Environment;
begin
GNAT.Float_Control.Reset;
Make_Repeat_Fasta (">ONE Homo sapiens alu", ALU, N*2);
Make_Random_Fasta (">TWO IUB ambiguity codes", IUB, N*3);
Make_Random_Fasta (">THREE Homo sapiens frequency", Homosapiens, N*5);
end Fasta;
package Sequence.Data is
pragma Pure (Data);
Homosapiens : constant Nucleotide_Set(0..3) :=
(('a', 0.3029549426680), ('c', 0.1979883004921),
('g', 0.1975473066391), ('t', 0.3015094502008));
IUB : constant Nucleotide_Set(0..14) :=
(('a', 0.27), ('c', 0.12), ('g', 0.12), ('t', 0.27),
('B', 0.02), ('D', 0.02), ('H', 0.02), ('K', 0.02),
('M', 0.02), ('N', 0.02), ('R', 0.02), ('S', 0.02),
('V', 0.02), ('W', 0.02), ('Y', 0.02));
ALU : constant String :=
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" &
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" &
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" &
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" &
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" &
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" &
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
end Sequence.Data;
with Ada.Finalization;
package Sequence.Creation is
procedure Make_Random_Fasta
(Title : in String;
Nucleotides : in Nucleotide_Set;
N : in Positive);
procedure Make_Repeat_Fasta
(Title : in String;
S : in String;
N : in Positive);
type Environment is new Ada.Finalization.Limited_Controlled
with null record;
private
overriding
procedure Initialize (Active : in out Environment);
overriding
procedure Finalize (Active : in out Environment);
end Sequence.Creation;
package Sequence is
pragma Pure (Sequence);
type Real is digits 15;
type Nucleotide is record
C : Character;
P : Real;
end record;
Max_Length_of_Code : constant := 15;
subtype Nucleotide_Index is Integer range 0 .. Max_Length_of_Code-1;
type Nucleotide_Set is array (Nucleotide_Index range <>) of Nucleotide;
end Sequence;
with LCG_Random;
with Line_IO;
package body Sequence.Creation is
package Real_Random_Nums is new LCG_Random (Real);
use Real_Random_Nums;
overriding
procedure Initialize (Active : in out Environment) is
begin
Line_IO.Open_Stdout;
end Initialize;
overriding
procedure Finalize (Active : in out Environment) is
begin
Line_IO.Close_Stdout;
end Finalize;
Line_Length : constant := 60;
End_of_Line : String renames Line_IO.End_of_Line;
subtype Line_End_Positions is Positive
range Line_Length + 1 .. Line_Length + End_of_Line'Length;
Line_Buffer : String (1 .. Line_Length + End_of_Line'Length);
Nucleo_Cumulative : array (Nucleotide_Index) of Nucleotide;
procedure Make_Random_Fasta
(Title : in String;
Nucleotides : in Nucleotide_Set;
N : in Positive)
is
function Random_Nucleotide return Character is
r : constant Real := Gen_Random (1.0);
Result : Character := 'J';
begin
Choose_Random:
for i in Nucleo_Cumulative'Range loop
if Nucleo_Cumulative(i).P > r then
Result := Nucleo_Cumulative(i).C;
exit Choose_Random;
end if;
end loop Choose_Random;
return Result;
end Random_Nucleotide;
Sum : Real;
Remaining_Chars : constant Natural := N mod Line_Length;
No_of_Full_Lines : constant Natural := N / Line_Length;
begin
Line_IO.Print (Title & End_of_Line);
Nucleo_Cumulative := (others => ('j', 2.0));
for k in Nucleotides'Range loop
Nucleo_Cumulative(k).C := Nucleotides(k).C;
end loop;
Sum := 0.0;
for k in Nucleotides'Range loop
Sum := Sum + Nucleotides(k).P;
Nucleo_Cumulative(k).P := Sum;
end loop;
Line_Buffer(Line_End_Positions) := End_of_Line;
for k in 1 .. No_of_Full_Lines loop
for i in 1 .. Line_Length loop
Line_Buffer(i) := Random_Nucleotide;
end loop;
Line_IO.Print (Line_Buffer);
end loop;
if Remaining_Chars > 0 then
for i in 1 .. Remaining_Chars loop
Line_Buffer(i) := Random_Nucleotide;
end loop;
Line_IO.Print (Line_Buffer(1 .. Remaining_Chars) & End_of_Line);
end if;
end Make_Random_Fasta;
procedure Make_Repeat_Fasta
(Title : in String;
S : in String;
N : in Positive)
is
S_App : constant String := S & S(S'First .. S'First + Line_Length);
Pos : Positive := S_App'First;
Remaining_Chars : Natural := N;
No_of_Chars_Output : Natural := 0;
begin
Line_IO.Print (Title & End_of_Line);
while Remaining_Chars > 0 loop
No_of_Chars_Output := Integer'Min (Remaining_Chars, Line_Length);
Line_IO.Print (S_App (Pos .. Pos + No_of_Chars_Output - 1));
Line_IO.Print (End_of_Line);
Remaining_Chars := Remaining_Chars - No_of_Chars_Output;
Pos := Pos + No_of_Chars_Output;
if Pos > S'Last then
Pos := Pos - S'Length;
end if;
end loop;
end Make_Repeat_Fasta;
end Sequence.Creation;
package Line_IO is
procedure Print (Item : String);
procedure Close_Stdout;
procedure Open_Stdout;
End_of_Line : constant String := (1 => ASCII.LF);
pragma Inline (Print);
end Line_IO;
with Ada.Streams.Stream_IO;
with Unchecked_Conversion;
package body Line_IO is
use Ada.Streams;
Stdout : Stream_IO.File_Type;
procedure Print (Item : String) is
subtype Index is Stream_Element_Offset range
Stream_Element_Offset(Item'First) .. Stream_Element_Offset(Item'Last);
subtype XString is String (Item'Range);
subtype XBytes is Stream_Element_Array (Index);
function To_Bytes is new Unchecked_Conversion
(Source => XString,
Target => XBytes);
begin
Stream_IO.Write (Stdout, To_Bytes (Item));
end Print;
procedure Close_Stdout is
begin
Stream_IO.Close (Stdout);
end Close_Stdout;
procedure Open_Stdout is
begin
Stream_IO.Open
(File => Stdout,
Mode => Stream_IO.Out_File,
Name => "/dev/stdout");
end Open_Stdout;
end Line_IO;
generic
type Real is digits <>;
package LCG_Random is
function Gen_Random (Max : in Real) return Real;
-- Linear congruential random number generator.
-- Period = 139_968, with output in [0.0, 1.0) if Max = 1.0.
end LCG_Random;
package body LCG_Random is
pragma Assert (Real'Digits > 5);
type Random_State is mod 2**32;
State : Random_State := 42;
type Signed is range
-2**(Random_State'Size-1) .. 2**(Random_State'Size-1) - 1;
function Gen_Random (Max : in Real) return Real is
IM : constant := 139_968;
IA : constant := 3_877;
IC : constant := 29_573;
begin
State := (State * IA + IC) mod IM;
return (Max * Real (Signed (State))) * (1.0 / Real (IM));
end Gen_Random;
end LCG_Random;